diff --git a/.github/workflows/build.yml b/.github/workflows/build.yml index 1d1cbf6f8..0005abfa8 100644 --- a/.github/workflows/build.yml +++ b/.github/workflows/build.yml @@ -40,12 +40,18 @@ jobs: # Only generate the distribution if this is the default branch GENERATE_DIST: ${{ env.DEFAULT_BRANCH == github.ref_name && '1' || '0' }} - - name: Publish Release + - name: Publish Latest Release + id: publish-release if: ${{ env.DEFAULT_BRANCH == github.ref_name && github.event_name == 'push' && github.base_ref == '' }} - uses: "marvinpinto/action-automatic-releases@latest" - with: - repo_token: "${{ secrets.PAT }}" - automatic_release_tag: "latest" - prerelease: true - title: "Development Build: ${{ env.DEFAULT_BRANCH }}" - files: /home/runner/work/_temp/_github_home/lkDist/discvr/DISCVR-* \ No newline at end of file + env: + GH_TOKEN: "${{ secrets.PAT }}" + run: | + LK_VERSION=$(cat /home/runner/work/_temp/_github_home/lkDist/release.txt | sed 's/-SNAPSHOT//g') + cd /home/runner/work/_temp/_github_home/labkey_build/${LK_VERSION}/server/server/modules/DiscvrLabKeyModules + COUNT=$(gh release list | grep 'latest' | wc -l) + if [ $COUNT != '0' ];then gh release delete 'latest' --cleanup-tag -y; fi + + git push -f origin "latest" + + gh release create 'latest' --verify-tag --generate-notes --prerelease --title "Development Build: ${{ env.DEFAULT_BRANCH }}" + gh release upload 'latest' /home/runner/work/_temp/_github_home/lkDist/discvr/DISCVR-* \ No newline at end of file diff --git a/.github/workflows/build_latest.yml b/.github/workflows/build_latest.yml index dfe4bc088..f194da930 100644 --- a/.github/workflows/build_latest.yml +++ b/.github/workflows/build_latest.yml @@ -36,13 +36,18 @@ jobs: env: GENERATE_DIST: 1 - # See: https://github.com/marketplace/actions/automatic-releases - - name: Deploy Build - if: ${{ env.DEFAULT_BRANCH == github.ref_name }} - uses: "marvinpinto/action-automatic-releases@latest" - with: - repo_token: "${{ secrets.PAT }}" - automatic_release_tag: "latest" - prerelease: true - title: "Development Build: ${{ fromJson(steps.get_default_branch.outputs.data).default_branch }}" - files: /home/runner/work/_temp/_github_home/lkDist/discvr/DISCVR-* \ No newline at end of file + - name: Publish Latest Release + id: publish-release + if: ${{ env.DEFAULT_BRANCH == github.ref_name && github.event_name == 'push' && github.base_ref == '' }} + env: + GH_TOKEN: "${{ secrets.PAT }}" + run: | + LK_VERSION=$(cat /home/runner/work/_temp/_github_home/lkDist/release.txt | sed 's/-SNAPSHOT//g') + cd /home/runner/work/_temp/_github_home/labkey_build/${LK_VERSION}/server/server/modules/DiscvrLabKeyModules + COUNT=$(gh release list | grep 'latest' | wc -l) + if [ $COUNT != '0' ];then gh release delete 'latest' --cleanup-tag -y; fi + + git push -f origin "latest" + + gh release create 'latest' --verify-tag --generate-notes --prerelease --title "Development Build: ${{ env.DEFAULT_BRANCH }}" + gh release upload 'latest' /home/runner/work/_temp/_github_home/lkDist/discvr/DISCVR-* \ No newline at end of file diff --git a/QueryExtensions/build.gradle b/QueryExtensions/build.gradle new file mode 100644 index 000000000..8a83d15d3 --- /dev/null +++ b/QueryExtensions/build.gradle @@ -0,0 +1,9 @@ +import org.labkey.gradle.util.BuildUtils + +plugins { + id 'org.labkey.build.module' +} + +dependencies { + BuildUtils.addLabKeyDependency(project: project, config: "modules", depProjectPath: ":server:modules:DiscvrLabKeyModules:discvrcore", depProjectConfig: "published", depExtension: "module") +} diff --git a/QueryExtensions/module.properties b/QueryExtensions/module.properties new file mode 100644 index 000000000..3044be8be --- /dev/null +++ b/QueryExtensions/module.properties @@ -0,0 +1,5 @@ +ModuleClass: org.labkey.queryextensions.QueryExtensionsModule +Label: Query Extensions +Description: This module contains low-level extensions to the LabKey Query layer +License: Apache 2.0 +LicenseURL: http://www.apache.org/licenses/LICENSE-2.0 diff --git a/QueryExtensions/resources/schemas/dbscripts/postgresql/queryextensions-0.00-23.000.sql b/QueryExtensions/resources/schemas/dbscripts/postgresql/queryextensions-0.00-23.000.sql new file mode 100644 index 000000000..c9855ba77 --- /dev/null +++ b/QueryExtensions/resources/schemas/dbscripts/postgresql/queryextensions-0.00-23.000.sql @@ -0,0 +1,19 @@ +/* + * Copyright (c) 2023 LabKey Corporation + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +-- Create schema, tables, indexes, and constraints used for QueryExtensions module here +-- All SQL VIEW definitions should be created in queryextensions-create.sql and dropped in queryextensions-drop.sql +CREATE SCHEMA queryextensions; diff --git a/QueryExtensions/resources/schemas/dbscripts/sqlserver/queryextensions-0.00-23.000.sql b/QueryExtensions/resources/schemas/dbscripts/sqlserver/queryextensions-0.00-23.000.sql new file mode 100644 index 000000000..d12b98db4 --- /dev/null +++ b/QueryExtensions/resources/schemas/dbscripts/sqlserver/queryextensions-0.00-23.000.sql @@ -0,0 +1,20 @@ +/* + * Copyright (c) 2023 LabKey Corporation + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +-- Create schema, tables, indexes, and constraints used for QueryExtensions module here +-- All SQL VIEW definitions should be created in queryextensions-create.sql and dropped in queryextensions-drop.sql +CREATE SCHEMA queryextensions; +GO \ No newline at end of file diff --git a/QueryExtensions/resources/schemas/queryextensions.xml b/QueryExtensions/resources/schemas/queryextensions.xml new file mode 100644 index 000000000..867c4794c --- /dev/null +++ b/QueryExtensions/resources/schemas/queryextensions.xml @@ -0,0 +1,20 @@ + + + \ No newline at end of file diff --git a/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsController.java b/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsController.java new file mode 100644 index 000000000..95772162d --- /dev/null +++ b/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsController.java @@ -0,0 +1,37 @@ +/* + * Copyright (c) 2023 LabKey Corporation + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +package org.labkey.queryextensions; + +import org.labkey.api.action.SimpleViewAction; +import org.labkey.api.action.SpringActionController; +import org.labkey.api.security.RequiresPermission; +import org.labkey.api.security.permissions.ReadPermission; +import org.labkey.api.view.JspView; +import org.labkey.api.view.NavTree; +import org.springframework.validation.BindException; +import org.springframework.web.servlet.ModelAndView; + +public class QueryExtensionsController extends SpringActionController +{ + private static final DefaultActionResolver _actionResolver = new DefaultActionResolver(QueryExtensionsController.class); + public static final String NAME = "queryextensions"; + + public QueryExtensionsController() + { + setActionResolver(_actionResolver); + } +} diff --git a/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsManager.java b/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsManager.java new file mode 100644 index 000000000..62994f0b3 --- /dev/null +++ b/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsManager.java @@ -0,0 +1,32 @@ +/* + * Copyright (c) 2023 LabKey Corporation + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +package org.labkey.queryextensions; + +public class QueryExtensionsManager +{ + private static final QueryExtensionsManager _instance = new QueryExtensionsManager(); + + private QueryExtensionsManager() + { + + } + + public static QueryExtensionsManager get() + { + return _instance; + } +} \ No newline at end of file diff --git a/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsModule.java b/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsModule.java new file mode 100644 index 000000000..d383227e4 --- /dev/null +++ b/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsModule.java @@ -0,0 +1,84 @@ +/* + * Copyright (c) 2023 LabKey Corporation + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +package org.labkey.queryextensions; + +import org.jetbrains.annotations.NotNull; +import org.jetbrains.annotations.Nullable; +import org.labkey.api.data.Container; +import org.labkey.api.module.DefaultModule; +import org.labkey.api.module.ModuleContext; +import org.labkey.api.view.WebPartFactory; + +import java.util.Collection; +import java.util.Collections; +import java.util.Set; + +public class QueryExtensionsModule extends DefaultModule +{ + public static final String NAME = "QueryExtensions"; + + @Override + public String getName() + { + return NAME; + } + + @Override + public @Nullable Double getSchemaVersion() + { + return 23.000; + } + + @Override + public boolean hasScripts() + { + return true; + } + + @Override + @NotNull + protected Collection createWebPartFactories() + { + return Collections.emptyList(); + } + + @Override + protected void init() + { + addController(QueryExtensionsController.NAME, QueryExtensionsController.class); + } + + @Override + public void doStartup(ModuleContext moduleContext) + { + + } + + @Override + @NotNull + public Collection getSummary(Container c) + { + return Collections.emptyList(); + } + + @Override + @NotNull + public Set getSchemaNames() + { + return Collections.singleton(QueryExtensionsSchema.NAME); + } +} \ No newline at end of file diff --git a/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsSchema.java b/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsSchema.java new file mode 100644 index 000000000..e5bcabc15 --- /dev/null +++ b/QueryExtensions/src/org/labkey/queryextensions/QueryExtensionsSchema.java @@ -0,0 +1,49 @@ +/* + * Copyright (c) 2023 LabKey Corporation + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +package org.labkey.queryextensions; + +import org.labkey.api.data.DbSchema; +import org.labkey.api.data.DbSchemaType; +import org.labkey.api.data.dialect.SqlDialect; + +public class QueryExtensionsSchema +{ + private static final QueryExtensionsSchema _instance = new QueryExtensionsSchema(); + public static final String NAME = "queryextensions"; + + public static QueryExtensionsSchema getInstance() + { + return _instance; + } + + private QueryExtensionsSchema() + { + // private constructor to prevent instantiation from + // outside this class: this singleton should only be + // accessed via org.labkey.queryextensions.QueryExtensionsSchema.getInstance() + } + + public DbSchema getSchema() + { + return DbSchema.get(NAME, DbSchemaType.Module); + } + + public SqlDialect getSqlDialect() + { + return getSchema().getSqlDialect(); + } +} diff --git a/QueryExtensions/test/src/org/labkey/test/tests/queryextensions/QueryExtensionsTest.java b/QueryExtensions/test/src/org/labkey/test/tests/queryextensions/QueryExtensionsTest.java new file mode 100644 index 000000000..9065c8158 --- /dev/null +++ b/QueryExtensions/test/src/org/labkey/test/tests/queryextensions/QueryExtensionsTest.java @@ -0,0 +1,82 @@ +/* + * Copyright (c) 2023 LabKey Corporation + * + * Licensed under the Apache License, Version 2.0 (the "License"); + * you may not use this file except in compliance with the License. + * You may obtain a copy of the License at + * + * http://www.apache.org/licenses/LICENSE-2.0 + * + * Unless required by applicable law or agreed to in writing, software + * distributed under the License is distributed on an "AS IS" BASIS, + * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. + * See the License for the specific language governing permissions and + * limitations under the License. + */ + +package org.labkey.test.tests.queryextensions; + +import org.junit.Before; +import org.junit.BeforeClass; +import org.junit.Test; +import org.junit.experimental.categories.Category; +import org.labkey.test.BaseWebDriverTest; +import org.labkey.test.TestTimeoutException; +import org.labkey.test.categories.InDevelopment; + +import java.util.Collections; +import java.util.List; + +@Category({InDevelopment.class}) +public class QueryExtensionsTest extends BaseWebDriverTest +{ + @Override + protected void doCleanup(boolean afterTest) throws TestTimeoutException + { + _containerHelper.deleteProject(getProjectName(), afterTest); + } + + @BeforeClass + public static void setupProject() + { + QueryExtensionsTest init = (QueryExtensionsTest)getCurrentTest(); + + init.doSetup(); + } + + private void doSetup() + { + _containerHelper.createProject(getProjectName(), null); + } + + @Before + public void preTest() + { + goToProjectHome(); + } + + @Test + public void testQueryExtensionsModule() + { + _containerHelper.enableModule("QueryExtensions"); + + } + + @Override + protected BrowserType bestBrowser() + { + return BrowserType.CHROME; + } + + @Override + protected String getProjectName() + { + return "QueryExtensionsTest Project"; + } + + @Override + public List getAssociatedModules() + { + return Collections.singletonList("QueryExtensions"); + } +} \ No newline at end of file diff --git a/SequenceAnalysis/api-src/org/labkey/api/sequenceanalysis/pipeline/HasJobParams.java b/SequenceAnalysis/api-src/org/labkey/api/sequenceanalysis/pipeline/HasJobParams.java index 3551e51a1..210230f17 100644 --- a/SequenceAnalysis/api-src/org/labkey/api/sequenceanalysis/pipeline/HasJobParams.java +++ b/SequenceAnalysis/api-src/org/labkey/api/sequenceanalysis/pipeline/HasJobParams.java @@ -2,6 +2,7 @@ import org.json.JSONObject; +import java.io.File; import java.util.Map; /** @@ -12,4 +13,6 @@ public interface HasJobParams Map getJobParams(); JSONObject getParameterJson(); + + File getParametersFile(); } diff --git a/SequenceAnalysis/api-src/org/labkey/api/sequenceanalysis/pipeline/SequencePipelineService.java b/SequenceAnalysis/api-src/org/labkey/api/sequenceanalysis/pipeline/SequencePipelineService.java index f9d1ddf10..a5ad1e5e7 100644 --- a/SequenceAnalysis/api-src/org/labkey/api/sequenceanalysis/pipeline/SequencePipelineService.java +++ b/SequenceAnalysis/api-src/org/labkey/api/sequenceanalysis/pipeline/SequencePipelineService.java @@ -144,4 +144,6 @@ static public void setInstance(SequencePipelineService instance) // Note: this primarily exists for testing. The returned TaskFileManager does not have key values set: SequenceJob, WorkingDir (File) and WorkDirectory abstract public TaskFileManager getTaskFileManager(); + + abstract public Set getResourceSettings(); } diff --git a/SequenceAnalysis/build.gradle b/SequenceAnalysis/build.gradle index c2e887a19..a0cda32aa 100644 --- a/SequenceAnalysis/build.gradle +++ b/SequenceAnalysis/build.gradle @@ -10,13 +10,9 @@ import java.util.regex.Matcher repositories { mavenCentral() - // Added for org.clojars.chapmanb:sam dependency required by com.github.samtools:htsjdk + // Added for jhdf5 from FASTQC / sequence analysis module maven { - url "https://clojars.org/repo" - } - // Added for org.clojars.chapmanb:sam - maven { - url "https://maven.scijava.org/content/groups/public" + url "https://maven.scijava.org/content/groups/public/" } } @@ -99,13 +95,26 @@ dependencies { BuildUtils.addExternalDependency( project, new ExternalDependency( - 'org.clojars.chapmanb:sam:1.96', - 'picard tools', - 'picard tools', - 'http://sourceforge.net/projects/picard/', + 'cisd:jhdf5:19.04.1', + 'JHDF5', + 'JHDF5', + 'https://unlimited.ethz.ch/display/JHDF/', + ExternalDependency.BSD_LICENSE_NAME, + ExternalDependency.BSD_LICENSE_URL, + 'JHDF5 is a Java binding for HDF5. Used by FastQC' + ) + ) + + BuildUtils.addExternalDependency( + project, + new ExternalDependency( + 'net.iharder:base64:2.3.8', + 'Base64', + 'Base64', + 'http://iharder.net/base64/', ExternalDependency.MIT_LICENSE_NAME, ExternalDependency.MIT_LICENSE_URL, - 'Library for working with SAM/BAM files. Used by FastQC' + 'Library for Base64 encoding. Used by FastQC' ) ) implementation "net.sf.opencsv:opencsv:${opencsvVersion}" @@ -156,6 +165,7 @@ dependencies { apiImplementation "org.apache.commons:commons-math3:${commonsMath3Version}" BuildUtils.addLabKeyDependency(project: project, config: "modules", depProjectPath: ":server:modules:LabDevKitModules:laboratory", depProjectConfig: "published", depExtension: "module") BuildUtils.addLabKeyDependency(project: project, config: "modules", depProjectPath: ":server:modules:LabDevKitModules:LDK", depProjectConfig: "published", depExtension: "module") + BuildUtils.addLabKeyDependency(project: project, config: "modules", depProjectPath: ":server:modules:DiscvrLabKeyModules:discvrcore", depProjectConfig: "published", depExtension: "module") } diff --git a/SequenceAnalysis/resources/external/basicHistogram.r b/SequenceAnalysis/resources/external/basicHistogram.r deleted file mode 100644 index 7e9e1fc10..000000000 --- a/SequenceAnalysis/resources/external/basicHistogram.r +++ /dev/null @@ -1,62 +0,0 @@ -options(warn = -1) - -library(reshape) -library(lattice) -library(plyr) -library(ggplot2) -library(grid) -library(perm) -library(gridExtra) -library(naturalsort) - -library(getopt); -library(Matrix); - -options(scipen=1000000000) - -spec <- matrix(c( - 'inputFile', 'i', 1, "character", - 'outputFile', 'o', 1, "character", - 'plotTitle', 't', 2, "character", - 'xLabel', NA, 2, "character", - 'colIdx', 'c', 1, "integer", - 'binWidth', NA, 2, "integer", - 'maxValue', NA, 2, "integer", - 'hasHeaders', 'h', 2, "logical" -), ncol=4, byrow=TRUE); -opts = getopt(spec, commandArgs(trailingOnly = TRUE)); - -if ( is.null(opts$xLabel ) ) { opts$xLabel = "" } -if ( is.null(opts$plotTitle ) ) { opts$plotTitle = "" } -if ( is.null(opts$hasHeaders ) ) { opts$hasHeaders = TRUE } - -df <- read.table(opts$inputFile, quote="\"", header = opts$hasHeaders); - -#echo "Generating Histogram" - -colName <-names(df)[opts$colIdx]; - -if ( !is.null(opts$maxValue)) { - message(paste0("combining all values greater than: ", opts$maxValue)); - - df[colName][df[colName] > opts$maxValue] <- opts$maxValue -} - -P<-ggplot(df,aes_string(x=colName)) + - ggtitle(opts$plotTitle) + - #scale_y_continuous(limits=c(0,2),labels=c("0.0","0.5","1.0","1.5","2.0")) + - geom_histogram(binwidth = opts$binWidth) + - theme( - #axis.text.x = element_blank(), - plot.margin = unit(c(0.3,0.3,0.3,0.3),"in"), - plot.title = element_text(size=14,vjust=2), - axis.title.x = element_text(size=14,vjust=-1), - axis.title.y = element_text(size=14,vjust=2), - strip.text.x = element_text(size = 12,face="bold")) + - xlab(opts$xLabel) + - ylab("Count") - - -png(opts$outputFile,width=880, height=680) -print(P); -dev.off(); \ No newline at end of file diff --git a/SequenceAnalysis/resources/external/basicScatter.r b/SequenceAnalysis/resources/external/basicScatter.r deleted file mode 100644 index 5789b4cee..000000000 --- a/SequenceAnalysis/resources/external/basicScatter.r +++ /dev/null @@ -1,55 +0,0 @@ -options(warn = -1) - -library(reshape) -library(lattice) -library(plyr) -library(ggplot2) -library(grid) -library(perm) -library(gridExtra) -library(naturalsort) - -library(getopt); -library(Matrix); - -options(scipen=1000000000) - -spec <- matrix(c( - 'inputFile', 'i', 1, "character", - 'outputFile', 'o', 1, "character", - 'plotTitle', 't', 2, "character", - 'xLabel', NA, 2, "character", - 'xColIdx', 'x', 1, "integer", - 'yColIdx', 'y', 1, "integer", - 'hasHeaders', 'h', 2, "logical" -), ncol=4, byrow=TRUE); -opts = getopt(spec, commandArgs(trailingOnly = TRUE)); - -if ( is.null(opts$xLabel ) ) { opts$xLabel = "" } -if ( is.null(opts$plotTitle ) ) { opts$plotTitle = "" } -if ( is.null(opts$hasHeaders ) ) { opts$hasHeaders = TRUE } - -df <- read.table(opts$inputFile, quote="\"", header = opts$hasHeaders); - -#echo "Generating Plot" - -xColName <-names(df)[opts$xColIdx]; -yColName <-names(df)[opts$yColIdx]; - -P<-ggplot(df,aes_string(x=xColName, y=yColName)) + - ggtitle(opts$plotTitle) + - geom_point(shape=1) + - theme( - #axis.text.x = element_blank(), - plot.margin = unit(c(0.3,0.3,0.3,0.3),"in"), - plot.title = element_text(size=14,vjust=2), - axis.title.x = element_text(size=14,vjust=-1), - axis.title.y = element_text(size=14,vjust=2), - strip.text.x = element_text(size = 12,face="bold")) + - xlab(opts$xLabel) + - ylab("Count") - - -png(opts$outputFile,width=880, height=680) -print(P); -dev.off(); \ No newline at end of file diff --git a/SequenceAnalysis/resources/external/coverageGraph.r b/SequenceAnalysis/resources/external/coverageGraph.r deleted file mode 100644 