diff --git a/.github/workflows/pull_request.yml b/.github/workflows/pull_request.yml
index 52ad1fc6..d823790f 100644
--- a/.github/workflows/pull_request.yml
+++ b/.github/workflows/pull_request.yml
@@ -40,6 +40,7 @@ jobs:
         working-directory: packages/jbrowse-plugin-apollo
       - name: Start apollo
         run: |
+          yarn --cwd packages/apollo-collaboration-server/test/data/ serve --listen 3131 &
           yarn --cwd packages/apollo-shared start &
           ALLOW_ROOT_USER=true ROOT_USER_NAME=admin ROOT_USER_PASSWORD=pass yarn --cwd packages/apollo-collaboration-server start &
       - name: Run CLI tests
diff --git a/.github/workflows/reload_demo_data.yml b/.github/workflows/reload_demo_data.yml
index f5fa4a1e..a332be57 100644
--- a/.github/workflows/reload_demo_data.yml
+++ b/.github/workflows/reload_demo_data.yml
@@ -89,23 +89,21 @@ jobs:
             /data/schistosoma_haematobium.TD2_PRJEB44434.WBPS19.genomic.fa.gz \
             --fai /data/schistosoma_haematobium.TD2_PRJEB44434.WBPS19.genomic.fa.gz.fai \
             --gzi /data/schistosoma_haematobium.TD2_PRJEB44434.WBPS19.genomic.fa.gz.gzi \
-            --assembly 'Schistosoma haematobium' \
-            --not-editable
+            --assembly 'Schistosoma haematobium'
 
           apollo assembly \
             add-from-fasta \
             /data/schistosoma_mansoni.PRJEA36577.WBPS19.genomic.fa.gz \
             --fai /data/schistosoma_mansoni.PRJEA36577.WBPS19.genomic.fa.gz.fai \
             --gzi /data/schistosoma_mansoni.PRJEA36577.WBPS19.genomic.fa.gz.gzi \
-            --assembly 'Schistosoma mansoni' \
-            --not-editable
+            --assembly 'Schistosoma mansoni'
 
           apollo feature \
             import \
-            --input-file /data/schistosoma_haematobium.TD2_PRJEB44434.WBPS19.annotations.genes.gff3 \
+            /data/schistosoma_haematobium.TD2_PRJEB44434.WBPS19.annotations.genes.gff3 \
             --assembly 'Schistosoma haematobium'
 
           apollo feature \
             import \
-            --input-file /data/schistosoma_mansoni.PRJEA36577.WBPS19.annotations.genes.gff3 \
+            /data/schistosoma_mansoni.PRJEA36577.WBPS19.annotations.genes.gff3 \
             --assembly 'Schistosoma mansoni'
diff --git a/packages/apollo-cli/README.md b/packages/apollo-cli/README.md
index 74bd15ec..b0faa1f0 100644
--- a/packages/apollo-cli/README.md
+++ b/packages/apollo-cli/README.md
@@ -47,18 +47,18 @@ USAGE
 - [`apollo feature edit-type`](#apollo-feature-edit-type)
 - [`apollo feature get`](#apollo-feature-get)
 - [`apollo feature get-id`](#apollo-feature-get-id)
-- [`apollo feature import`](#apollo-feature-import)
+- [`apollo feature import INPUT-FILE`](#apollo-feature-import-input-file)
 - [`apollo feature search`](#apollo-feature-search)
 - [`apollo file delete`](#apollo-file-delete)
 - [`apollo file download`](#apollo-file-download)
 - [`apollo file get`](#apollo-file-get)
-- [`apollo file upload`](#apollo-file-upload)
+- [`apollo file upload INPUT-FILE`](#apollo-file-upload-input-file)
 - [`apollo help [COMMANDS]`](#apollo-help-commands)
 - [`apollo jbrowse get-config`](#apollo-jbrowse-get-config)
 - [`apollo jbrowse set-config INPUTFILE`](#apollo-jbrowse-set-config-inputfile)
 - [`apollo login`](#apollo-login)
 - [`apollo logout`](#apollo-logout)
-- [`apollo refseq add-alias`](#apollo-refseq-add-alias)
+- [`apollo refseq add-alias INPUT-FILE`](#apollo-refseq-add-alias-input-file)
 - [`apollo refseq get`](#apollo-refseq-get)
 - [`apollo status`](#apollo-status)
 - [`apollo user get`](#apollo-user-get)
@@ -69,21 +69,20 @@ Add a new assembly from fasta input
 
 ```
 USAGE
-  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-x <value>] [-f] [-n]
-    [--fai <value>] [--gzi <value>] [-z | -d]
+  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-f] [-e] [--fai <value>]
+    [--gzi <value>] [-z | -d]
 
 ARGUMENTS
-  INPUT  Input fasta file, local or remote, or id of a previously uploaded file
+  INPUT  Input fasta file, local or remote, or id of a previously uploaded file. For local or remote files, it is
+         assumed the file is bgzip'd with `bgzip` and indexed with `samtools faidx`. The indexes are assumed to be at
+         <my.fasta.gz>.fai and <my.fasta.gz>.gzi unless the options --fai and --gzi are provided.
 
 FLAGS
   -a, --assembly=<value>     Name for this assembly. Use the file name if omitted
   -d, --decompressed         For local file input: Override autodetection and instruct that input is decompressed
+  -e, --editable             Instead of using indexed fasta lookup, the sequence is loaded into the Apollo database and
+                             is editable. Use with caution, as editing the sequence often has unintended side effects.
   -f, --force                Delete existing assembly, if it exists
-  -n, --not-editable         The fasta sequence is not editable. Apollo will not load it into the database and instead
-                             use the provided indexes to query it. This option assumes the fasta file is bgzip'd with
-                             `bgzip` and indexed with `samtools faidx`. Indexes should be named <my.fasta.gz>.gzi and
-                             <my.fasta.gz>.fai unless options --fai and --gzi are set
-  -x, --index=<value>        URL of the index. Required if input is an external source
   -z, --gzip                 For local file input: Override autodetection and instruct that input is gzip compressed
       --config-file=<value>  Use this config file (mostly for testing)
       --fai=<value>          Fasta index of the (not-editable) fasta file
@@ -137,7 +136,7 @@ DESCRIPTION
 EXAMPLES
   Import sequences and features:
 
-    $ apollo assembly add-from-gff -i genome.gff -a myAssembly
+    $ apollo assembly add-from-gff genome.gff -a myAssembly
 
   Import sequences only:
 
@@ -674,18 +673,20 @@ EXAMPLES
 _See code:
 [src/commands/feature/get-id.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/get-id.ts)_
 
-## `apollo feature import`
+## `apollo feature import INPUT-FILE`
 
 Import features from local gff file
 
 ```
 USAGE
-  $ apollo feature import -i <value> -a <value> [--profile <value>] [--config-file <value>] [-d]
+  $ apollo feature import INPUT-FILE -a <value> [--profile <value>] [--config-file <value>] [-d]
+
+ARGUMENTS
+  INPUT-FILE  Input gff file
 
 FLAGS
   -a, --assembly=<value>     (required) Import into this assembly name or assembly ID
   -d, --delete-existing      Delete existing features before importing
-  -i, --input-file=<value>   (required) Input gff file
       --config-file=<value>  Use this config file (mostly for testing)
       --profile=<value>      Use credentials from this profile
 
@@ -697,7 +698,7 @@ DESCRIPTION
 EXAMPLES
   Delete features in myAssembly and then import features.gff3:
 
-    $ apollo feature import -d -i features.gff3 -a myAssembly
+    $ apollo feature import features.gff3 -d -a myAssembly
 ```
 
 _See code:
@@ -836,18 +837,20 @@ EXAMPLES
 _See code:
 [src/commands/file/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/get.ts)_
 
-## `apollo file upload`
+## `apollo file upload INPUT-FILE`
 
 Upload a local file to the Apollo server
 
 ```
 USAGE
-  $ apollo file upload -i <value> [--profile <value>] [--config-file <value>] [-t
+  $ apollo file upload INPUT-FILE [--profile <value>] [--config-file <value>] [-t
     text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi] [-z | -d]
 
+ARGUMENTS
+  INPUT-FILE  Local file to upload
+
 FLAGS
   -d, --decompressed         Override autodetection and instruct that input is decompressed
-  -i, --input-file=<value>   (required) Local file to upload
   -t, --type=<option>        Set file type or autodetected it if not set.
                              NB: There is no check for whether the file complies to this type
                              <options: text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi>
@@ -865,7 +868,7 @@ DESCRIPTION
 EXAMPLES
   Upload local file, type auto-detected:
 
-    $ apollo file upload -i genome.fa > file.json
+    $ apollo file upload genome.fa > file.json
 ```
 
 _See code:
@@ -1016,17 +1019,19 @@ EXAMPLES
 _See code:
 [src/commands/logout.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/logout.ts)_
 
-## `apollo refseq add-alias`
+## `apollo refseq add-alias INPUT-FILE`
 
 Add reference name aliases from a file
 
 ```
 USAGE
-  $ apollo refseq add-alias -i <value> -a <value> [--profile <value>] [--config-file <value>]
+  $ apollo refseq add-alias INPUT-FILE -a <value> [--profile <value>] [--config-file <value>]
+
+ARGUMENTS
+  INPUT-FILE  Input refname alias file
 
 FLAGS
   -a, --assembly=<value>     (required) Name for this assembly.