index 2fb7af566..000000000 --- a/SequenceAnalysis/resources/external/coverageGraph.r +++ /dev/null @@ -1,64 +0,0 @@ -library(reshape) -library(lattice) -library(plyr) -library(ggplot2) -library(grid) -library(perm) -library(gridExtra) -library(naturalsort) - -library(getopt); -library(Matrix); - -spec <- matrix(c( - 'colHeader', '-c', 1, "character", - 'outputFile', '-o', 1, "character", - 'inputFile', '-i', 1, "character", - 'plotTitle', '-t', 1, "character", - 'vertical', '-v', 1, "integer", - 'yLabel', NA, 1, "character" -), ncol=4, byrow=TRUE); -opts = getopt(spec, commandArgs(trailingOnly = TRUE)); -if ( is.null(opts$vertical ) ) { opts$vertical = 0 } - -df <- read.table(opts$inputFile, quote="\"", header = TRUE, fill = TRUE, na.strings = "NA"); -df$SequenceName <- factor(df$SequenceName, levels = naturalsort(unique(df$SequenceName))); - -df <- df[(!is.na(df[opts$colHeader])),]; -#str(df) - -plotHeight <- 680; - -if (opts$vertical == 1){ - facet1 <- 'SequenceName'; - facet2 <- '.'; - fac_formula <- as.formula(paste(facet1,"~",facet2)) - facetLine <- facet_grid(fac_formula, scales="free", space="fixed") - - plotHeight <- (500 * nlevels(df$SequenceName)); -} else { - facet1 <- '.'; - facet2 <- 'SequenceName'; - fac_formula <- as.formula(paste(facet1,"~",facet2)) - facetLine <- facet_grid(fac_formula, scales="free", space="free") -} - -# make all chroms plot -P<-ggplot(df,aes_string(x="Start",y=opts$colHeader)) + - ggtitle(opts$plotTitle) + - #scale_y_continuous(limits=c(0,2),labels=c("0.0","0.5","1.0","1.5","2.0")) + - geom_point(stat='identity') + - theme(axis.text.x = element_blank(), - plot.margin = unit(c(0.3,0.3,0.3,0.3),"in"), - plot.title = element_text(size=14,vjust=2), - axis.title.x = element_text(size=14,vjust=-1), - axis.title.y = element_text(size=14,vjust=2), - strip.text.x = element_text(size = 12,face="bold")) + - xlab("Position") + - ylab(opts$yLabel) + - facetLine - - -png(opts$outputFile,width=880, height=plotHeight) -print(P); -dev.off(); \ No newline at end of file diff --git a/SequenceAnalysis/resources/external/fastqc/Configuration/adapter_list.txt b/SequenceAnalysis/resources/external/fastqc/Configuration/adapter_list.txt index 63d7ff601..236dca897 100644 --- a/SequenceAnalysis/resources/external/fastqc/Configuration/adapter_list.txt +++ b/SequenceAnalysis/resources/external/fastqc/Configuration/adapter_list.txt @@ -20,5 +20,8 @@ # fragments for now. Illumina Universal Adapter AGATCGGAAGAG -Illumina Small RNA Adapter ATGGAATTCTCG -Nextera Transposase Sequence CTGTCTCTTATA \ No newline at end of file +Illumina Small RNA 3' Adapter TGGAATTCTCGG +Illumina Small RNA 5' Adapter GATCGTCGGACT +Nextera Transposase Sequence CTGTCTCTTATA +PolyA AAAAAAAAAAAA +PolyG GGGGGGGGGGGG \ No newline at end of file diff --git a/SequenceAnalysis/resources/external/fastqc/Configuration/contaminant_list.txt b/SequenceAnalysis/resources/external/fastqc/Configuration/contaminant_list.txt index eb4b70a83..1ae0bd980 100644 --- a/SequenceAnalysis/resources/external/fastqc/Configuration/contaminant_list.txt +++ b/SequenceAnalysis/resources/external/fastqc/Configuration/contaminant_list.txt @@ -43,7 +43,6 @@ Illumina NlaIII expression Sequencing Primer CCGACAGGTTCAGAGTTCTACAGTCCGACATG Illumina Small RNA Adapter 1 GTTCAGAGTTCTACAGTCCGACGATC Illumina Small RNA Adapter 2 TGGAATTCTCGGGTGCCAAGG Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA -Illumina Small RNA PCR Primer 1 CAAGCAGAAGACGGCATACGA Illumina Small RNA PCR Primer 2 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA Illumina Small RNA Sequencing Primer CGACAGGTTCAGAGTTCTACAGTCCGACGATC @@ -84,14 +83,11 @@ Illumina NlaIII Gex PCR Primer 1 CAAGCAGAAGACGGCATACGA Illumina NlaIII Gex PCR Primer 2 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA Illumina NlaIII Gex Sequencing Primer CCGACAGGTTCAGAGTTCTACAGTCCGACATG -Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA Illumina 5p RNA Adapter GTTCAGAGTTCTACAGTCCGACGATC Illumina RNA Adapter1 TGGAATTCTCGGGTGCCAAGG Illumina Small RNA 3p Adapter 1 ATCTCGTATGCCGTCTTCTGCTTG Illumina Small RNA PCR Primer 1 CAAGCAGAAGACGGCATACGA -Illumina Small RNA PCR Primer 2 AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA -Illumina Small RNA Sequencing Primer CGACAGGTTCAGAGTTCTACAGTCCGACGATC TruSeq Universal Adapter AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT TruSeq Adapter, Index 1 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG @@ -115,7 +111,7 @@ TruSeq Adapter, Index 19 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACTCTCGTATGC TruSeq Adapter, Index 20 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 21 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGTCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 22 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTTCTCGTATGCCGTCTTCTGCTTG -TruSeq Adapter, Index 23 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTTCTCGTATGCCGTCTTCTGCTTG +TruSeq Adapter, Index 23 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCACTCTTCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 25 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 27 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTCTCGTATGCCGTCTTCTGCTTG @@ -180,3 +176,11 @@ ABI Solid3 EF1 alpha Sense Primer CATGTGTGTTGAGAGCTTC ABI Solid3 EF1 alpha Antisense Primer GAAAACCAAAGTGGTCCAC ABI Solid3 GAPDH Forward Primer TTAGCACCCCTGGCCAAGG ABI Solid3 GAPDH Reverse Primer CTTACTCCTTGGAGGCCATG + + + +Clontech Universal Primer Mix Short CTAATACGACTCACTATAGGGC +Clontech Universal Primer Mix Long CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT +Clontech SMARTer II A Oligonucleotide AAGCAGTGGTATCAACGCAGAGTAC +Clontech SMART CDS Primer II A AAGCAGTGGTATCAACGCAGAGTACT + diff --git a/SequenceAnalysis/resources/external/fastqc/Configuration/limits.txt b/SequenceAnalysis/resources/external/fastqc/Configuration/limits.txt index 742d172cc..ec4280c1a 100644 --- a/SequenceAnalysis/resources/external/fastqc/Configuration/limits.txt +++ b/SequenceAnalysis/resources/external/fastqc/Configuration/limits.txt @@ -2,7 +2,7 @@ # module at all by setting the value below to 1 for the # modules you want to remove. duplication ignore 0 -kmer ignore 0 +kmer ignore 1 n_content ignore 0 overrepresented ignore 0 quality_base ignore 0 diff --git a/SequenceAnalysis/resources/external/fastqc/INSTALL.txt b/SequenceAnalysis/resources/external/fastqc/INSTALL.txt deleted file mode 100644 index f55db8b08..000000000 --- a/SequenceAnalysis/resources/external/fastqc/INSTALL.txt +++ /dev/null @@ -1,127 +0,0 @@ -Installing FastQC -------------------- -FastQC is a java application. In order to run it needs your system to have a suitable -Java Runtime Environment (JRE) installed. Before you try to run FastQC you should therefore -ensure that you have a suitable JRE. There are a number of different JREs available -however the one we have tested is the v1.6 JRE from Oracle. This is available -for a number of different platforms from www.java.com (click the download now button at the -top). - -If you're not sure whether you have java installed then you can test this from a command -prompt. To get a command prompt try: - -Windows: Select Start > Run, and type 'cmd' (no quotes) in the box which appears, press OK - -MaxOSX: Run Applications > Utilities > Terminal - -Linux: From your applications menu look for an application called 'Terminal' or 'Konsole'. -Either of these will give you a usable shell. - -At the command prompt type 'java -version' and press enter. You should see something like: - -java version "1.6.0_17" -Java(TM) SE Runtime Environment (build 1.6.0_17-b04-248-10M3025) -Java HotSpot(TM) Client VM (build 14.3-b01-101, mixed mode) - -If you get an error then you don't have java installed. If the version listed on the first -line is less than 1.5 then you might have problems running FastQC. - -Actually installing FastQC is as simple as unzipping the zip file it comes in into a -suitable location. That's it. Once unzipped it's ready to go. - -Running FastQC --------------- - -You can run FastQC in one of two modes, either as an interactive graphical application -in which you can dynamically load FastQ files and view their results. - -Alternatively you can run FastQC in a non-interactive mode where you specify the files -you want to process on the command line and FastQC will generate an HTML report for -each file without launching a user interface. This would allow FastQC to be run as -part of an analysis pipeline. - - -Running FastQC Interactively ----------------------------- -Windows: Simply double click on the run_fastqc bat file. If you want to make a pretty -shortcut then we've included an icon file in the top level directory so you don't have -to use the generic bat file icon. - -MacOSX: There is an application bundle for MacOSX which you can use to install and run -FastQC. Just drag the application from the disk image to your Applications folder (or -wherever you want to install the program). - -Linux: We have included a wrapper script, called 'fastqc' which is the easiest way to -start the program. The wrapper is in the top level of the FastQC installation. You -may need to make this file executable: - -chmod 755 fastqc - -..but once you have done that you can run it directly - -./fastqc - -..or place a link in /usr/local/bin to be able to run the program from any location: - -sudo ln -s /path/to/FastQC/fastqc /usr/local/bin/fastqc - - -Running FastQC as part of a pipeline ------------------------------------- -To run FastQC non-interactively you should use the fastqc wrapper script to launch -the program. You will probably want to use the zipped install file on every platform -(even OSX). - -To run non-interactively you simply have to specify a list of files to process -on the commandline - -fastqc somefile.txt someotherfile.txt - -You can specify as many files to process in a single run as you like. If you don't -specify any files to process the program will try to open the interactive application -which may result in an error if you're running in a non-graphical environment. - -There are a few extra options you can specify when running non-interactively. Full -details of these can be found by running - -fastqc --help - -By default, in non-interactive mode FastQC will create both a zipped copy of the -QC report, and also extract this to create a folder which contains the report -files ready to be viewed. If you only want to create the zipped file then you can -add - ---noextract - -To the launch command to suppress the unzipping. - -If you want to save your reports in a folder other than the folder which contained -your original FastQ files then you can specify an alternative location by setting a ---outdir value: - ---outdir=/some/other/dir/ - -Customising the report output ------------------------------ - -If you want to run FastQC as part of a sequencing pipeline you may wish to change the -formatting of the report to add in your own branding or to include extra information. - -In the Templates directory you will find a file called 'header_template.html' which -you can edit to change the look of the report. This file contains all of the header for -the report file, including the CSS section and you can alter this however you see fit. - -If you want to add in your own logo or other image files to the reports then you can drop -a png or jpg file into the Icons folder in the templates directory and this will be copied -into the report folder for all reports generated by the program. You can refer to these -icons using a relative URL (eg Icons/image.png) in the HTML template. Images placed -outside the icons directory will not be copied. - -Whilst you can make whatever changes you like you should probably leave in place the -
structure of the html template since later code will expect to close the main div -which is left open at the end of the header. There is no facility to change the code in -the main body of the report or the footer (although you can of course change the styling). - -The text tags @@FILENAME@@ and @@DATE@@ are placeholders which are filled in when the -report it created. You can use these placeholders in other parts of the header if you -wish. diff --git a/SequenceAnalysis/resources/external/fastqc/LICENSE b/SequenceAnalysis/resources/external/fastqc/LICENSE new file mode 100644 index 000000000..94a9ed024 --- /dev/null +++ b/SequenceAnalysis/resources/external/fastqc/LICENSE @@ -0,0 +1,674 @@ + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + Copyright (C) + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +. diff --git a/SequenceAnalysis/resources/external/fastqc/Main.txt b/SequenceAnalysis/resources/external/fastqc/Main.txt deleted file mode 100644 index aad1ee48a..000000000 --- a/SequenceAnalysis/resources/external/fastqc/Main.txt +++ /dev/null @@ -1 +0,0 @@ -Main-Class: uk.ac.bbsrc.babraham.FastQC.FastQCApplication diff --git a/SequenceAnalysis/resources/external/fastqc/README.txt b/SequenceAnalysis/resources/external/fastqc/README.txt deleted file mode 100644 index e08d5a2f0..000000000 --- a/SequenceAnalysis/resources/external/fastqc/README.txt +++ /dev/null @@ -1,42 +0,0 @@ -FastQC - A Quality Control application for FastQ files ------------------------------------------------------- - -Most high throughput sequencers generate output in FastQ format. This -format combines the base calls for the sequence which was generated with -an encoded quality value for each base which says how confident the -sequencer was that the base call generated was correct. - -Before proceeding with the analysis of a sequence data set it is -a good idea to do some basic quality control checks on the raw data -to ensure that there are no hidden problems which might be more -difficult to detect at a later stage. - -FastQC is an application which takes a FastQ file and runs a series -of tests on it to generate a comprehensive QC report. This will -tell you if there is anything unusual about your sequence. Each -test is flagged as a pass, warning or fail depending on how far it -departs from what you'd expect from a normal large dataset with no -significant biases. It's important to stress that warnings or even -failures do not necessarily mean that there is a problem with your -data, only that it is unusual. It is possible that the biological -nature of your sample means that you would expect this particular -bias in your results. - -FastQC can be run either as an interactive graphical application -which allows you to view results for multiple files in a single -application. Alternatively you can run the program in a non -interactive way (say as part of a pipeline) which will generate -an HTML report for each file you process. - -FastQC is a cross-platform application, written in java. In theory it -should run on any platform which has a suitable java runtime environment. -Having said that we've only tested in on Windows, MacOSX 10.6 and Linux -running the Sun v1.5 and 1.6 JREs. Please let us know what happened if -you try running it on other platforms / JREs. - -If you have any comments about FastQC we would like to hear them. You -can either enter them in our bug tracking system at: - -http://www.bioinformatics.bbsrc.ac.uk/bugzilla/ - -..or send them directly to simon.andrews@bbsrc.ac.uk. diff --git a/SequenceAnalysis/resources/external/fastqc/RELEASE_NOTES.txt b/SequenceAnalysis/resources/external/fastqc/RELEASE_NOTES.txt deleted file mode 100644 index 1e41c2c81..000000000 --- a/SequenceAnalysis/resources/external/fastqc/RELEASE_NOTES.txt +++ /dev/null @@ -1,613 +0,0 @@ -RELEASE NOTES FOR FastQC V0.10.0 --------------------------------- - -The major feature of FastQC v0.10.0 is the addition of support -for fastq files generated directly by the latest version of the -illumina pipeline (Casava v1.8). In this version the pipeline -generates gzipped fastq files by default rather than using qseq -files which can then be converted to fastq. However the fastq -files generated by casava are unusual in two ways: - -1) A single sample produces a set of fastq files with a common - name, but an incrementing number at the end. - -2) Casava FastQ files contain sequences from clusters which have - failed the internal QC, and been flagged to be filtered. - -FastQC v0.10.0 introduces a Casava mode which will merge together -fastq files from the same sample group and produce a single report. -It will also exclude any flagged entries from the analysis. You -would therefore run FastQC as normal but selecting all of the -fastq files from Casava and using casava mode for your analysis. - -Casava mode is activated from the command line by adding the ---casava option to the launch command. From the interactive -application you need to select 'Casava FastQ Files' from the drop -down file selector filter options. - -If you want to analyse casava fastq files without these extra -options then you can use treat them as normal fastq files with -no problems. - -In addition to this change there have also been changes to allow -the wrapper script to work properly under windows, and a bug was -fixed which missed of the last possible Kmer from every sequence -in a library. - - -RELEASE NOTES FOR FastQC V0.9.6 -------------------------------- - -FastQC v0.9.6 fixes a couple of bugs which aren't likely to have -affected the majority of fastqc users: - -- Fixed a crash in the Kmer module when analysing a sequence where - every sequence in a library contained a poly-N stretch at its - 3' end. - -- Fixed the wrapper script so that OSX users launching fastqc - through the script rather than the Mac application bundle get - their classpath set correctly, and can therefore analyse bam/sam - files. - - -RELEASE NOTES FOR FastQC V0.9.5 -------------------------------- - -FastQC v0.9.5 fixes some bugs in the programs text output and -improves a few things in the graphical interface. Main changes -are: - -- Progress calculations are now exact and not approximate - -- The UI now has a welcome screen so you're not just presented - with a blank screen when the program starts - -- The wrapper script now sets the classpath correctly in windows - as well as linux. - -- The text report for per-base sequence content now reports - correct values for grouped bases - -- The HTML report uses a custom stylesheet for print output so - graphs aren't cut off when reports are printed. - -- Fixed a bug in testing for a warning in the per-base sequence - content module. - -- Alt text in HTML reports now matches the graphic it describes - - -RELEASE NOTES FOR FastQC V0.9.4 -------------------------------- - -FastQC v0.9.4 is a minor bugfix release which changes the offline -version of the program so that if a file fails to be processed a -full backtrace of the error is produced, rather than just a -simple generic error message. - -RELEASE NOTES FOR FastQC V0.9.3 -------------------------------- - -FastQC v0.9.3 adds support for fastq files compressed with -bzip2 in addition to its existing support for gzip compressed -files. It's worth noting that although bzip2 offers a reduction -in the file size of the compressed files (about a 5-fold size -reduction compared to raw fastq. Gzip is a 4-fold decrease), -there is a significant penalty in terms of the speed of -decompression of these files. In our tests gzipped files were -actually processed slightly faster than raw FastQ files, presumably -due to the lower amount of data transfer from disk required, -however bzip2 compressed files took around 6X as long to -process as gzipped files. - -The other big change in this release is an update to the default -CSS layout such that viewing the HTML reports doesn't require -lots of scrolling up and down the page. As before the CSS can -be edited and customised by editing the templates shipped with -the program. Many thanks to Phil Ewels who did much of the -work on the new layout. - - - -RELEASE NOTES FOR FastQC V0.9.2 -------------------------------- - -FastQC v0.9.2 fixes two bugs which were identified in the -previous release. - -1) In the text output for the per-base quality module the -correct base numbers weren't being included for files which -used grouped base ranges. - -2) The Kmer analysis module could crash when analysing very -small