-  -i, --input-file=<value>   (required) Input refname alias file
       --config-file=<value>  Use this config file (mostly for testing)
       --profile=<value>      Use credentials from this profile
 
@@ -1039,7 +1044,7 @@ DESCRIPTION
 EXAMPLES
   Add reference name aliases:
 
-    $ apollo refseq add-alias -i alias.txt -a myAssembly
+    $ apollo refseq add-alias alias.txt -a myAssembly
 ```
 
 _See code:
diff --git a/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts b/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
index eb2f3e79..1b9b9b31 100644
--- a/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
+++ b/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts
@@ -7,11 +7,15 @@ import { ObjectId } from 'bson'
 import { FileCommand } from '../../fileCommand.js'
 import { queryApollo, submitAssembly } from '../../utils.js'
 import { Response } from 'undici'
+import {
+  SerializedAddAssemblyFromExternalChange,
+  SerializedAddAssemblyFromFileChange,
+} from '@apollo-annotation/shared'
 
 export default class AddFasta extends FileCommand {
   static summary = 'Add a new assembly from fasta input'
   static description = `Add new assembly. The input fasta may be:
-    * A local file 
+    * A local file
     * An external fasta file
     * The id of a file previously uploaded to Apollo`
 
@@ -30,7 +34,11 @@ export default class AddFasta extends FileCommand {
   static args = {
     input: Args.string({
       description:
-        'Input fasta file, local or remote, or id of a previously uploaded file',
+        "Input fasta file, local or remote, or id of a previously uploaded \
+file. For local or remote files, it is assumed the file is bgzip'd with \
+`bgzip` and indexed with `samtools faidx`. The indexes are assumed to be at \
+<my.fasta.gz>.fai and <my.fasta.gz>.gzi unless the options --fai and --gzi are \
+provided.",
       required: true,
     }),
   }
@@ -40,21 +48,16 @@ export default class AddFasta extends FileCommand {
       char: 'a',
       description: 'Name for this assembly. Use the file name if omitted',
     }),
-    index: Flags.string({
-      char: 'x',
-      description: 'URL of the index. Required if input is an external source',
-    }),
     force: Flags.boolean({
       char: 'f',
       description: 'Delete existing assembly, if it exists',
     }),
-    'not-editable': Flags.boolean({
-      char: 'n',
+    editable: Flags.boolean({
+      char: 'e',
       description:
-        "The fasta sequence is not editable. Apollo will not load it into \
-the database and instead use the provided indexes to query it. This option assumes \
-the fasta file is bgzip'd with `bgzip` and indexed with `samtools faidx`. \
-Indexes should be named <my.fasta.gz>.gzi and <my.fasta.gz>.fai unless options --fai and --gzi are set",
+        'Instead of using indexed fasta lookup, the sequence is loaded into \
+the Apollo database and is editable. Use with caution, as editing the sequence \
+often has unintended side effects.',
     }),
     fai: Flags.string({
       description: 'Fasta index of the (not-editable) fasta file',
@@ -77,8 +80,7 @@ Indexes should be named <my.fasta.gz>.gzi and <my.fasta.gz>.fai unless options -
   }
 
   public async run(): Promise<void> {
-    const { args } = await this.parse(AddFasta)
-    const { flags } = await this.parse(AddFasta)
+    const { args, flags } = await this.parse(AddFasta)
 
     const access = await this.getAccess()
 
@@ -91,22 +93,46 @@ Indexes should be named <my.fasta.gz>.gzi and <my.fasta.gz>.fai unless options -
     )
     const isExternal = isValidHttpUrl(args.input)
 
-    let body
+    let body:
+      | SerializedAddAssemblyFromFileChange
+      | SerializedAddAssemblyFromExternalChange
     if (isExternal) {
-      if (flags.index === undefined) {
-        this.error(
-          'Please provide the URL to the index of the external fasta file',
-        )
-      }
+      const fai = flags.fai ?? `${args.input}.fai`
+      const gzi = flags.gzi ?? `${args.input}.gzi`
       body = {
         assemblyName,
         typeName: 'AddAssemblyFromExternalChange',
-        externalLocation: {
-          fa: args.input,
-          fai: flags.index,
-        },
+        externalLocation: { fa: args.input, fai, gzi },
+        assembly: new ObjectId().toHexString(),
+      }
+    } else if (flags.editable) {
+      if (!isExternal && !fs.existsSync(args.input) && !fastaIsFileId) {
+        this.error(`Input "${args.input}" is not valid`)
+      }
+      let isGzip = args.input.endsWith('.gz')
+      if (flags.gzip) {
+        isGzip = true
       }
-    } else if (flags['not-editable']) {
+      if (flags.decompressed) {
+        isGzip = false
+      }
+
+      const fileId = fastaIsFileId
+        ? args.input
+        : await this.uploadFile(
+            access.address,
+            access.accessToken,
+            args.input,
+            'text/x-fasta',
+            isGzip,
+          )
+      body = {
+        assemblyName,
+        fileIds: { fa: fileId },
+        typeName: 'AddAssemblyFromFileChange',
+        assembly: new ObjectId().toHexString(),
+      }
+    } else {
       const gzi = flags.gzi ?? `${args.input}.gzi`
       const fai = flags.fai ?? `${args.input}.fai`
 
@@ -165,41 +191,10 @@ Indexes should be named <my.fasta.gz>.gzi and <my.fasta.gz>.fai unless options -
       body = {
         assemblyName,
         typeName: 'AddAssemblyFromFileChange',
-        fileIds: {
-          fa: faId,
-          fai: faiId,
-          gzi: gziId,
-        },
-      }
-    } else {
-      if (!isExternal && !fs.existsSync(args.input) && !fastaIsFileId) {
-        this.error(`Input "${args.input}" is not valid`)
-      }
-      let isGzip = args.input.endsWith('.gz')
-      if (flags.gzip) {
-        isGzip = true
-      }
-      if (flags.decompressed) {
-        isGzip = false
-      }
-
-      const fileId = fastaIsFileId
-        ? args.input
-        : await this.uploadFile(
-            access.address,
-            access.accessToken,
-            args.input,
-            'text/x-fasta',
-            isGzip,
-          )
-      body = {
-        assemblyName,
-        fileIds: { fa: fileId },
-        typeName: 'AddAssemblyFromFileChange',
+        fileIds: { fa: faId, fai: faiId, gzi: gziId },
         assembly: new ObjectId().toHexString(),
       }
     }
-
     const rec = await submitAssembly(
       access.address,
       access.accessToken,
diff --git a/packages/apollo-cli/src/commands/assembly/add-from-gff.ts b/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
index 04562a0f..1eede29b 100644
--- a/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
+++ b/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
@@ -6,6 +6,11 @@ import { ObjectId } from 'bson'
 
 import { FileCommand } from '../../fileCommand.js'
 import { submitAssembly } from '../../utils.js'
+import type {
+  SerializedAddAssemblyAndFeaturesFromFileChange,
+  SerializedAddAssemblyFromExternalChange,
+  SerializedAddAssemblyFromFileChange,
+} from '@apollo-annotation/shared'
 
 export default class AddGff extends FileCommand {
   static summary = 'Add new assembly from gff or gft file'
@@ -15,8 +20,7 @@ export default class AddGff extends FileCommand {
   static examples = [
     {
       description: 'Import sequences and features:',
-      command:
-        '<%= config.bin %> <%= command.id %> -i genome.gff -a myAssembly',
+      command: '<%= config.bin %> <%= command.id %> genome.gff -a myAssembly',
     },
     {
       description: 'Import sequences only:',
@@ -48,8 +52,7 @@ export default class AddGff extends FileCommand {
   }
 
   public async run(): Promise<void> {
-    const { args } = await this.parse(AddGff)
-    const { flags } = await this.parse(AddGff)
+    const { args, flags } = await this.parse(AddGff)
 
     if (!fs.existsSync(args['input-file'])) {
       this.error(`File ${args['input-file']} does not exist`)
@@ -65,19 +68,24 @@ export default class AddGff extends FileCommand {
       args['input-file'].endsWith('.gz'),
     )
 
-    let typeName = 'AddAssemblyAndFeaturesFromFileChange'
-    if (flags['omit-features']) {
-      typeName = 'AddAssemblyFromFileChange'
-    }
-
     const assemblyName = flags.assembly ?? path.basename(args['input-file'])
 
-    const body = {
-      assemblyName,
-      fileIds: { fa: fileId },
-      typeName,
-      assembly: new ObjectId().toHexString(),
-    }
+    const body:
+      | SerializedAddAssemblyFromFileChange
+      | SerializedAddAssemblyFromExternalChange
+      | SerializedAddAssemblyAndFeaturesFromFileChange = flags['omit-features']
+      ? {
+          assemblyName,
+          fileIds: { fa: fileId },
+          typeName: 'AddAssemblyFromFileChange',
+          assembly: new ObjectId().toHexString(),
+        }
+      : {
+          assemblyName,
+          fileIds: { fa: fileId },
+          typeName: 'AddAssemblyAndFeaturesFromFileChange',
+          assembly: new ObjectId().toHexString(),
+        }
     const rec = await submitAssembly(
       access.address,
       access.accessToken,
diff --git a/packages/apollo-cli/src/commands/config.ts b/packages/apollo-cli/src/commands/config.ts
index 558917dc..d3433f37 100644
--- a/packages/apollo-cli/src/commands/config.ts
+++ b/packages/apollo-cli/src/commands/config.ts
@@ -56,8 +56,7 @@ export default class ApolloConfig extends BaseCommand<typeof ApolloConfig> {
   ]
 
   public async run(): Promise<void> {
-    const { args } = await this.parse(ApolloConfig)
-    const { flags } = await this.parse(ApolloConfig)
+    const { args, flags } = await this.parse(ApolloConfig)
 
     let configFile = flags['config-file']
     configFile =
diff --git a/packages/apollo-cli/src/commands/feature/import.ts b/packages/apollo-cli/src/commands/feature/import.ts
index b31de499..31b9ccb2 100644
--- a/packages/apollo-cli/src/commands/feature/import.ts
+++ b/packages/apollo-cli/src/commands/feature/import.ts
@@ -1,7 +1,7 @@
 import * as fs from 'node:fs'
 
 import { type SerializedAddFeaturesFromFileChange } from '@apollo-annotation/shared'
-import { Flags } from '@oclif/core'
+import { Args, Flags } from '@oclif/core'
 import { Agent, RequestInit, fetch } from 'undici'
 
 import { FileCommand } from '../../fileCommand.js'
@@ -20,16 +20,18 @@ export default class Import extends FileCommand {
       description:
         'Delete features in myAssembly and then import features.gff3:',
       command:
-        '<%= config.bin %> <%= command.id %> -d -i features.gff3 -a myAssembly',
+        '<%= config.bin %> <%= command.id %> features.gff3 -d -a myAssembly',
     },
   ]
 
-  static flags = {
-    'input-file': Flags.string({
-      char: 'i',
+  static args = {
+    'input-file': Args.string({
       description: 'Input gff file',
       required: true,
     }),
+  }
+
+  static flags = {
     assembly: Flags.string({
       char: 'a',
       description: 'Import into this assembly name or assembly ID',
@@ -42,10 +44,10 @@ export default class Import extends FileCommand {
   }
 
   public async run(): Promise<void> {
-    const { flags } = await this.parse(Import)
+    const { args, flags } = await this.parse(Import)
 
-    if (!fs.existsSync(flags['input-file'])) {
-      this.error(`File "${flags['input-file']}" does not exist`)
+    if (!fs.existsSync(args['input-file'])) {
+      this.error(`File "${args['input-file']}" does not exist`)
     }
 
     const access = await this.getAccess()
@@ -64,7 +66,7 @@ export default class Import extends FileCommand {