files, such that no position in the file had more than -1000 instances of an enriched Kmer. - -Both of these issues should now be resolved. - - -RELEASE NOTES FOR FastQC V0.9.1 -------------------------------- - -FastQC v0.9.1 adds some new command line options and fixes a -couple of usability issues. - -The new command line options are: - ---quiet Will suppress all progress messages and ensure that only -warnings or errors are written to stderr. This might be useful -for people running fastqc as part of a pipeline. - ---nogroup Will turn off the dynamic grouping of bases in the -various per-base plots. This would allow you to see a result -for each base of a 100bp run for example. This option should -not be used for really long reads (454, PacBio etc) since it -has the potential to crash the program or generate very wide -output plots - -In addition to these the following changes have been made: - -The basic stats module now includes a line to say which type -of quality encoding was found so this information isn't just -present in the header of the per-base quality plot, and will -appear in the text based output. - -We now distinguish between Illumina <1.3, 1.3 and 1.5 encodings -rather than just <1.3 and >=1.3. The Sanger encoding is now -labelled as Sanger / Illumina 1.9+ to allow for the change in -encoding in the latest illumina pipeline. - -A bug was fixed which caused the program to crash when encountering -a zero length colorspace file (which shouldn't happen anyway, but -crashing wasn't the correct response). - -The interactive over-represented sequence table now allows you -to copy out each cell individually which makes it easy to copy -any unknown sequences into other programs. - - -RELEASE NOTES FOR FastQC V0.9.0 -------------------------------- - -FastQC v0.9.0 makes a number of changes primarily targetted at -datasets containing longer reads. It allows all of the analyses -within FastQC to be completed sensibly and without excessive -resource usage on runs containing reads up to tens of kilobases -in length. - -For long reads the program now converts many of its plots to -variably sized bins so that, for example you see every base for -the first 10 bases, then every 5 bases for the next 40 bases, -then every 50, then 100 then 1kb per bin, until the end of the -sequence is reached. For sequences below 75bp the reports will -look exactly the same as before. For groups running slightly -longer Illumina or ABI runs you'll see some compression at the -end of your reads, and people using 454 or PacBio will get -sensible results for all analyses for the first time. - -One additional change which will impact anyone using reads over -75bp is that the duplicate sequence and overrepresented sequence -plots now only use the first 50bp of each read if the total read -length is over 75bp. This is because these plots work on the -basis of an exact sequence match, and longer reads tend to show -more errors at the end which makes them look like different -sequences when they're actually the same. 50bp should be enough -that you won't see exact matches by chance. - - - -RELEASE NOTES FOR FastQC V0.8.0 -------------------------------- - -FastQC v0.8.0 adds some new options for parsing BAM/SAM files and -makes the graphs in the report easier to interpret. - -All graphs in v0.8.0 now have marker lines going across them to make -it easier to relate the data in the graph to the y-axis. The per -base quality boxplots have shading behind the graph to indicate ranges -of good, medium and bad quality sequence. - -For BAM/SAM files you can now specify that you wish to analyse only -the mapped sequences in the file. This is particularly of use to -people working on colorspace data where the mapped data should -produce reliable sequence, whereas the current raw conversion to -base space may overrepresent any errors which are present. The -option to use only mapped data is set by using the - --f bam_mapped or -f sam_mapped - -option on the command line, or by specifying Mapped BAM/SAM files -from the drop down file filter in the file chooser in the interactive -version of the program. - -For FastQ files the parser has been updated to not treat blank lines -between entries or at the end of the file as a format violation since -many sequences in the public repositories can have this problem. - -From the command line we now offer the option to process multiple -files in parallel by setting the -t/--threads option. Please note that -using more than 1 thread will increase the amount of allocated memory -(250MB per thread), so you need to be sure you have enough memory (and -disk bandwidth) to be able to process more than one file. The -interactive application still defaults to a single processing thread -but you could theoretically change this by passing the correct java -properties in the startup command. - - -RELEASE NOTES FOR FastQC V0.7.2 -------------------------------- - -FastQC v0.7.2 fixes a bug in libraries where no unique sequences -were observed. It also improves the collection of duplicate -statistics on libraries with very low diversity. - -A new command line option has been added to allow the user to -manually specify a contaminant's file rather than using the sitewide -default. This would be useful if you have different sets of -contaminants to screen against for different libraries, or if you -wanted to make a custom set of contaminants, but didn't have -sufficient privileges to modify the sitewide contaminants file. - - -RELEASE NOTES FOR FastQC V0.7.1 -------------------------------- - -FastQC v0.7.1 makes some significant enhancements to the fastqc -wrapper script which make it easier to use as part of a pipeline. - -You can now use normal unix options to create your fastqc -command rather than having to pass java system properties. The -old options will continue to work though, so the updated -wrapper is still compatible with any previous commands you may -have in place. Full details of the new options can be found -by running - -fastqc --help - -One new option is the --format option which allows you to manually -specify the input format of a file, rather than having FastQC -guess the format from the file name. This would allow you to have -a BAM file called test.dat and process it using: - -fastqc --format bam test.dat - - - - -RELEASE NOTES FOR FastQC V0.7.0 -------------------------------- - -FastQC v0.7.0 introduces a new analysis module which looks at the -enrichment of short sequences within the library. It is possible -to get enrichment of unaligned subsequences to quite a high degree -without this being apparent in any of the existing modules. This -new module should find problems such as read through into the -adapters at the other end of libraries, which other analyses would -miss. - -Other changes in this release include: - -* Altering the fastqc wrapper script so it can identify when it's - being used on the source distribution of the software so it can - issue an appropriate warning. - -* Tidied up all of the y-axes on the graphs so that scaling should - now always be perfect in all graphs. - - -RELEASE NOTES FOR FastQC V0.6.1 -------------------------------- - -FastQC v0.6.1 is a bugfix release which fixes a problem with sequences -from BAM/SAM files which map to the reverse strand of the reference. - -In these cases the sequence contained in the BAM/SAM file is reverse -complemented and the qualities are reversed relative to the original -sequence which came off the sequencer. In the previous release this -meant that the plots were incorrectly showing a mix of forward and -reversed sequences. - -In v0.6.1 any sequences mapping to the reverse strand of the reference -are converted back to their original state before being analysed which -should give a clearer view of the overall qualities and sequence biases -within the run. - - -RELEASE NOTES FOR FastQC V0.6.0 -------------------------------- - -FastQC v0.6 adds support for reading SAM/BAM files as well as still -supporting fastq files. File type detection is based on the filename -so SAM/BAM files need to be named .sam or .bam. Any other form of -filename is assumed to be a fastq file. - -SAM/BAM reading was added through the use of the picard libraries, which -means that the launcher for FastQC has had to be modified to include -the picard libraries into the classpath. If you use the bat file launcher, -the wrapper script or the Mac application bundle then you won't need to -do anything to get the new version to work, but if you've created your -own launcher then you will need to modify your classpath statement to -include the sam-1.32.jar file into the classpath. - -The only other change in this release is that the line graphs have been -improved to use smoother lines for the graphs. - - - -RELEASE NOTES FOR FastQC V0.5.1 -------------------------------- - -Release 0.5.1 fixes a couple of bugs and makes some improvements to -existing functions. - -* A bug was fixed which caused the headers of the overrepresented - sequences results to not be separated in the text output. - -* A bug was fixed which caused spikes to appear in the %GC profile - when using read lengths >100bp - -* The fitting of the theoretical distribution to the %GC profile - was improved - -* Some new entries were added to the contaminants file to cover - Illumina oligos for multiplexing, tag expression and small RNA - protocols (thanks to Aaron Statham for providing these) - - -RELEASE NOTES FOR FastQC V0.5.0 -------------------------------- - -FastQC v0.4.4 makes a number of changes to the previous -release which hopefully improve the relevance of the output. - -* The fitting of the normal curve to the %GC distribution has - been improved for shorter sequences - -* Each section of the HTML report output now has a pass/warn/fail - icon next to it, rather than just having them at the top - -* The duplicate level analysis now estimates the total percentage - of sequences which are not unique, reports this on the graph and - uses this as the basis for the pass/warn/fail filtering - -* The structure of the HTML output folder has been changed so that - icons and images are put into subfolders so the only files at - the top level are ones which the user is intended to open directly. - - -RELEASE NOTES FOR FastQC V0.4.3 -------------------------------- - -FastQC v0.4.3 is a bugfix release which fixes a bug and adds -an extra check to the interactive program. - -In versions of the program since v0.2 the total sequence count -in the Basic Stats module may have been incorrect by a few percent -(either high or low). This is because instead of using the real -sequence count the module was using an estimated count which should -only be used for updating the progress indicators. The module -has now been fixed to report the actual sequence count. - -In the interactive application there was no warning given if you -chose to save a report and opted to overwrite an existing report. You -will now be warned in this case an offered the chance to use a -different filename. This change won't affect the non-interactive -mode of the program where report files will be overwritten if the -program is run more than once on the same set of data. - -RELEASE NOTES FOR FastQC V0.4.2 -------------------------------- - -FastQC v0.4.2 is a minor release which fixes some bugs and improves -the warnings on some of the analysis modules. - -Bugs which were fixed were: - -* The per-base quality plot showed an incorrect scale on the - y-axis. This was usually off by about 2, but could be more - depending on the data. The relative relationships shown - were correct, it was just the scale bar which was wrong. - -* The sequence parser incorrectly identified some base called - files as colorspace files where they contained dots in place - of N base calls. This has now been improved but will still - fail for the base where a base called file starts with an - entry which is a single called base followed by all dots - since this is indistinguishable from a colorspace fastq file. - -* Some JREs (notably OpenJDK) can't cope with a headless environment - being set from within the program. I've therefore added code - to the fastqc wrapper script to externally set the headless - environment up to bypass this problem. - -Other improvements which have been made are: - -* When writing out graphs for the HTML report we now scale some - graphs by the length of the sequences analysed so we don't get - really squashed graphs. The interactive application will still - scale the graphs to the size of the window - -* More checks have been added to the parsing of FastQ files to - ensure we're looking at the correct file format. A better reporting - mechanism has been added to allow the program to cope better with - problems during parsing. - -* The per-sequence GC plot has been modified to add in a modelled - normal distribtion over the observed distribution so you can see - how well the two fit. - -* All modules (apart from the general stats) now have valid checks - in place, and all can now produce warnings and failures. Some of - the checks in the existing modules have been changed to better cope - with libraries with very low or high GC content. - - -RELEASE NOTES FOR FastQC V0.4.1 -------------------------------- - -FastQC v0.4.1 is a bugfix release which changes the operation -of the duplicate sequence and overrepresented sequence modules. - -Both of these modules now only track sequences which appear in -the first 200,000 sequences of a file. This change was made -because people using longer read lengths found that tracking -the first million sequences led to the program exhausting its -allocated memory. - -The other change is that the duplicate sequence module now -tracks sequence counts to the end of the file rather than -stopping after a million sequences. This means the final -duplication counts seen are much more realistic and should -match with what you would see in a genome browser. Because -of this change the cutoffs to flag a file with a warning or -an error have been increased. You now get a warning when -the sum of duplicated sequences is more than 20% of the -unique sequences. You get an error when there are more -duplicated sequences than unique sequences. - - -RELEASE NOTES FOR FastQC V0.4 ------------------------------ - -FastQC v0.4 introduces a new analysis module, and easier way -to launch the program from the command line and a new output -file, as well as fixing a few minor bugs. - -The new analysis module is the sequence duplication level -module. This is a complement to the existing overrepresented -sequences module in that it looks at sequences which occur -more than once in your data. The new module takes a more -global view and says what proportion of all of your sequences -occur once, twice, three times etc. In a diverse library most -sequences should occur only once. A highly enriched library -may have some duplication, but higher levels of duplication -may indicate a problem, such as a PCR overamplification. - -In response to several requests we've also now introduced a -new output file into the report. This is a text based, tab -delimited file which includes all of the data show in the -graphs in the graphical report. This would allow people -running pipelines to store the data generated by fastQC and -analyse it systematically rather than just taking the -pass/fail/warn summary, or reviewing the reports manually. - -Finally, if you're running fastqc from the command line we've -now included a 'fastqc' wrapper script which you can launch -directly rather than having to construct a java launch -command. You can still pass -Dxxx options through to the -program, but for simple analyses you can now simply run: - -fastqc [some files] - -..once you have included the FastQC install directory into your -path. More details are in the install document. - -Other minor changes: - -- The over-represented sequences module now scans the first -million sequences to decide which sequences to track to the -end of the file. - -- The labeling on the per-base N content graph is now correct - - - -RELEASE NOTES FOR FastQC V0.3.1 -------------------------------- - -V0.3.1 is a bugfix release which fixes a few minor problems. - -1) The template system now correctly checks that it only imports -graphics files from the templates directory into the report -files and doesn't break when it encounters unexpected files. - -2) The offline mode now correctly reports the progress of all -processed files rather than just the first one. - -3) The documentation has been updated to include information on -the blue mean line in the per base quality plot. - - -RELEASE NOTES FOR FastQC V0.3 ------------------------------ - -Major new additions to v0.3 are listed below: - -1) Support for gzip compressed fastq files. You can now -load gzip compressed fastq files into FastQC in the same -way as uncompressed files. The files will be decompressed -interactively and can be viewed in the same way as for -uncompressed files. - -2) Contaminant identification. If your library is found to -have overrepresented sequences in it these are now scanned -against a database of common contaminants (primers, adapters etc) -to see if the source of the contamination can be identified. -The database is stored in a new Contaminants folder in the -main installation directory, and can be updated with your -own protocol specific sequences. - -3) When in non-interactive mode you can now pass a -preference -Dfastqc.output_dir to provide an alternative location -to save reports to, rather than having them in the same -directory as the source fastq files. - -Some improvements have also been made to the colorspace support -so this version should support a wider range of colorspace -fastq files. - - -RELEASE NOTES FOR FastQC V0.2 ------------------------------ - -There are a few new additions in v0.2 of FastQC - -1) Colorspace support: We now have rudimentary support for the -analysis of fastq files in colorspace. The analysis is done by -converting the colorspace calls to basecalls, which isn't ideal -but is hopefully more useful than nothing. - -2) Option to unzip reports. The default action in non-interactive -mode is now to both create a zip file containing the FastQC report -and to unzip this into a folder of the same name. If you just want -to generate the zip files you can add -Dfastqc.unzip=false to the -command line to suppress this new behaviour - -3) It is now possible to customise the HTML report for your site. -There is an HTML template which can be edited to add your own -branding to the reports you generate. - -4) In addition to the human readable HTML report we now also -generate a tab delimited summary file which should make it -easier to integrate FastQC into an automated reporting system -which spots any potential problems with the data. - - -RELEASE NOTES FOR FastQC V0.1.1 -------------------------------- - -This point release fixes a problem when running FastQC in a -non-interactive mode on a system without a graphical display. -The program should now operate correctly on headless systems -as long as the filename(s) to process are specified on the -command line. - - -RELEASE NOTES FOR FastQC V0.1 -------------------------------- - -FastQC v0.1 is a beta release it should work in its present state but -we are keen to get feedback on the program. In particular we are -interested to hear if anyone has: - -1) Suggestions for other checks we could be performing. - -2) Comments about the criteria we set for issuing warnings or errors and -suggestions for how these could be improved. - -You can report feedback either though our bug reporting tool at: - -www.bioinformatics.bbsrc.ac.uk/bugzilla/ - -...or directly to simon.andrews@bbsrc.ac.uk diff --git a/SequenceAnalysis/resources/external/fastqc/Templates/header_template.html b/SequenceAnalysis/resources/external/fastqc/Templates/header_template.html index bbd34b399..588d8f2f0 100644 --- a/SequenceAnalysis/resources/external/fastqc/Templates/header_template.html +++ b/SequenceAnalysis/resources/external/fastqc/Templates/header_template.html @@ -1,4 +1,3 @@ - FastQC Report @@ -7,10 +6,11 @@ - - + +