     const uploadId = await this.uploadFile(
       access.address,
       access.accessToken,
-      flags['input-file'],
+      args['input-file'],
       'text/x-gff3',
       false,
     )
diff --git a/packages/apollo-cli/src/commands/file/upload.ts b/packages/apollo-cli/src/commands/file/upload.ts
index bb2d0b2e..97076bf8 100644
--- a/packages/apollo-cli/src/commands/file/upload.ts
+++ b/packages/apollo-cli/src/commands/file/upload.ts
@@ -1,4 +1,4 @@
-import { Flags } from '@oclif/core'
+import { Args, Flags } from '@oclif/core'
 import { Response } from 'undici'
 
 import { FileCommand } from '../../fileCommand.js'
@@ -12,16 +12,18 @@ export default class Upload extends FileCommand {
   static examples = [
     {
       description: 'Upload local file, type auto-detected:',
-      command: '<%= config.bin %> <%= command.id %> -i genome.fa > file.json',
+      command: '<%= config.bin %> <%= command.id %> genome.fa > file.json',
     },
   ]
 
-  static flags = {
-    'input-file': Flags.string({
-      char: 'i',
+  static args = {
+    'input-file': Args.string({
       description: 'Local file to upload',
       required: true,
     }),
+  }
+
+  static flags = {
     type: Flags.string({
       char: 't',
       description:
@@ -50,18 +52,18 @@ export default class Upload extends FileCommand {
   }
 
   public async run(): Promise<void> {
-    const { flags } = await this.parse(Upload)
+    const { args, flags } = await this.parse(Upload)
 
     const access = await this.getAccess()
 
     let { type } = flags
     if (type === undefined) {
-      const hasGzipExt = flags['input-file'].endsWith('.gz')
-      const infile = flags['input-file'].replace(/\.gz$/, '')
+      const hasGzipExt = args['input-file'].endsWith('.gz')
+      const infile = args['input-file'].replace(/\.gz$/, '')
 
       if (/\.fasta$|\.fas$|\.fa$|\.fna$/.test(infile) && hasGzipExt) {
         this.error(
-          `Unable to auto-detect file type for "${flags['input-file']}" since it may be gzip or bgzip compressed. Please set the -t/--type option`,
+          `Unable to auto-detect file type for "${args['input-file']}" since it may be gzip or bgzip compressed. Please set the -t/--type option`,
         )
       } else if (/\.fasta$|\.fas$|\.fa$|\.fna$/.test(infile)) {
         type = 'text/x-fasta'
@@ -73,12 +75,12 @@ export default class Upload extends FileCommand {
         type = 'application/x-gzi'
       } else {
         this.error(
-          `Unable to auto-detect the type of file "${flags['input-file']}". Please set the --type/-t option.`,
+          `Unable to auto-detect the type of file "${args['input-file']}". Please set the --type/-t option.`,
         )
       }
     }
 
-    let isGzip = flags['input-file'].endsWith('.gz')
+    let isGzip = args['input-file'].endsWith('.gz')
     // eslint-disable-next-line unicorn/consistent-destructuring
     if (flags.gzip) {
       isGzip = true
@@ -93,7 +95,7 @@ export default class Upload extends FileCommand {
     const fileId = await this.uploadFile(
       access.address,
       access.accessToken,
-      flags['input-file'],
+      args['input-file'],
       type,
 
       isGzip,
diff --git a/packages/apollo-cli/src/commands/refseq/add-alias.ts b/packages/apollo-cli/src/commands/refseq/add-alias.ts
index 47dde566..84598077 100644
--- a/packages/apollo-cli/src/commands/refseq/add-alias.ts
+++ b/packages/apollo-cli/src/commands/refseq/add-alias.ts
@@ -1,6 +1,6 @@
 import * as fs from 'node:fs'
 import { Agent, RequestInit, Response, fetch } from 'undici'
-import { Flags } from '@oclif/core'
+import { Args, Flags } from '@oclif/core'
 import { BaseCommand } from '../../baseCommand.js'
 import {
   createFetchErrorMessage,
@@ -21,16 +21,18 @@ export default class AddRefNameAlias extends BaseCommand<
   static examples = [
     {
       description: 'Add reference name aliases:',
-      command: '<%= config.bin %> <%= command.id %> -i alias.txt -a myAssembly',
+      command: '<%= config.bin %> <%= command.id %> alias.txt -a myAssembly',
     },
   ]
 
-  static flags = {
-    'input-file': Flags.string({
-      char: 'i',
+  static args = {
+    'input-file': Args.string({
       description: 'Input refname alias file',
       required: true,
     }),
+  }
+
+  static flags = {
     assembly: Flags.string({
       char: 'a',
       description: 'Name for this assembly.',
@@ -39,14 +41,14 @@ export default class AddRefNameAlias extends BaseCommand<
   }
 
   async run(): Promise<void> {
-    const { flags } = await this.parse(AddRefNameAlias)
+    const { args, flags } = await this.parse(AddRefNameAlias)
 
-    if (!fs.existsSync(flags['input-file'])) {
-      this.error(`File ${flags['input-file']} does not exist`)
+    if (!fs.existsSync(args['input-file'])) {
+      this.error(`File ${args['input-file']} does not exist`)
     }
 
     const access = await this.getAccess()
-    const filehandle = await fs.promises.open(flags['input-file'])
+    const filehandle = await fs.promises.open(args['input-file'])
     const fileContent = await filehandle.readFile({ encoding: 'utf8' })
     await filehandle.close()
     const lines = fileContent.split('\n')
diff --git a/packages/apollo-cli/src/utils.ts b/packages/apollo-cli/src/utils.ts
index c3b372a3..897dd574 100644
--- a/packages/apollo-cli/src/utils.ts
+++ b/packages/apollo-cli/src/utils.ts
@@ -3,7 +3,12 @@ import EventEmitter from 'node:events'
 import * as fs from 'node:fs'
 import { stdin, stderr } from 'node:process'
 
-import { type SerializedDeleteAssemblyChange } from '@apollo-annotation/shared'
+import type {
+  SerializedAddAssemblyAndFeaturesFromFileChange,
+  SerializedAddAssemblyFromExternalChange,
+  SerializedAddAssemblyFromFileChange,
+  SerializedDeleteAssemblyChange,
+} from '@apollo-annotation/shared'
 
 import { Agent, RequestInit, Response, fetch } from 'undici'
 
@@ -353,43 +358,30 @@ export const waitFor = <T>(
   return promise
 }
 
-interface bodyFastaFile {
-  assemblyName: string
-  typeName: string
-  fileIds: { fa: string }
-  assembly: string
-}
-interface bodyIndexedFiles {
-  assemblyName: string
-  typeName: string
-  fileIds: {
-    fa: string
-    fai: string
-    gzi: string
-  }
-}
-interface bodyExternalFile {
-  assemblyName: string
-  typeName: string
-  externalLocation: {
-    fa: string
-    fai: string
-  }
-}
-
 export async function submitAssembly(
   address: string,
   accessToken: string,
-  body: bodyFastaFile | bodyExternalFile | bodyIndexedFiles,
+  body:
+    | SerializedAddAssemblyFromFileChange
+    | SerializedAddAssemblyFromExternalChange
+    | SerializedAddAssemblyAndFeaturesFromFileChange,
   force: boolean,
 ): Promise<object> {
   let assemblies = await queryApollo(address, accessToken, 'assemblies')
-  for (const x of (await assemblies.json()) as object[]) {
-    if (x['name' as keyof typeof x] === body.assemblyName) {
-      if (force) {
-        await deleteAssembly(address, accessToken, x['_id' as keyof typeof x])
-      } else {
-        throw new Error(`Error: Assembly "${body.assemblyName}" already exists`)
+  for (const x of (await assemblies.json()) as {
+    name: string
+    _id: string
+  }[]) {
+    const addedAssemblies = 'changes' in body ? body.changes : [body]
+    for (const addedAssembly of addedAssemblies) {
+      if (x.name === addedAssembly.assemblyName) {
+        if (force) {
+          await deleteAssembly(address, accessToken, x._id)
+        } else {
+          throw new Error(
+            `Error: Assembly "${addedAssembly.assemblyName}" already exists`,
+          )
+        }
       }
     }
   }
@@ -413,12 +405,18 @@ export async function submitAssembly(
     throw new Error(errorMessage)
   }
   assemblies = await queryApollo(address, accessToken, 'assemblies')
-  for (const x of (await assemblies.json()) as object[]) {
-    if (x['name' as keyof typeof x] === body.assemblyName) {
-      return x
+  for (const x of (await assemblies.json()) as {
+    name: string
+    _id: string
+  }[]) {
+    const addedAssemblies = 'changes' in body ? body.changes : [body]
+    for (const addedAssembly of addedAssemblies) {
+      if (x.name === addedAssembly.assemblyName) {
+        return x
+      }
     }
   }
-  throw new Error(`Failed to retrieve assembly ${body.assemblyName}`)
+  throw new Error(`Failed to retrieve assembly from ${body.assembly}`)
 }
 
 export async function readStdin() {
diff --git a/packages/apollo-cli/test/test.py b/packages/apollo-cli/test/test.py
index 8d414be5..6cd28de7 100755
--- a/packages/apollo-cli/test/test.py
+++ b/packages/apollo-cli/test/test.py
@@ -105,9 +105,9 @@ def testFeatureGet(self):
         self.assertTrue("returned 0 assemblies" in p.stderr)
 
     def testAssemblyGet(self):
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv2 -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv3 -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv2 -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv3 -e -f")
         p = shell(f"{apollo} assembly get {P}")
         self.assertTrue("vv1" in p.stdout)
         self.assertTrue("vv2" in p.stdout)
@@ -257,7 +257,7 @@ def testAddAssemblyLargeInput(self):
                 i += 1
 
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -f",
+            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -e -f",
             timeout=60,
         )
         shell(
@@ -266,7 +266,7 @@ def testAddAssemblyLargeInput(self):
             timeout=60,
         )
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -f",
+            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -e -f",
             timeout=60,
         )
 
@@ -274,7 +274,7 @@ def testAddAssemblyLargeInput(self):
 
     def testAddAssemblyFromLocalFasta(self):
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e -f"
         )
         out = json.loads(p.stdout)
         self.assertTrue("fa" in out["fileIds"].keys())
@@ -282,27 +282,24 @@ def testAddAssemblyFromLocalFasta(self):
         p = shell(f"{apollo} assembly get {P} -a vv1")
         self.assertTrue("vv1" in p.stdout)
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1",
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
         self.assertTrue('Error: Assembly "vv1" already exists' in p.stderr)
 
-        p = shell(f"{apollo} assembly add-from-fasta {P} na.fa -a vv1 -f", strict=False)
+        p = shell(f"{apollo} assembly add-from-fasta {P} na.fa -a vv1 -e -f", strict=False)
         self.assertTrue(p.returncode != 0)
         self.assertTrue("Input" in p.stderr)
 
         # Test default name
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -e -f")
         p = shell(f"{apollo} assembly get {P} -a tiny.fasta")
         self.assertTrue("tiny.fasta" in p.stdout)
 
     def testAddAssemblyFromExternalFasta(self):
         p = shell(
-            f"""{apollo} assembly add-from-fasta {P} -a vv1 -f \
-                https://raw.githubusercontent.com/GMOD/Apollo3/main/packages/apollo-collaboration-server/test/data/volvox.fa \
-                -x https://raw.githubusercontent.com/GMOD/Apollo3/main/packages/apollo-collaboration-server/test/data/volvox.fa.fai
-                  """
+            f"{apollo} assembly add-from-fasta {P} -a vv1 -f http://localhost:3131/volvox.fa.gz"
         )
         out = json.loads(p.stdout)
         self.assertTrue("fa" in out["externalLocation"].keys())
@@ -315,7 +312,7 @@ def testAddAssemblyFromExternalFasta(self):
         self.assertEqual(seq[1], "cattgttgcg")
 