-

+
+ \ No newline at end of file diff --git a/SequenceAnalysis/resources/external/fastqc/fastqc_icon.ico b/SequenceAnalysis/resources/external/fastqc/fastqc_icon.ico deleted file mode 100644 index 6b5567fbb..000000000 Binary files a/SequenceAnalysis/resources/external/fastqc/fastqc_icon.ico and /dev/null differ diff --git a/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$1.class b/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$1.class index 3294940a8..afdca438e 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$1.class and b/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$1.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$InputStream.class b/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$InputStream.class index b35be85d4..570c512fc 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$InputStream.class and b/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$InputStream.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$OutputStream.class b/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$OutputStream.class index 98dfc3271..a215e0d7a 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$OutputStream.class and b/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64$OutputStream.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64.class b/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64.class index 9870f88f3..a8aa67800 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64.class and b/SequenceAnalysis/resources/external/fastqc/net/sourceforge/iharder/base64/Base64.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/AnalysisQueue.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/AnalysisQueue.class index e91f45d65..4ab1c43b9 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/AnalysisQueue.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/AnalysisQueue.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/AnalysisRunner.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/AnalysisRunner.class index b3368b9bd..e11aee370 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/AnalysisRunner.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/AnalysisRunner.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/OfflineRunner.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/OfflineRunner.class index 8c4edbfa5..01c89f468 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/OfflineRunner.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Analysis/OfflineRunner.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/AboutDialog$1.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/AboutDialog$1.class index e3532ee87..6760e287d 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/AboutDialog$1.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/AboutDialog$1.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/FastQCTitlePanel$SmoothJLabel.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/FastQCTitlePanel$SmoothJLabel.class index 7546d6c89..443524c49 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/FastQCTitlePanel$SmoothJLabel.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/FastQCTitlePanel$SmoothJLabel.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/FastQCTitlePanel.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/FastQCTitlePanel.class index b6490e0d4..141de3522 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/FastQCTitlePanel.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Dialogs/FastQCTitlePanel.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCApplication$1.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCApplication$1.class index aff23a34c..f4c16de2d 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCApplication$1.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCApplication$1.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCApplication.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCApplication.class index c73c6a1fb..53a4a1517 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCApplication.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCApplication.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCConfig.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCConfig.class index 969e1f242..86aa22724 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCConfig.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCConfig.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCMenuBar.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCMenuBar.class index a0c394301..767915ef9 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCMenuBar.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FastQCMenuBar.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/BAMFileFilter.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/BAMFileFilter.class index 3d83e0097..cffbb3e7e 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/BAMFileFilter.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/BAMFileFilter.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/FastQFileFilter.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/FastQFileFilter.class index c005190c4..d2f845e47 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/FastQFileFilter.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/FastQFileFilter.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/MappedBAMFileFilter.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/MappedBAMFileFilter.class index 8946edee4..2c479bae3 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/MappedBAMFileFilter.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/FileFilters/MappedBAMFileFilter.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/BaseGroup.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/BaseGroup.class index de77bf1d5..8a5d17292 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/BaseGroup.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/BaseGroup.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/LineGraph.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/LineGraph.class index d3b476e75..baa2500e2 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/LineGraph.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/LineGraph.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/QualityBoxPlot.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/QualityBoxPlot.class index 9bd158417..1af5937b3 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/QualityBoxPlot.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/QualityBoxPlot.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/TileGraph.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/TileGraph.class index a1f6de086..f00977dcb 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/TileGraph.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Graphs/TileGraph.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpIndexRoot$FileSorter.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpIndexRoot$FileSorter.class index e944f3b42..726515163 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpIndexRoot$FileSorter.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpIndexRoot$FileSorter.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpIndexRoot.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpIndexRoot.class index 313ef31b9..1fdc42f6f 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpIndexRoot.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpIndexRoot.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpPage.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpPage.class index d2da4bcd8..3a5b6f3a0 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpPage.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpPage.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpPageDisplay.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpPageDisplay.class index ed169ef18..fa499982c 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpPageDisplay.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpPageDisplay.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpSearchPanel.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpSearchPanel.class index f04c6cc3d..b84ce63b7 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpSearchPanel.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Help/HelpSearchPanel.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AbstractQCModule.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AbstractQCModule.class index e1679bbe7..fa55b7342 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AbstractQCModule.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AbstractQCModule.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent$Adapter.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent$Adapter.class index 0f60f33be..5b74276db 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent$Adapter.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent$Adapter.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent$ResultsTable.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent$ResultsTable.class index 2233de08e..ff259a528 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent$ResultsTable.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent$ResultsTable.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent.class index e8127a4c1..a4af7d7a5 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/AdapterContent.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/BasicStats$ResultsTable.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/BasicStats$ResultsTable.class index 031ce9de0..1dcef0d6f 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/BasicStats$ResultsTable.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/BasicStats$ResultsTable.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/BasicStats.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/BasicStats.class index e4be1c380..a671047f2 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/BasicStats.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/BasicStats.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/DuplicationLevel.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/DuplicationLevel.class index 6f0dc2505..facbdf6da 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/DuplicationLevel.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/DuplicationLevel.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent$Kmer.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent$Kmer.class index 119cc340d..88aa00b9c 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent$Kmer.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent$Kmer.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent$ResultsTable.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent$ResultsTable.class index c8c253333..6e33046e5 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent$ResultsTable.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent$ResultsTable.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent.class index bbc7ce36c..c9f34a90d 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/KmerContent.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/ModuleConfig.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/ModuleConfig.class index b6446e24a..929427358 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/ModuleConfig.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/ModuleConfig.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/ModuleFactory.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/ModuleFactory.class new file mode 100644 index 000000000..d93fb87bf Binary files /dev/null and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/ModuleFactory.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/NContent.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/NContent.class index 77cf5cc45..28d102fcd 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/NContent.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/NContent.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs$OverrepresentedSeq.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs$OverrepresentedSeq.class index 224c0008d..ba39357d8 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs$OverrepresentedSeq.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs$OverrepresentedSeq.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs$ResultsTable.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs$ResultsTable.class index 6d212cac8..2c984f724 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs$ResultsTable.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs$ResultsTable.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs.class index 49f260797..7948152c7 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/OverRepresentedSeqs.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerBaseQualityScores.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerBaseQualityScores.class index 56f455ad8..421f27c91 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerBaseQualityScores.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerBaseQualityScores.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerBaseSequenceContent.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerBaseSequenceContent.class index 8c3f406c0..e3eab69cf 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerBaseSequenceContent.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerBaseSequenceContent.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerSequenceGCContent.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerSequenceGCContent.class index 17b3136a2..41f7601e6 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerSequenceGCContent.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerSequenceGCContent.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerSequenceQualityScores.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerSequenceQualityScores.class index 85df965ea..b8426c4c2 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerSequenceQualityScores.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerSequenceQualityScores.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerTileQualityScores.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerTileQualityScores.class index 3d70c8098..81435e7a2 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerTileQualityScores.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/PerTileQualityScores.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/SequenceLengthDistribution.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/SequenceLengthDistribution.class index eaad8eef8..9a18aa35b 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/SequenceLengthDistribution.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Modules/SequenceLengthDistribution.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Report/HTMLReportArchive.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Report/HTMLReportArchive.class index 6b7512973..7da9246ea 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Report/HTMLReportArchive.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Report/HTMLReportArchive.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Results/ResultsPanel$ModuleRenderer.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Results/ResultsPanel$ModuleRenderer.class index 56a90d07d..1a9672766 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Results/ResultsPanel$ModuleRenderer.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Results/ResultsPanel$ModuleRenderer.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Results/ResultsPanel.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Results/ResultsPanel.class index d45cd9858..94d20b986 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Results/ResultsPanel.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Results/ResultsPanel.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/BAMFile.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/BAMFile.class index 4af6a909b..046d7c31f 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/BAMFile.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/BAMFile.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/Contaminant.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/Contaminant.class index c02411997..02230c63b 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/Contaminant.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/Contaminant.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/ContaminantHit.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/ContaminantHit.class index 0888553e4..bdd2383e1 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/ContaminantHit.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/ContaminantHit.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/ContaminentFinder.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/ContaminentFinder.class index 9a78af34c..7c2373654 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/ContaminentFinder.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Contaminant/ContaminentFinder.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Fast5File.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Fast5File.class new file mode 100644 index 000000000..cc32648e4 Binary files /dev/null and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/Fast5File.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/FastQFile.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/FastQFile.class index 06b5ea16c..678b49ece 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/FastQFile.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/FastQFile.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/QualityEncoding/PhredEncoding.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/QualityEncoding/PhredEncoding.class index 21acc28f1..3e5c7aa81 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/QualityEncoding/PhredEncoding.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/QualityEncoding/PhredEncoding.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/SequenceFactory.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/SequenceFactory.class index da4f9fe27..680dcf0ef 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/SequenceFactory.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/SequenceFactory.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/SequenceFileGroup.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/SequenceFileGroup.class index f4f4ec797..8b9f1fef1 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/SequenceFileGroup.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Sequence/SequenceFileGroup.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/CasavaBasename.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/CasavaBasename.class index ce47124a1..c98114f0a 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/CasavaBasename.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/CasavaBasename.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/HotColdColourGradient.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/HotColdColourGradient.class index 118b168d5..619ed58a5 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/HotColdColourGradient.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/HotColdColourGradient.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageSaver/SVGGenerator$SVGGraphics.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageSaver/SVGGenerator$SVGGraphics.class new file mode 100644 index 000000000..6548dec85 Binary files /dev/null and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageSaver/SVGGenerator$SVGGraphics.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageSaver/SVGGenerator.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageSaver/SVGGenerator.class new file mode 100644 index 000000000..23150125d Binary files /dev/null and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageSaver/SVGGenerator.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageSaver/SVGImageSaver.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageSaver/SVGImageSaver.class new file mode 100644 index 000000000..b1e3db125 Binary files /dev/null and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageSaver/SVGImageSaver.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageToBase64.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageToBase64.class index 6a72cfc06..2f181ab77 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageToBase64.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/ImageToBase64.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/MultiMemberGZIPInputStream.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/MultiMemberGZIPInputStream.class index e0eaffcd5..10cfc98ae 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/MultiMemberGZIPInputStream.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/MultiMemberGZIPInputStream.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/NanoporeBasename.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/NanoporeBasename.class new file mode 100644 index 000000000..2987459fe Binary files /dev/null and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/NanoporeBasename.class differ diff --git a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/QualityCount.class b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/QualityCount.class index 788e458e3..163168b53 100644 Binary files a/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/QualityCount.class and b/SequenceAnalysis/resources/external/fastqc/uk/ac/babraham/FastQC/Utilities/QualityCount.class differ diff --git a/SequenceAnalysis/resources/external/jbzip2-0.9.jar b/SequenceAnalysis/resources/external/jbzip2-0.9.jar deleted file mode 100644 index 803be9d32..000000000 Binary files a/SequenceAnalysis/resources/external/jbzip2-0.9.jar and /dev/null differ diff --git a/SequenceAnalysis/resources/external/qscript/IndelRealignerRunner.scala b/SequenceAnalysis/resources/external/qscript/IndelRealignerRunner.scala deleted file mode 100644 index badb29148..000000000 --- a/SequenceAnalysis/resources/external/qscript/IndelRealignerRunner.scala +++ /dev/null @@ -1,35 +0,0 @@ -import org.broadinstitute.gatk.queue.QScript -import org.broadinstitute.gatk.queue.extensions.gatk._ - -class IndelRealignerRunner extends QScript { - - qscript => - - // Required arguments. All initialized to empty values. - @Input(doc="The reference file for the bam files.", shortName="R") - var referenceFile: File = _ // _ is scala shorthand for null - - @Input(doc="One or more bam files.", shortName="I") - var bamFiles: List[File] = Nil - - @Output(fullName = "output", shortName = "o", doc = "the output file") - var output: File = _ - - @Output(fullName = "targetIntervals", shortName = "targetIntervals", doc = "the intervals file output from RealignerTargetCreator") - var targetIntervals: File = _ - - @Argument(fullName="scatterCount", shortName="scatterCount", doc="the number of concurrent jobs", required=false) - var scatterCount: Int = 1 - - def script(){ - val realigner = new IndelRealigner - realigner.R = this.referenceFile - realigner.I = this.bamFiles - realigner.out = this.output - realigner.bam_compression = 9 - realigner.targetIntervals = this.targetIntervals - realigner.scatterCount = this.scatterCount - - add(realigner) - } -} \ No newline at end of file diff --git a/SequenceAnalysis/resources/external/sam-1.96.jar b/SequenceAnalysis/resources/external/sam-1.96.jar deleted file mode 100644 index bcb94a844..000000000 Binary files a/SequenceAnalysis/resources/external/sam-1.96.jar and /dev/null differ diff --git a/SequenceAnalysis/resources/external/tableToGraph.r b/SequenceAnalysis/resources/external/tableToGraph.r deleted file mode 100644 index c16f6a40c..000000000 --- a/SequenceAnalysis/resources/external/tableToGraph.r +++ /dev/null @@ -1,53 +0,0 @@ -library(reshape) -library(lattice) -library(plyr) -library(ggplot2) -library(grid) -library(perm) -library(gridExtra) -library(naturalsort) - -library(getopt); -library(Matrix); - -spec <- matrix(c( - 'inputFile', 'i', 1, "character", - 'outputFile', 'o', 1, "character", - 'plotTitle', 't', 2, "character", - 'xLabel', NA, 2, "character", - 'yLabel', NA, 2, "character", - 'xColIdx', NA, 1, "integer", - 'yColIdx', NA, 1, "integer", - 'hasHeaders', 'h', 2, "logical" -), ncol=4, byrow=TRUE); -opts = getopt(spec, commandArgs(trailingOnly = TRUE)); - -if ( is.null(opts$yLabel ) ) { opts$yLabel = "" } -if ( is.null(opts$xLabel ) ) { opts$xLabel = "" } -if ( is.null(opts$plotTitle ) ) { opts$plotTitle = "" } -if ( is.null(opts$hasHeaders ) ) { opts$hasHeaders = TRUE } - -df <- read.table(opts$inputFile, quote="\"", header = opts$hasHeaders); - -xColName <-names(df)[opts$xColIdx]; -yColName <- names(df)[opts$yColIdx]; -#str(df) - -P<-ggplot(df,aes_string(x=xColName,y=yColName)) + - ggtitle(opts$plotTitle) + - #scale_y_continuous(limits=c(0,2),labels=c("0.0","0.5","1.0","1.5","2.0")) + - geom_point(stat='identity') + - theme( - #axis.text.x = element_blank(), - plot.margin = unit(c(0.3,0.3,0.3,0.3),"in"), - plot.title = element_text(size=14,vjust=2), - axis.title.x = element_text(size=14,vjust=-1), - axis.title.y = element_text(size=14,vjust=2), - strip.text.x = element_text(size = 12,face="bold")) + - xlab(opts$xLabel) + - ylab(opts$yLabel) - - -png(opts$outputFile,width=880, height=680) -print(P); -dev.off(); \ No newline at end of file diff --git a/SequenceAnalysis/resources/web/SequenceAnalysis/panel/VariantProcessingPanel.js b/SequenceAnalysis/resources/web/SequenceAnalysis/panel/VariantProcessingPanel.js index 8f21bacc2..96436e527 100644 --- a/SequenceAnalysis/resources/web/SequenceAnalysis/panel/VariantProcessingPanel.js +++ b/SequenceAnalysis/resources/web/SequenceAnalysis/panel/VariantProcessingPanel.js @@ -249,7 +249,7 @@ Ext4.define('SequenceAnalysis.panel.VariantProcessingPanel', { name: 'maxSamplesPerWorkspace', label: 'Max Samples Per Workspace', description: 'If multiple input gVCFs are provided, the pipeline will batch samples into workspaces with at most this many samples', - defaultValue: 3000 + defaultValue: 4000 },{ fieldXtype: 'ldk-integerfield', name: 'batchSize', diff --git a/SequenceAnalysis/src/org/labkey/sequenceanalysis/SequencePipelineServiceImpl.java b/SequenceAnalysis/src/org/labkey/sequenceanalysis/SequencePipelineServiceImpl.java index f42aa99db..a8cb96339 100644 --- a/SequenceAnalysis/src/org/labkey/sequenceanalysis/SequencePipelineServiceImpl.java +++ b/SequenceAnalysis/src/org/labkey/sequenceanalysis/SequencePipelineServiceImpl.java @@ -523,6 +523,7 @@ public void registerResourceSettings(JobResourceSettings settings) _resourceSettings.add(settings); } + @Override public Set getResourceSettings() { return _resourceSettings; diff --git a/SequenceAnalysis/src/org/labkey/sequenceanalysis/run/util/FastqcRunner.java b/SequenceAnalysis/src/org/labkey/sequenceanalysis/run/util/FastqcRunner.java index 8b11dea00..aadef9827 100644 --- a/SequenceAnalysis/src/org/labkey/sequenceanalysis/run/util/FastqcRunner.java +++ b/SequenceAnalysis/src/org/labkey/sequenceanalysis/run/util/FastqcRunner.java @@ -220,8 +220,8 @@ private String processOutput(List inputFiles, Set filesCreated, @Nul return ""; } - String output = ""; - String header = "

File Summary:

    "; + StringBuilder output = new StringBuilder(); + StringBuilder header = new StringBuilder("

    File Summary:

      "); try { @@ -233,7 +233,7 @@ private String processOutput(List inputFiles, Set filesCreated, @Nul File htmlFile = getExpectedHtmlFile(f); if (!htmlFile.exists()) { - output += "

      Unable to find output for file: " + f.getName() + "

      "; + output.append("

      Unable to find output for file: ").append(f.getName()).append("

      "); continue; } @@ -268,16 +268,16 @@ private String processOutput(List inputFiles, Set filesCreated, @Nul css = ""; html = html.replaceAll("\n", ""); - output += delim + html; + output.append(delim).append(html); delim = "
      "; //also build a header: - header += "
    • " + title + "
      • "; + header.append("
    • ").append(title).append("
      • "); //remove footer except on final file if (counter < inputFiles.size() - 1) { - output = output.replaceAll("
      .*
      ", ""); + output = new StringBuilder(output.toString().replaceAll("
      .*
      ", "")); } counter++; @@ -285,9 +285,9 @@ private String processOutput(List inputFiles, Set filesCreated, @Nul if (inputFiles.size() > 1) { - header += "

    "; + header.append("

"); String tag = "
"; - output = output.replace(tag, tag + header); + output = new StringBuilder(output.toString().replace(tag, tag + header)); } } catch (IOException e) @@ -304,7 +304,7 @@ private String processOutput(List inputFiles, Set filesCreated, @Nul } } - return output; + return output.toString(); } private String readCompressedHtmlReport(File htmlFile) throws IOException @@ -367,13 +367,17 @@ private List getBaseParams() throws FileNotFoundException File libDir = new File(ModuleLoader.getInstance().getModule(SequenceAnalysisModule.NAME).getExplodedPath(), "lib"); File fastqcDir = new File(libDir.getParentFile(), "external/fastqc"); - File bzJar = new File(libDir, "bzip2-0.9.1.jar"); - if (!bzJar.exists()) - throw new RuntimeException("Not found: " + bzJar.getPath()); + File jbzip2 = new File(libDir, "bzip2-0.9.1.jar"); + if (!jbzip2.exists()) + { + throw new RuntimeException("Not found: " + jbzip2.getPath()); + } - File samJar = new File(libDir, "sam-1.96.jar"); - if (!samJar.exists()) - throw new RuntimeException("Not found: " + samJar.getPath()); + File htsjdkJar = new File(libDir, "htsjdk-3.0.1.jar"); + if (!htsjdkJar.exists()) + { + throw new RuntimeException("Not found: " + htsjdkJar.getPath()); + } File commonsMath = new File(libDir, "commons-math3-3.6.1.jar"); if (!commonsMath.exists()) @@ -381,12 +385,26 @@ private List getBaseParams() throws FileNotFoundException throw new RuntimeException("Not found: " + commonsMath.getPath()); } + File jhdf5 = new File(libDir, "jhdf5-19.04.1.jar"); + if (!jhdf5.exists()) + { + throw new RuntimeException("Not found: " + jhdf5.getPath()); + } + + // NOTE: FastQC expects an alternate package name within this JAR, so use their packaged code instead: +// File base64 = new File(libDir, "base64-2.3.8.jar"); +// if (!base64.exists()) +// { +// throw new RuntimeException("Not found: " + base64.getPath()); +// } + List classPath = new ArrayList<>(); classPath.add("."); classPath.add(fastqcDir.getPath()); - classPath.add(samJar.getPath()); - classPath.add(bzJar.getPath()); + classPath.add(htsjdkJar.getPath()); + classPath.add(jbzip2.getPath()); classPath.add(commonsMath.getPath()); + classPath.add(jhdf5.getPath()); params.add("-classpath"); params.add(StringUtils.join(classPath, File.pathSeparator)); diff --git a/SequenceAnalysis/tools/pipeline_config/pipelineConfig_remote.xml b/SequenceAnalysis/tools/pipeline_config/pipelineConfig_remote.xml deleted file mode 100644 index be4fd23f8..000000000 --- a/SequenceAnalysis/tools/pipeline_config/pipelineConfig_remote.xml +++ /dev/null @@ -1,91 +0,0 @@ - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - diff --git a/SequenceAnalysis/tools/pipeline_config/remoteMuleConfig.xml b/SequenceAnalysis/tools/pipeline_config/remoteMuleConfig.xml deleted file mode 100644 index 3f4525742..000000000 --- a/SequenceAnalysis/tools/pipeline_config/remoteMuleConfig.xml +++ /dev/null @@ -1,115 +0,0 @@ - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - diff --git a/SequenceAnalysis/tools/pipeline_config/sequenceanalysisConfig.xml b/SequenceAnalysis/tools/pipeline_config/sequenceanalysisConfig.xml deleted file mode 100644 index df485de76..000000000 --- a/SequenceAnalysis/tools/pipeline_config/sequenceanalysisConfig.xml +++ /dev/null @@ -1,33 +0,0 @@ - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - \ No newline at end of file diff --git a/Studies/build.gradle b/Studies/build.gradle index ba037f25b..fcd61b0d7 100644 --- a/Studies/build.gradle +++ b/Studies/build.gradle @@ -11,5 +11,7 @@ dependencies BuildUtils.addLabKeyDependency(project: project, config: "modules", depProjectPath: ":server:modules:LabDevKitModules:laboratory", depProjectConfig: "published", depExtension: "module") BuildUtils.addLabKeyDependency(project: project, config: "modules", depProjectPath: ":server:modules:LabDevKitModules:LDK", depProjectConfig: "published", depExtension: "module") + + BuildUtils.addLabKeyDependency(project: project, config: "modules", depProjectPath: ":server:modules:DiscvrLabKeyModules:discvrcore", depProjectConfig: "published", depExtension: "module") } diff --git a/blast/src/org/labkey/blast/BLASTController.java b/blast/src/org/labkey/blast/BLASTController.java index 56e89fdbb..74e2d9815 100644 --- a/blast/src/org/labkey/blast/BLASTController.java +++ b/blast/src/org/labkey/blast/BLASTController.java @@ -20,15 +20,16 @@ import org.jetbrains.annotations.NotNull; import org.json.JSONObject; import org.labkey.api.action.AbstractFileUploadAction; -import org.labkey.api.action.ReadOnlyApiAction; -import org.labkey.api.action.MutatingApiAction; import org.labkey.api.action.ApiJsonWriter; import org.labkey.api.action.ApiResponse; import org.labkey.api.action.ApiSimpleResponse; import org.labkey.api.action.ExportAction; +import org.labkey.api.action.MutatingApiAction; +import org.labkey.api.action.ReadOnlyApiAction; import org.labkey.api.action.SimpleErrorView; import org.labkey.api.action.SimpleViewAction; import org.labkey.api.action.SpringActionController; +import org.labkey.api.assay.AssayFileWriter; import org.labkey.api.data.Container; import org.labkey.api.data.ContainerManager; import org.labkey.api.data.PropertyManager; @@ -48,7 +49,6 @@ import org.labkey.api.security.permissions.InsertPermission; import org.labkey.api.security.permissions.ReadPermission; import org.labkey.api.security.permissions.UpdatePermission; -import org.labkey.api.assay.AssayFileWriter; import org.labkey.api.util.ExceptionUtil; import org.labkey.api.util.PageFlowUtil; import org.labkey.api.util.Pair; @@ -69,6 +69,7 @@ import java.io.IOException; import java.io.OutputStreamWriter; import java.io.PrintWriter; +import java.io.Writer; import java.util.ArrayList; import java.util.Collections; import java.util.HashMap; @@ -605,7 +606,7 @@ public void export(DownloadBlastResultsForm form, HttpServletResponse response, return; } - try (OutputStreamWriter out = new OutputStreamWriter(response.getOutputStream(), StringUtilsLabKey.DEFAULT_CHARSET)) + try (Writer out = new OutputStreamWriter(response.getOutputStream(), StringUtilsLabKey.DEFAULT_CHARSET)) { Map headers = new HashMap<>(); diff --git a/blast/src/org/labkey/blast/BLASTMaintenanceTask.java b/blast/src/org/labkey/blast/BLASTMaintenanceTask.java index ecdae8548..b1d3fa8d7 100644 --- a/blast/src/org/labkey/blast/BLASTMaintenanceTask.java +++ b/blast/src/org/labkey/blast/BLASTMaintenanceTask.java @@ -23,6 +23,7 @@ import java.io.File; import java.io.FilenameFilter; import java.io.IOException; +import java.util.ArrayList; import java.util.List; import java.util.Set; @@ -78,6 +79,40 @@ public void run(Logger log) } } + //delete DBs linked to a genome that no longer exists + sqlDB = new SQLFragment("SELECT max(d.rowId) as maxRowId, d.container, d.libraryId FROM " + BLASTSchema.NAME + "." + BLASTSchema.TABLE_DATABASES + " d GROUP BY d.libraryId, d.container HAVING count(*) > 1"); + ss = new SqlSelector(BLASTSchema.getInstance().getSchema().getScope(), sqlDB); + if (ss.exists()) + { + final List objectIds = new ArrayList<>(); + ss.forEach(rs -> { + int libraryId = rs.getInt("libraryId"); + int maxRowId = rs.getInt("maxRowId"); + String container = rs.getString("container"); + + List toDelete = new SqlSelector(BLASTSchema.getInstance().getSchema().getScope(), new SQLFragment("SELECT objectId FROM " + BLASTSchema.NAME + "." + BLASTSchema.TABLE_DATABASES + " WHERE libraryId = ? AND rowId != ? AND container = ?", libraryId, maxRowId, container)).getArrayList(String.class); + objectIds.addAll(toDelete); + }); + + try (DbScope.Transaction transaction = BLASTSchema.getInstance().getSchema().getScope().ensureTransaction()) + { + objectIds.forEach(objectId -> { + log.info("deleting duplicate BLAST DB: " + objectId); + + Table.delete(BLASTSchema.getInstance().getSchema().getTable(BLASTSchema.TABLE_DATABASES), objectId); + + SqlExecutor ex = new SqlExecutor(BLASTSchema.getInstance().getSchema().getScope()); + int deleted = ex.execute(new SQLFragment("DELETE FROM " + BLASTSchema.NAME + "." + BLASTSchema.TABLE_BLAST_JOBS + " WHERE databaseid = ? ", objectId)); + if (deleted > 0) + { + log.info("also deleted " + deleted + " blast jobs associated with this database"); + } + }); + + transaction.commit(); + } + } + //delete BLAST jobs not flagged to persist TableInfo blastJobs = BLASTSchema.getInstance().getSchema().getTable(BLASTSchema.TABLE_BLAST_JOBS); TableSelector ts = new TableSelector(blastJobs); diff --git a/blast/src/org/labkey/blast/BLASTWrapper.java b/blast/src/org/labkey/blast/BLASTWrapper.java index 39c9535fc..086ecbaaf 100644 --- a/blast/src/org/labkey/blast/BLASTWrapper.java +++ b/blast/src/org/labkey/blast/BLASTWrapper.java @@ -3,7 +3,6 @@ import org.apache.commons.lang3.StringUtils; import org.apache.commons.lang3.SystemUtils; import org.apache.logging.log4j.Logger; -import org.apache.logging.log4j.LogManager; import org.jetbrains.annotations.Nullable; import org.labkey.api.pipeline.PipelineJobException; import org.labkey.api.pipeline.PipelineJobService; @@ -15,7 +14,6 @@ import java.io.File; import java.io.FilenameFilter; import java.io.IOException; -import java.io.Writer; import java.util.ArrayList; import java.util.Arrays; import java.util.List; @@ -94,7 +92,7 @@ public File runBlastN(String blastDbGuid, File input, File outputFile, Map args, @Nullable Writer writer) throws PipelineJobException, IOException + private @Nullable String executeBlast(List args, boolean retainOutput) throws PipelineJobException, IOException { StringBuilder output = new StringBuilder(); @@ -238,20 +236,14 @@ private void executeBlast(List args, @Nullable Writer writer) throws Pip getLogger().info(StringUtils.join(args, " ")); } - if (writer == null) + if (retainOutput) { - execute(args); + return executeWithOutput(args); } else { - String ret = executeWithOutput(args); - writer.write(ret); - } - - - if (getLogger() != null && output.length() > 0) - { - getLogger().info(output.toString()); + execute(args); + return null; } } diff --git a/blast/src/org/labkey/blast/model/BlastJob.java b/blast/src/org/labkey/blast/model/BlastJob.java index a8ceea54b..109d2ac91 100644 --- a/blast/src/org/labkey/blast/model/BlastJob.java +++ b/blast/src/org/labkey/blast/model/BlastJob.java @@ -1,8 +1,8 @@ package org.labkey.blast.model; import org.apache.commons.lang3.StringUtils; -import org.apache.logging.log4j.Logger; import org.apache.logging.log4j.LogManager; +import org.apache.logging.log4j.Logger; import org.jetbrains.annotations.Nullable; import org.json.JSONException; import org.json.JSONObject; @@ -19,23 +19,26 @@ import org.labkey.api.pipeline.PipelineService; import org.labkey.api.pipeline.PipelineStatusFile; import org.labkey.api.security.User; +import org.labkey.api.util.HtmlString; import org.labkey.blast.BLASTManager; import org.labkey.blast.BLASTSchema; import org.labkey.blast.BLASTWrapper; +import javax.servlet.jsp.JspWriter; import java.io.File; import java.io.IOException; import java.io.Serializable; import java.io.StringWriter; import java.io.Writer; import java.util.ArrayList; -import java.util.Collections; import java.util.Date; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Scanner; +import static org.labkey.api.util.HtmlString.unsafe; + /** * User: bimber * Date: 7/20/2014 @@ -320,7 +323,15 @@ public void getResults(BLAST_OUTPUT_FORMAT outputFormat, Writer out) throws IOEx return; } - outputFormat.processResults(output, out); + String results = outputFormat.processResults(output); + if (out instanceof JspWriter jsp) + { + jsp.print(outputFormat.supportsHTML() ? unsafe(results) : HtmlString.of(results)); + } + else + { + out.write(outputFormat.processResults(output)); + } } public boolean hasError(User u) @@ -381,16 +392,15 @@ public Alignment(int qLength, int sLength, int alignLength) private Map _perfectHitSummary; @Override - public void processResults(File results, Writer out) throws IOException, PipelineJobException + public String processResults(File results) throws IOException, PipelineJobException { //summary of perfect hits by query seq - try (StringWriter writer = new StringWriter()) + try (StringWriter out = new StringWriter()) { _perfectHitSummary = new HashMap<>(); - new BLASTWrapper(_log).runBlastFormatter(results, BLAST_OUTPUT_FORMAT.alignmentSummary, writer); - - Scanner scan = new Scanner(writer.getBuffer().toString()); + String resultsText = new BLASTWrapper(_log).runBlastFormatter(results, BLAST_OUTPUT_FORMAT.alignmentSummary); + Scanner scan = new Scanner(resultsText); while (scan.hasNextLine()) { String line = scan.nextLine(); @@ -420,7 +430,7 @@ public void processResults(File results, Writer out) throws IOException, Pipelin String qseq = tokens[8]; String sseq = tokens[9]; - int i=0; + int i = 0; int qmatch = 0; int qmismatch = 0; while (i < qseq.length()) @@ -448,58 +458,60 @@ public void processResults(File results, Writer out) throws IOException, Pipelin } } } - } - out.write("

Summary of Perfect Hits:
"); - out.write(""); - for (String qname : _perfectHitSummary.keySet()) - { - out.write(""); - out.write(""); - out.write(""); - - StringBuilder sNameCell = new StringBuilder(); - StringBuilder alignLengthCell = new StringBuilder(); - StringBuilder qLengthCell = new StringBuilder(); - StringBuilder sLengthCell = new StringBuilder(); - - Summary s = _perfectHitSummary.get(qname); - String br = ""; - for (String sname : s.hitMap.keySet()) + out.write("

Summary of Perfect Hits:
"); + out.write("
Query# Perfect HitsReference NamesAlignment LengthQuery LengthReference Length
" + qname + "" + _perfectHitSummary.get(qname).hitMap.size() + "
"); + for (String qname : _perfectHitSummary.keySet()) { - for (Alignment a : s.hitMap.get(sname)) + out.write(""); + out.write(""); + out.write(""); + + StringBuilder sNameCell = new StringBuilder(); + StringBuilder alignLengthCell = new StringBuilder(); + StringBuilder qLengthCell = new StringBuilder(); + StringBuilder sLengthCell = new StringBuilder(); + + Summary s = _perfectHitSummary.get(qname); + String br = ""; + for (String sname : s.hitMap.keySet()) { - sNameCell.append(br); - sNameCell.append(sname); + for (Alignment a : s.hitMap.get(sname)) + { + sNameCell.append(br); + sNameCell.append(sname); - alignLengthCell.append(br); - alignLengthCell.append(a.alignLength); + alignLengthCell.append(br); + alignLengthCell.append(a.alignLength); - qLengthCell.append(br); - qLengthCell.append(a.qLength); + qLengthCell.append(br); + qLengthCell.append(a.qLength); - sLengthCell.append(br); - sLengthCell.append(a.sLength); + sLengthCell.append(br); + sLengthCell.append(a.sLength); - br = "
"; + br = "
"; + } } - } - out.write(""); - out.write(""); - out.write(""); - out.write(""); + out.write(""); + out.write(""); + out.write(""); + out.write(""); - out.write(""); - } + out.write(""); + } - out.write("
Query# Perfect HitsReference NamesAlignment LengthQuery LengthReference Length
" + qname + "" + _perfectHitSummary.get(qname).hitMap.size() + "" + sNameCell + "" + alignLengthCell + "" + qLengthCell + "" + sLengthCell + "" + sNameCell + "" + alignLengthCell + "" + qLengthCell + "" + sLengthCell + "


"); - out.write("
"); + out.write("

"); + out.write("
"); - out.write("BLAST Output:"); - out.write("
");
-                new BLASTWrapper(_log).runBlastFormatter(results, BLAST_OUTPUT_FORMAT.flatQueryAnchoredWithIdentities, out);
-                out.write("
"); + out.write("BLAST Output:"); + out.write("
");
+                    out.write(new BLASTWrapper(_log).runBlastFormatter(results, BLAST_OUTPUT_FORMAT.flatQueryAnchoredWithIdentities));
+                    out.write("
"); + + return out.toString(); + } } private void appendHit(String qname, String sname, int qLen, int sLen, int alignLen) @@ -547,15 +559,15 @@ public boolean supportsHTML() return _supportsHTML; } - public void processResults(File results, Writer out) throws IOException, PipelineJobException + public String processResults(File results) throws IOException, PipelineJobException { if (_processor == null) { - new BLASTWrapper(_log).runBlastFormatter(results, this, out); + return new BLASTWrapper(_log).runBlastFormatter(results, this); } else { - _processor.processResults(results, out); + return _processor.processResults(results); } } @@ -563,7 +575,7 @@ public void processResults(File results, Writer out) throws IOException, Pipelin public interface BlastResultProcessor { - void processResults(File results, Writer out) throws IOException, PipelineJobException; + String processResults(File results) throws IOException, PipelineJobException; } } diff --git a/blast/src/org/labkey/blast/view/jobDetails.jsp b/blast/src/org/labkey/blast/view/jobDetails.jsp index 888d6ebc6..2846abf29 100644 --- a/blast/src/org/labkey/blast/view/jobDetails.jsp +++ b/blast/src/org/labkey/blast/view/jobDetails.jsp @@ -74,7 +74,7 @@ schemaName: 'blast', queryName: 'blast_jobs', filterArray: [ - LABKEY.Filter.create('objectid', <%=q(job.getObjectid())%>, LABKEY.Filter.Types.EQUAL) + LABKEY.Filter.create('objectid', <%=q(h(job.getObjectid()))%>, LABKEY.Filter.Types.EQUAL) ] } },{ @@ -82,7 +82,7 @@ },{ layout: 'hbox', border: false, - hidden: !<%=hasRun%>, + hidden: !<%=h(hasRun)%>, items: [{ xtype: 'combo', fieldLabel: 'Choose Output Format', @@ -92,7 +92,7 @@ valueField: 'id', labelWidth: 150, width: 600, - value: <%=q(outputFormat == null ? null : outputFormat.name())%>, + value: <%=q(h(outputFormat == null ? null : outputFormat.name()))%>, store: { type: 'array', fields: ['label', 'id'], @@ -123,7 +123,7 @@ return; } - window.location = LABKEY.ActionURL.buildURL('blast', 'jobDetails', null, {outputFmt: fmt, jobId: <%=q(job.getObjectid())%>}); + window.location = LABKEY.ActionURL.buildURL('blast', 'jobDetails', null, {outputFmt: fmt, jobId: <%=q(h(job.getObjectid()))%>}); } },{ xtype: 'button', @@ -139,8 +139,9 @@ var newForm = Ext4.DomHelper.append(document.getElementsByTagName('body')[0], '
' + '' + - '' + + '' + '' + + '' + '
'); newForm.submit(); @@ -164,7 +165,7 @@ getResultItems: function(){ var ret = []; - if (!<%=hasRun%>){ + if (!<%=h(hasRun)%>){ ret.push({ xtype: 'panel', minHeight: 200, @@ -191,13 +192,13 @@ Ext4.create('BLAST.panel.BlastDetailsPanel', { - }).render(<%=q(renderTarget)%>); + }).render(<%=q(h(renderTarget))%>); }); -
>
-
> +
>
+
> <% if (job.isHasRun()) { @@ -205,18 +206,18 @@ { if (!outputFormat.supportsHTML()) { - out.print("
");
+                    out.print(unsafe("
"));
                 }
                 job.getResults(outputFormat, out);
 