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} -a vv1 -f https://x.fa -x https://x.fai",
+            f"{apollo} assembly add-from-fasta {P} -a vv1 -f https://x.fa.gz --fai https://x.fa.gz.fai --gzi https://x.fa.gz.gzi",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
@@ -620,33 +617,33 @@ def testAddChildFeatures(self):
         self.assertEqual(p.returncode, 0)
 
     def testImportFeatures(self):
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -f")
-        shell(f"{apollo} feature import {P} -i test_data/tiny.fasta.gff3 -a vv1")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e -f")
+        shell(f"{apollo} feature import {P} test_data/tiny.fasta.gff3 -a vv1")
         p = shell(f"{apollo} feature search {P} -a vv1 -t contig")
         out = json.loads(p.stdout)
         self.assertEqual(len(out), 2)
 
         # Import again: Add to existing feature
-        p = shell(f"{apollo} feature import {P} -i test_data/tiny.fasta.gff3 -a vv1")
+        p = shell(f"{apollo} feature import {P} test_data/tiny.fasta.gff3 -a vv1")
         p = shell(f"{apollo} feature search {P} -a vv1 -t contig")
         out = json.loads(p.stdout)
         self.assertEqual(len(out), 4)
 
         # Import again: delete {P} existing
-        p = shell(f"{apollo} feature import {P} -d -i test_data/tiny.fasta.gff3 -a vv1")
+        p = shell(f"{apollo} feature import {P} -d test_data/tiny.fasta.gff3 -a vv1")
         p = shell(f"{apollo} feature search {P} -a vv1 -t contig")
         out = json.loads(p.stdout)
         self.assertEqual(len(out), 2)
 
         p = shell(f"{apollo} assembly delete {P} -a vv2")
         p = shell(
-            f"{apollo} feature import {P} -i test_data/tiny.fasta.gff3 -a vv2",
+            f"{apollo} feature import {P} test_data/tiny.fasta.gff3 -a vv2",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
         self.assertTrue('Assembly "vv2" does not exist' in p.stderr)
 
-        p = shell(f"{apollo} feature import {P} -i foo.gff3 -a vv1", strict=False)
+        p = shell(f"{apollo} feature import {P} foo.gff3 -a vv1", strict=False)
         self.assertTrue(p.returncode != 0)
         self.assertTrue('File "foo.gff3" does not exist' in p.stderr)
 
@@ -654,8 +651,8 @@ def testCopyFeature(self):
         shell(
             f"{apollo} assembly add-from-gff {P} test_data/tiny.fasta.gff3 -a source -f"
         )
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest2 -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest2 -e -f")
         p = shell(f"{apollo} feature search {P} -a source -t contig")
         fid = json.loads(p.stdout)[0]["_id"]
 
@@ -700,13 +697,13 @@ def testCopyFeature(self):
 
     def testGetChanges(self):
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a myAssembly -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a myAssembly -e -f"
         )
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a yourAssembly -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a yourAssembly -e -f"
         )
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a ourAssembly -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a ourAssembly -e -f"
         )
 
         p = shell(f"{apollo} change get {P}")
@@ -728,8 +725,8 @@ def testGetChanges(self):
         self.assertEqual(len(out), 0)
 
     def testGetSequence(self):
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v1 -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v2 -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v1 -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v2 -e -f")
 
         p = shell(f"{apollo} assembly sequence {P} -a nonExistant", strict=False)
         self.assertTrue(p.returncode != 0)
@@ -801,7 +798,8 @@ def testAssemblyChecks(self):
 
         # Test view checks set for assembly
         p = shell(f"{apollo} assembly check {P} -a v1")
-        self.assertEqual(p.stdout.strip(), "[]")
+        out = json.loads(p.stdout)
+        self.assertEqual(len(out), 1)
 
         # Test non-existant assembly
         p = shell(f"{apollo} assembly check {P} -a non-existant", strict=False)
@@ -839,25 +837,6 @@ def testFeatureChecks(self):
         shell(f"{apollo} assembly add-from-gff {P} test_data/tiny.fasta.gff3 -a v1 -f")
         shell(f"{apollo} assembly check {P} -a v1 -c CDSCheck")
         p = shell(f"{apollo} feature check {P} -a v1")
-        ## If we don't edit a feature, checks are not activated (!?)
-        self.assertEqual(p.stdout.strip(), "[]")
-
-        p = shell(f"{apollo} feature get {P} -a v1")
-        ff = json.loads(p.stdout)
-        g1 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["MyGene"]
-        ][0]
-        g2 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["AnotherGene"]
-        ][0]
-
-        shell(f"{apollo} feature edit-coords {P} -i {g1['_id']} -e 201")
-        shell(f"{apollo} feature edit-coords {P} -i {g2['_id']} -e 251")
-        p = shell(f"{apollo} feature check {P} -a v1")
         out = json.loads(p.stdout)
         self.assertTrue(len(out) > 1)
         self.assertTrue("InternalStopCodonCheck" in p.stdout)
@@ -875,30 +854,10 @@ def testFeatureChecks(self):
 
     def testFeatureChecksIndexed(self):
         shell(
-            f"{apollo} assembly add-from-fasta {P} -a v1 test_data/tiny.fasta.gz --not-editable -f"
+            f"{apollo} assembly add-from-fasta {P} -a v1 test_data/tiny.fasta.gz -f"
         )
-        shell(f"{apollo} feature import {P} -a v1 -i test_data/tiny.fasta.gff3 -d")
-        # shell(f"{apollo} assembly add-from-gff {P} test_data/tiny.fasta.gff3 -a v1 -f")
         shell(f"{apollo} assembly check {P} -a v1 -c CDSCheck")
-        p = shell(f"{apollo} feature check {P} -a v1")
-        ## If we don't edit a feature, checks are not activated (!?)