                 if (!outputFormat.supportsHTML())
                 {
-                    out.print("
");
+                    out.print(unsafe("
")); } } else { - out.print("Either no output format specified, or an invalid option was provided."); + out.print(h("Either no output format specified, or an invalid option was provided.")); } } else if (job.hasError(getUser())) diff --git a/cluster/src/org/labkey/cluster/PipelineStartup.java b/cluster/src/org/labkey/cluster/PipelineStartup.java index 9adf77f09..7027ebc65 100644 --- a/cluster/src/org/labkey/cluster/PipelineStartup.java +++ b/cluster/src/org/labkey/cluster/PipelineStartup.java @@ -35,7 +35,7 @@ private void registerPipelineSteps() { if (PipelineJobService.get().getLocationType() == PipelineJobService.LocationType.WebServer) { - for (RemoteExecutionEngine engine : PipelineJobService.get().getRemoteExecutionEngines()) + for (RemoteExecutionEngine engine : PipelineJobService.get().getRemoteExecutionEngines()) { try { diff --git a/cluster/src/org/labkey/cluster/pipeline/ClusterPipelineJob.java b/cluster/src/org/labkey/cluster/pipeline/ClusterPipelineJob.java index 610148e65..2ff235f9c 100644 --- a/cluster/src/org/labkey/cluster/pipeline/ClusterPipelineJob.java +++ b/cluster/src/org/labkey/cluster/pipeline/ClusterPipelineJob.java @@ -54,7 +54,7 @@ private ClusterPipelineJob(Container c, User user, PipeRoot pipeRoot, String des _location = location; } - public static ClusterPipelineJob createJob(Container c, User user, String jobName, ClusterService.ClusterRemoteTask runnable, RemoteExecutionEngine engine, File logFile) throws PipelineValidationException + public static ClusterPipelineJob createJob(Container c, User user, String jobName, ClusterService.ClusterRemoteTask runnable, RemoteExecutionEngine engine, File logFile) throws PipelineValidationException { if (!logFile.exists()) { @@ -134,7 +134,7 @@ public ClusterService.ClusterRemoteTask getRunnable() } @Override - public TaskPipeline getTaskPipeline() + public TaskPipeline getTaskPipeline() { return PipelineJobService.get().getTaskPipeline(_taskPipelineId); } @@ -161,14 +161,16 @@ public ClusterTaskFactory(TaskId id, String location) } @Override - public Task createTask(PipelineJob job) + public Task createTask(PipelineJob job) { - return new Task(this, job) + return new Task<>(this, job) { @NotNull @Override public RecordedActionSet run() throws PipelineJobException { + job.setStatus(TaskStatus.running, "I am running!"); + ((ClusterPipelineJob)getJob()).getRunnable().run(getJob().getLogger()); return new RecordedActionSet(); diff --git a/cluster/src/org/labkey/cluster/pipeline/TestCase.java b/cluster/src/org/labkey/cluster/pipeline/TestCase.java index 18a701646..b113e2613 100644 --- a/cluster/src/org/labkey/cluster/pipeline/TestCase.java +++ b/cluster/src/org/labkey/cluster/pipeline/TestCase.java @@ -53,8 +53,7 @@ public static void initialSetUp() throws Exception if (project == null) { project = ContainerManager.createContainer(ContainerManager.getRoot(), PROJECT_NAME, TestContext.get().getUser()); - Set modules = new HashSet<>(); - modules.addAll(project.getActiveModules()); + Set modules = new HashSet<>(project.getActiveModules()); modules.add(ModuleLoader.getInstance().getModule(ClusterModule.class)); project.setActiveModules(modules); } @@ -107,7 +106,11 @@ public void basicTest() throws Exception _log.info("testing engine: " + engine.getType()); if (engine instanceof AbstractClusterExecutionEngine acee) { +<<<<<<< HEAD runTestJob(c, TestContext.get().getUser(), acee); +======= + runTestJob(c, TestContext.get().getUser(), (AbstractClusterExecutionEngine) engine); +>>>>>>> origin/discvr-23.7 } } } @@ -140,7 +143,7 @@ public void run(Logger log) } } - public static void runTestJob(Container c, User u, AbstractClusterExecutionEngine engine) throws PipelineJobException + public static void runTestJob(Container c, User u, AbstractClusterExecutionEngine engine) throws PipelineJobException { boolean orig = engine.isDebug(); try diff --git a/discvrcore/src/org/labkey/discvrcore/AuditSummaryUserSchema.java b/discvrcore/src/org/labkey/discvrcore/AuditSummaryUserSchema.java new file mode 100644 index 000000000..6ed630904 --- /dev/null +++ b/discvrcore/src/org/labkey/discvrcore/AuditSummaryUserSchema.java @@ -0,0 +1,282 @@ +package org.labkey.discvrcore; + +import org.jetbrains.annotations.Nullable; +import org.junit.AfterClass; +import org.junit.Assert; +import org.junit.BeforeClass; +import org.junit.Test; +import org.labkey.api.audit.AuditLogService; +import org.labkey.api.collections.CaseInsensitiveHashMap; +import org.labkey.api.data.ColumnInfo; +import org.labkey.api.data.CompareType; +import org.labkey.api.data.Container; +import org.labkey.api.data.ContainerFilter; +import org.labkey.api.data.ContainerManager; +import org.labkey.api.data.DbSchema; +import org.labkey.api.data.DbSchemaType; +import org.labkey.api.data.JdbcType; +import org.labkey.api.data.SQLFragment; +import org.labkey.api.data.SimpleFilter; +import org.labkey.api.data.TableInfo; +import org.labkey.api.data.TableSelector; +import org.labkey.api.exp.property.DomainProperty; +import org.labkey.api.module.Module; +import org.labkey.api.module.ModuleLoader; +import org.labkey.api.query.BatchValidationException; +import org.labkey.api.query.DefaultSchema; +import org.labkey.api.query.ExprColumn; +import org.labkey.api.query.FieldKey; +import org.labkey.api.query.QueryForeignKey; +import org.labkey.api.query.QuerySchema; +import org.labkey.api.query.QueryService; +import org.labkey.api.query.SimpleUserSchema; +import org.labkey.api.query.UserSchema; +import org.labkey.api.security.MutableSecurityPolicy; +import org.labkey.api.security.SecurityManager; +import org.labkey.api.security.SecurityPolicyManager; +import org.labkey.api.security.User; +import org.labkey.api.security.UserManager; +import org.labkey.api.security.ValidEmail; +import org.labkey.api.security.roles.ReaderRole; +import org.labkey.api.study.Dataset; +import org.labkey.api.study.Study; +import org.labkey.api.study.StudyService; +import org.labkey.api.study.TimepointType; +import org.labkey.api.util.GUID; +import org.labkey.api.util.PageFlowUtil; +import org.labkey.api.util.TestContext; + +import java.util.ArrayList; +import java.util.Collections; +import java.util.Date; +import java.util.HashSet; +import java.util.List; +import java.util.Map; +import java.util.Set; + +public class AuditSummaryUserSchema extends SimpleUserSchema +{ + public static final String NAME = "AuditSummary"; + public static final String QUERY_AUDIT = "QueryUpdateAuditLog"; + public static final String DATASET_AUDIT = "DatasetUpdateAuditLog"; + + private AuditSummaryUserSchema(User user, Container container, DbSchema schema) + { + super(NAME, null, user, container, schema); + } + + public static void register(final Module m) + { + final DbSchema dbSchema = DbSchema.get(DiscvrCoreModule.NAME, DbSchemaType.Module); + + DefaultSchema.registerProvider(NAME, new DefaultSchema.SchemaProvider(m) + { + @Override + public QuerySchema createSchema(final DefaultSchema schema, Module module) + { + return new AuditSummaryUserSchema(schema.getUser(), schema.getContainer(), dbSchema); + } + }); + } + + @Override + public @Nullable String getDescription() + { + return "Contains a summary view of audit records, without record detail, primarily for use in ETLs "; + } + + @Override + public TableInfo createTable(String name, ContainerFilter cf) + { + if (name.equalsIgnoreCase(QUERY_AUDIT)) + { + return generateQueryAuditSql(name, cf); + } + else if (name.equalsIgnoreCase(DATASET_AUDIT)) + { + return generateDatasetAuditSql(name, cf); + } + + return super.createTable(name, cf); + } + + @Override + public Set getTableNames() + { + Set tables = new HashSet<>(super.getTableNames()); + tables.add(QUERY_AUDIT); + tables.add(DATASET_AUDIT); + + return Collections.unmodifiableSet(tables); + } + + @Override + public synchronized Set getVisibleTableNames() + { + return getTableNames(); + } + + private SimpleTable generateAuditSql(String tableName, String eventType, ContainerFilter cf) + { + Container target = getContainer().isWorkbookOrTab() ? getContainer().getParent() : getContainer(); + String storageTableName = AuditLogService.get().getAuditProvider(eventType).getDomain().getStorageTableName(); + DbSchema auditSchema = DbSchema.get("audit", DbSchemaType.Module); + TableInfo ti = auditSchema.getTable(storageTableName); + + SimpleTable st = new SimpleTable<>(this, ti, ContainerFilter.current(target)); + st.setName(tableName); + st.init(); + + // Don't expose more information than needed: + st.removeColumn(st.getColumn("CreatedBy")); + st.removeColumn(st.getColumn("ImpersonatedBy")); + st.removeColumn(st.getColumn("oldRecordMap")); + st.removeColumn(st.getColumn("newRecordMap")); + + ColumnInfo lsid = st.getColumn("lsid"); + if (lsid != null) + { + if (st.getSqlDialect().isPostgreSQL()) + { + st.addColumn(new ExprColumn(st, FieldKey.fromString("primaryKey"), new SQLFragment("right(" + ExprColumn.STR_TABLE_ALIAS + ".lsid, position('.' IN reverse(" + ExprColumn.STR_TABLE_ALIAS + ".lsid))-1)"), JdbcType.VARCHAR, lsid)); + } + else if (ti.getSqlDialect().isSqlServer()) + { + st.addColumn(new ExprColumn(st, FieldKey.fromString("primaryKey"), new SQLFragment("right(" + ExprColumn.STR_TABLE_ALIAS + ".lsid, charindex('.', reverse(" + ExprColumn.STR_TABLE_ALIAS + ".lsid))-1)"), JdbcType.VARCHAR, lsid)); + } + } + + return st; + } + + private TableInfo generateQueryAuditSql(String tableName, ContainerFilter cf) + { + return generateAuditSql(tableName, "QueryUpdateAuditEvent", cf); + } + + private TableInfo generateDatasetAuditSql(String tableName, ContainerFilter cf) + { + SimpleTable ti = generateAuditSql(tableName, "DatasetAuditEvent", cf); + Container target = getContainer().isWorkbookOrTab() ? getContainer().getParent() : getContainer(); + + UserSchema us = QueryService.get().getUserSchema(getUser(), target, "study"); + if (us != null) + { + ti.getMutableColumn("DatasetId").setFk(new QueryForeignKey(us.getTable("Datasets"), "DataSetId", "Name")); + } + + return ti; + } + + public static class TestCase extends Assert + { + public static final String PROJECT_NAME = "QueryExtensionsTestProject"; + + @BeforeClass + public static void setup() throws Exception + { + doCleanup(); + + Container c = getContainer(true); + User u = getReaderUser(true); + + MutableSecurityPolicy p = new MutableSecurityPolicy(c.getPolicy()); + p.addRoleAssignment(u, ReaderRole.class); + SecurityPolicyManager.savePolicy(p, TestContext.get().getUser()); + } + + private static Container getContainer(boolean createIfNeeded) + { + if (createIfNeeded && ContainerManager.getForPath(PROJECT_NAME) == null) + { + Container c = ContainerManager.createContainer(ContainerManager.getRoot(), PROJECT_NAME); + c.setActiveModules(PageFlowUtil.set(ModuleLoader.getInstance().getModule("study"), ModuleLoader.getInstance().getModule(DiscvrCoreModule.NAME))); + } + + return ContainerManager.getForPath(PROJECT_NAME); + } + + private Dataset createDataset(String name, boolean isDemographics) throws Exception + { + Dataset d1 = StudyService.get().createDataset(getContainer(true), TestContext.get().getUser(), name, null, isDemographics); + d1.setKeyManagementType(Dataset.KeyManagementType.GUID); + d1.setKeyPropertyName("objectId"); + DomainProperty objectId1 = d1.getDomain().addProperty(); + objectId1.setName("objectId"); + objectId1.setPropertyURI(AuditSummaryUserSchema.class.getName() + ":ObjectId"); + d1.getDomain().save(TestContext.get().getUser()); + d1.save(TestContext.get().getUser()); + + return d1; + } + + @Test + public void testAuditTables() throws Exception + { + Container c = getContainer(true); + + // Add a study: + Study s = StudyService.get().createStudy(c, TestContext.get().getUser(), "DemoStudy", TimepointType.CONTINUOUS, true); + + Dataset d1 = createDataset("Dataset1", false); + Dataset d2 = createDataset("Dataset2", true); + + String guid1 = new GUID().toString(); + + List> toInsert = new ArrayList<>(); + toInsert.add(new CaseInsensitiveHashMap<>(Map.of("ParticipantId", "P1", "Date", new Date(), "ObjectId", guid1))); + TableInfo t1 = d1.getTableInfo(TestContext.get().getUser()); + t1.getUpdateService().insertRows(TestContext.get().getUser(), c, toInsert, new BatchValidationException(), null, null); + + TableInfo t2 = d2.getTableInfo(TestContext.get().getUser()); + t2.getUpdateService().insertRows(TestContext.get().getUser(), c, toInsert, new BatchValidationException(), null, null); + + TableInfo qa = QueryService.get().getUserSchema(TestContext.get().getUser(), c, NAME).getTable(DATASET_AUDIT); + + TableSelector ts1 = new TableSelector(qa, PageFlowUtil.set("primaryKey")); + assertEquals("Incorrect row count", ts1.getRowCount(), 2L); + + assertEquals("Incorrect PK", new TableSelector(qa, PageFlowUtil.set("primaryKey"), new SimpleFilter(FieldKey.fromString("Comment"), "inserted", CompareType.CONTAINS).addCondition(FieldKey.fromString("DatasetId"), d1.getDatasetId()), null).getObject(String.class), guid1); + assertEquals("Incorrect PK", new TableSelector(qa, PageFlowUtil.set("primaryKey"), new SimpleFilter(FieldKey.fromString("Comment"), "inserted", CompareType.CONTAINS).addCondition(FieldKey.fromString("DatasetId"), d2.getDatasetId()), null).getObject(String.class), "P1"); + + assertEquals("Incorrect PK", new TableSelector(qa, PageFlowUtil.set("primaryKey"), new SimpleFilter(FieldKey.fromString("Comment"), "inserted", CompareType.CONTAINS).addCondition(FieldKey.fromString("DatasetId/Name"), d1.getName()), null).getObject(String.class), guid1); + assertEquals("Incorrect PK", new TableSelector(qa, PageFlowUtil.set("primaryKey"), new SimpleFilter(FieldKey.fromString("Comment"), "inserted", CompareType.CONTAINS).addCondition(FieldKey.fromString("DatasetId/Name"), d2.getName()), null).getObject(String.class), "P1"); + + t1.getUpdateService().deleteRows(TestContext.get().getUser(), c, Collections.singletonList(new CaseInsensitiveHashMap<>(Map.of("ObjectId", guid1))), null, null); + assertEquals("Incorrect PK", new TableSelector(qa, PageFlowUtil.set("primaryKey"), new SimpleFilter(FieldKey.fromString("Comment"), "deleted", CompareType.CONTAINS), null).getObject(String.class), guid1); + + // Ensure this works as reader: + User reader = getReaderUser(true); + qa = QueryService.get().getUserSchema(reader, c, NAME).getTable(DATASET_AUDIT); + assertEquals("Incorrect PK", new TableSelector(qa, PageFlowUtil.set("primaryKey"), new SimpleFilter(FieldKey.fromString("Comment"), "inserted", CompareType.CONTAINS).addCondition(FieldKey.fromString("DatasetId/Name"), d1.getName()), null).getObject(String.class), guid1); + assertEquals("Incorrect PK", new TableSelector(qa, PageFlowUtil.set("primaryKey"), new SimpleFilter(FieldKey.fromString("Comment"), "inserted", CompareType.CONTAINS).addCondition(FieldKey.fromString("DatasetId/Name"), d2.getName()), null).getObject(String.class), "P1"); + } + + @AfterClass + public static void doCleanup() throws Exception + { + if (getContainer(false) != null) + { + ContainerManager.delete(getContainer(false), TestContext.get().getUser()); + } + + if (getReaderUser(false) != null) + { + UserManager.deleteUser(getReaderUser(false).getUserId()); + } + } + + private static final String READER_USER = "readerUserForTesting@myDomain.com"; + + private static User getReaderUser(boolean createIfNeeded) throws Exception + { + if (createIfNeeded && !UserManager.userExists(new ValidEmail(READER_USER))) + { + SecurityManager.NewUserStatus nus = SecurityManager.addUser(new ValidEmail(READER_USER), TestContext.get().getUser()); + return nus.getUser(); + } + + return UserManager.getUser(new ValidEmail(READER_USER)); + } + } +} diff --git a/discvrcore/src/org/labkey/discvrcore/DiscvrCoreModule.java b/discvrcore/src/org/labkey/discvrcore/DiscvrCoreModule.java index d2c6ec12f..f7486e70a 100644 --- a/discvrcore/src/org/labkey/discvrcore/DiscvrCoreModule.java +++ b/discvrcore/src/org/labkey/discvrcore/DiscvrCoreModule.java @@ -18,9 +18,9 @@ import org.jetbrains.annotations.NotNull; import org.jetbrains.annotations.Nullable; -import org.labkey.api.data.Container; import org.labkey.api.module.DefaultModule; import org.labkey.api.module.ModuleContext; +import org.labkey.api.util.PageFlowUtil; import org.labkey.api.view.WebPartFactory; import java.util.Collection; @@ -60,6 +60,7 @@ protected Collection createWebPartFactories() protected void init() { addController(DiscvrCoreController.NAME, DiscvrCoreController.class); + AuditSummaryUserSchema.register(this); } @Override @@ -70,15 +71,15 @@ public void doStartup(ModuleContext moduleContext) @Override @NotNull - public Collection getSummary(Container c) + public Set getSchemaNames() { - return Collections.emptyList(); + return Collections.singleton(DiscvrCoreSchema.NAME); } + @Override - @NotNull - public Set getSchemaNames() + public @NotNull Set getIntegrationTests() { - return Collections.singleton(DiscvrCoreSchema.NAME); + return PageFlowUtil.set(AuditSummaryUserSchema.TestCase.class); } } \ No newline at end of file diff --git a/jbrowse/build.gradle b/jbrowse/build.gradle index 6d2eb13b3..0e19a553b 100644 --- a/jbrowse/build.gradle +++ b/jbrowse/build.gradle @@ -2,13 +2,9 @@ import org.labkey.gradle.util.BuildUtils; repositories { mavenCentral() - // Added for org.clojars.chapmanb:sam dependency required by com.github.samtools:htsjdk + // Added for jhdf5 from FASTQC / sequence analysis module maven { - url "https://clojars.org/repo" - } - // Added for org.clojars.chapmanb:sam (required by SequenceAnalysis) - maven { - url "https://maven.scijava.org/content/groups/public" + url "https://maven.scijava.org/content/repositories/public/" } } diff --git a/jbrowse/package-lock.json b/jbrowse/package-lock.json index 6e7bc5194..e1821c462 100644 --- a/jbrowse/package-lock.json +++ b/jbrowse/package-lock.json @@ -55,9 +55,9 @@ } }, "node_modules/@adobe/css-tools": { - "version": "4.2.0", - "resolved": "https://registry.npmjs.org/@adobe/css-tools/-/css-tools-4.2.0.tgz", - "integrity": "sha512-E09FiIft46CmH5Qnjb0wsW54/YQd69LsxeKUOWawmws1XWvyFGURnAChH0mlr7YPFR1ofwvUQfcL0J3lMxXqPA==" + "version": "4.3.1", + "resolved": "https://registry.npmjs.org/@adobe/css-tools/-/css-tools-4.3.1.tgz", + "integrity": "sha512-/62yikz7NLScCGAAST5SHdnjaDJQBDq0M2muyRTpf2VQhw6StBg2ALiu73zSJQ4fMVLA+0uBhBHAle7Wg+2kSg==" }, "node_modules/@ampproject/remapping": { "version": "2.2.1", @@ -17846,9 +17846,9 @@ }, "dependencies": { "@adobe/css-tools": { - "version": "4.2.0", - "resolved": "https://registry.npmjs.org/@adobe/css-tools/-/css-tools-4.2.0.tgz", - "integrity": "sha512-E09FiIft46CmH5Qnjb0wsW54/YQd69LsxeKUOWawmws1XWvyFGURnAChH0mlr7YPFR1ofwvUQfcL0J3lMxXqPA==" + "version": "4.3.1", + "resolved": "https://registry.npmjs.org/@adobe/css-tools/-/css-tools-4.3.1.tgz", + "integrity": "sha512-/62yikz7NLScCGAAST5SHdnjaDJQBDq0M2muyRTpf2VQhw6StBg2ALiu73zSJQ4fMVLA+0uBhBHAle7Wg+2kSg==" }, "@ampproject/remapping": { "version": "2.2.1", diff --git a/jbrowse/resources/external/mGAPSession.json b/jbrowse/resources/external/mGAPSession.json index 4ec961b4b..f30be70a2 100644 --- a/jbrowse/resources/external/mGAPSession.json +++ b/jbrowse/resources/external/mGAPSession.json @@ -57,7 +57,8 @@ { "type": "ExtendedVariantDisplay", "displayId": "mgap_hg38-ExtendedVariantDisplay", - "maxDisplayedBpPerPx": 5000, + "maxFeatureScreenDensity": 100, + "height": 400, "mouseover": "jexl:'Position: ' + formatWithCommas(get(feature,'POS'))", "renderer": { "type": "ExtendedVariantRenderer" diff --git a/jbrowse/resources/views/genotypeTable.html b/jbrowse/resources/views/genotypeTable.html index 5edaf28cd..d8daa91a1 100644 --- a/jbrowse/resources/views/genotypeTable.html +++ b/jbrowse/resources/views/genotypeTable.html @@ -28,9 +28,10 @@ $.each(rows, function(idx, row){ var contig = row.contig; var start = row.start; + var refAllele = row.refAllele; $.each(row.genotypes, function(idx, gt){ - var r = [contig, start, gt.sample]; + var r = [contig, start, refAllele, gt.sample]; var d = demographics[gt.sample] || {}; $.each(demographicsFields, function(field, displayName) { @@ -45,6 +46,7 @@ var columns = [ {title: 'Contig'}, {title: 'Position'}, + {title: 'Reference Allele'}, {title: 'Sample Name'} ]; diff --git a/jbrowse/resources/web/jbrowse/window/ModifyJsonConfigWindow.js b/jbrowse/resources/web/jbrowse/window/ModifyJsonConfigWindow.js index 1c238085f..7374e4f13 100644 --- a/jbrowse/resources/web/jbrowse/window/ModifyJsonConfigWindow.js +++ b/jbrowse/resources/web/jbrowse/window/ModifyJsonConfigWindow.js @@ -65,6 +65,12 @@ Ext4.define('JBrowse.window.ModifyJsonConfigWindow', { handler: function (gridBtn) { this.addAttribute('chunkSizeLimit', null, 'INT'); } + },{ + text: 'Track Height', + scope: this, + handler: function (gridBtn) { + this.addAttribute('trackHeight', 400, 'INT'); + } },{ text: 'Max Track Height', scope: this, diff --git a/jbrowse/src/client/JBrowse/Browser/plugins/ExtendedVariantPlugin/ExtendedVariantDisplay/model.tsx b/jbrowse/src/client/JBrowse/Browser/plugins/ExtendedVariantPlugin/ExtendedVariantDisplay/model.tsx index 4d8f3bbc4..329c1f4c9 100644 --- a/jbrowse/src/client/JBrowse/Browser/plugins/ExtendedVariantPlugin/ExtendedVariantDisplay/model.tsx +++ b/jbrowse/src/client/JBrowse/Browser/plugins/ExtendedVariantPlugin/ExtendedVariantDisplay/model.tsx @@ -217,7 +217,7 @@ export default jbrowse => { const region = view.getSelectedRegions(undefined, undefined)[0] const location = region.refName + ':' + (1+region.start) + '..' + (1+region.end) const sessionId = view.id; - navigateToSearch(sessionId, location, track.configuration.trackId, track) + navigateToSearch(sessionId, location, track.configuration.trackId, null, track) } }) } diff --git a/jbrowse/src/client/JBrowse/Search/StandaloneSearch.tsx b/jbrowse/src/client/JBrowse/Search/StandaloneSearch.tsx index 6bec89292..81774f609 100644 --- a/jbrowse/src/client/JBrowse/Search/StandaloneSearch.tsx +++ b/jbrowse/src/client/JBrowse/Search/StandaloneSearch.tsx @@ -47,7 +47,7 @@ const StandaloneSearch = observer(({ sessionId, selectedRegion }: { sessionId: a } return ( - + ) }) diff --git a/jbrowse/src/client/JBrowse/Search/components/StandaloneSearchComponent.tsx b/jbrowse/src/client/JBrowse/Search/components/StandaloneSearchComponent.tsx index 434550b44..eef531ee6 100644 --- a/jbrowse/src/client/JBrowse/Search/components/StandaloneSearchComponent.tsx +++ b/jbrowse/src/client/JBrowse/Search/components/StandaloneSearchComponent.tsx @@ -86,7 +86,11 @@ export default function StandaloneSearchComponent(props: { session: any, selecte } } else if (option.label) { - parsedLocString = parseLocString(option.label, isValidRefNameForAssembly) + try { + parsedLocString = parseLocString(option.label, isValidRefNameForAssembly) + } catch (e) { + // ignore + } } if (parsedLocString) { diff --git a/jbrowse/src/client/JBrowse/VariantSearch/VariantTable.tsx b/jbrowse/src/client/JBrowse/VariantSearch/VariantTable.tsx index 96757d8ec..b1c84e4ee 100644 --- a/jbrowse/src/client/JBrowse/VariantSearch/VariantTable.tsx +++ b/jbrowse/src/client/JBrowse/VariantSearch/VariantTable.tsx @@ -12,6 +12,7 @@ import VariantTableWidget from './components/VariantTableWidget'; import { fetchSession } from '../utils'; import { ErrorBoundary } from './components/ErrorBoundary'; import LoadingIndicator from './components/LoadingIndicator'; +import deepmerge from '@mui/utils/deepmerge'; const nativePlugins = [ExtendedVariantPlugin, LogSession] @@ -21,6 +22,18 @@ function VariantTable() { const locString = queryParam.get('location') || queryParam.get('loc') const refTheme = createTheme() + const themeAdditions = { + components: { + MuiTooltip: { + styleOverrides: { + tooltip: { + fontSize: '0.8rem', + }, + }, + }, + }, + }; + if (!sessionId){ return(

No session Id provided.

) } @@ -66,7 +79,7 @@ function VariantTable() { setState(state) // @ts-ignore - setTheme(createJBrowseTheme(readConfObject(state.config.configuration, 'theme'))) + setTheme(createTheme(deepmerge(createJBrowseTheme(readConfObject(state.config.configuration, 'theme')), themeAdditions))) } // NOTE: pass trackId for activeTracks, to ensure view.tracks contains it diff --git a/jbrowse/src/client/JBrowse/VariantSearch/components/ArrowPagination.tsx b/jbrowse/src/client/JBrowse/VariantSearch/components/ArrowPagination.tsx deleted file mode 100644 index 548e9474f..000000000 --- a/jbrowse/src/client/JBrowse/VariantSearch/components/ArrowPagination.tsx +++ /dev/null @@ -1,35 +0,0 @@ -import React from 'react'; -import IconButton from '@mui/material/IconButton'; -import ArrowBackIosIcon from '@mui/icons-material/ArrowBackIos'; -import ArrowForwardIosIcon from '@mui/icons-material/ArrowForwardIos'; - -interface ArrowPaginationProps { - offset: number; - onOffsetChange: (newOffset: number) => void; -} - -const ArrowPagination: React.FC = ({ offset, onOffsetChange }) => { - const handleLeftClick = () => { - if (offset > 0) { - onOffsetChange(offset - 1); - } - }; - - const handleRightClick = () => { - onOffsetChange(offset + 1); - }; - - return ( - <> - - - - Page {offset+1} - - - - - ); -}; - -export default ArrowPagination; diff --git a/jbrowse/src/client/JBrowse/VariantSearch/components/FilterForm.tsx b/jbrowse/src/client/JBrowse/VariantSearch/components/FilterForm.tsx index ad9274051..fdac08baf 100644 --- a/jbrowse/src/client/JBrowse/VariantSearch/components/FilterForm.tsx +++ b/jbrowse/src/client/JBrowse/VariantSearch/components/FilterForm.tsx @@ -98,17 +98,30 @@ const FilterForm = (props: FilterFormProps ) => { return i !== index; }) ); - }}; + } + }; const handleFilterChange = (index, key, value) => { const newFilters = filters.map((filter, i) => { if (i === index) { - return Object.assign(new Filter(), { ...filter, [key]: value }); + const updatedFilter = Object.assign(new Filter(), { ...filter, [key]: value }); + + if (key === "operator") { + if (value === "is empty" || value === "is not empty") { + updatedFilter.value = ''; + } + + if (value === "in set" || filter.operator === "in set") { + updatedFilter.value = ''; + } + } + + return updatedFilter; } return filter; }); - localSetFilters(newFilters) + localSetFilters(newFilters); }; const handleSubmit = (event) => { @@ -203,7 +216,7 @@ const FilterForm = (props: FilterFormProps ) => { handleFilterChange(index, "field", event.target.value) } > - + None {fieldTypeInfo.map((field) => ( @@ -223,7 +236,7 @@ const FilterForm = (props: FilterFormProps ) => { handleFilterChange(index, "operator", event.target.value) } > - + None @@ -262,6 +275,7 @@ const FilterForm = (props: FilterFormProps ) => {