-        self.assertEqual(p.stdout.strip(), "[]")
-
-        p = shell(f"{apollo} feature get {P} -a v1")
-        ff = json.loads(p.stdout)
-        g1 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["MyGene"]
-        ][0]
-        g2 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["AnotherGene"]
-        ][0]
-
-        shell(f"{apollo} feature edit-coords {P} -i {g1['_id']} -e 201")
-        shell(f"{apollo} feature edit-coords {P} -i {g2['_id']} -e 251")
+        shell(f"{apollo} feature import {P} -a v1 test_data/tiny.fasta.gff3 -d")
         p = shell(f"{apollo} feature check {P} -a v1")
         out = json.loads(p.stdout)
         self.assertTrue(len(out) > 1)
@@ -995,13 +954,13 @@ def testRefNameAliasConfiguration(self):
         asm_id = json.loads(p.stdout)[0]["_id"]
 
         p = shell(
-            f"{apollo} refseq add-alias {P} -i test_data/alias.txt -a asm2",
+            f"{apollo} refseq add-alias {P} test_data/alias.txt -a asm2",
             strict=False,
         )
         self.assertTrue("Assembly asm2 not found" in p.stderr)
 
         p = shell(
-            f"{apollo} refseq add-alias {P} -i test_data/alias.txt -a asm1",
+            f"{apollo} refseq add-alias {P} test_data/alias.txt -a asm1",
             strict=False,
         )
         self.assertTrue(
@@ -1032,23 +991,23 @@ def testLogin(self):
         # This should be ok
         shell(f"{apollo} login {P} --force", timeout=5, strict=True)
     def testFileUpload(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         out = json.loads(p.stdout)
         self.assertEqual("text/x-fasta", out["type"])
         self.assertTrue(out["_id"])
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         out = json.loads(p.stdout)
         self.assertEqual("text/x-fasta", out["type"])
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gff3")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gff3")
         out = json.loads(p.stdout)
         self.assertEqual("text/x-gff3", out["type"])
 
-        p = shell(f"{apollo} file upload {P} -i test_data/guest.yaml", strict=False)
+        p = shell(f"{apollo} file upload {P} test_data/guest.yaml", strict=False)
         self.assertTrue(p.returncode != 0)
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gz", strict=False)
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gz", strict=False)
         self.assertTrue("it may be gzip or bgzip compressed" in p.stderr)
         self.assertTrue(p.returncode != 0)
 
@@ -1057,15 +1016,15 @@ def testFileUploadGzip(self):
         with open("test_data/tiny.fasta.gz", "rb") as gz:
             md5 = hashlib.md5(gz.read()).hexdigest()
         p = shell(
-            f"{apollo} file upload {P} -i test_data/tiny.fasta.gz -t text/x-fasta"
+            f"{apollo} file upload {P} test_data/tiny.fasta.gz -t text/x-fasta"
         )
         out = json.loads(p.stdout)
         self.assertEqual(md5, out["checksum"])
-        shell(f"{apollo} assembly add-from-fasta {P} -f {out['_id']}")
+        shell(f"{apollo} assembly add-from-fasta {P} -e -f {out['_id']}")
 
     def testAddAssemblyGzip(self):
         # Autodetect format
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta.gz -f -a vv1")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta.gz -e -f -a vv1")
         p = shell(f"{apollo} assembly sequence {P} -a vv1")
         self.assertTrue(p.stdout.startswith(">"))
         self.assertTrue("cattgttgcggagttgaaca" in p.stdout)
@@ -1073,7 +1032,7 @@ def testAddAssemblyGzip(self):
         # Skip autodetect
         shutil.copy("test_data/tiny.fasta", "test_data/tmp.gz")
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tmp.gz -f -a vv1 --decompressed"
+            f"{apollo} assembly add-from-fasta {P} test_data/tmp.gz -e -f -a vv1 --decompressed"
         )
         p = shell(f"{apollo} assembly sequence {P} -a vv1")
         self.assertTrue(p.stdout.startswith(">"))
@@ -1082,7 +1041,7 @@ def testAddAssemblyGzip(self):
 
         shutil.copy("test_data/tiny.fasta.gz", "test_data/fasta.tmp")
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -f -a vv1 --gzip"
+            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -e -f -a vv1 --gzip"
         )
         p = shell(f"{apollo} assembly sequence {P} -a vv1")
         self.assertTrue(p.stdout.startswith(">"))
@@ -1090,7 +1049,7 @@ def testAddAssemblyGzip(self):
 
         # Autodetect false positive
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -f -a vv1",
+            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -e -f -a vv1",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
@@ -1099,21 +1058,21 @@ def testAddAssemblyGzip(self):
     def testAddAssemblyFromFilesNotEditable(self):
         # It would be good to check that really there was no sequence loading
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable test_data/tiny.fasta.gz"
+            f"{apollo} assembly add-from-fasta {P} -f test_data/tiny.fasta.gz"
         )
         p = shell(f"{apollo} assembly sequence {P} -a tiny.fasta.gz")
         self.assertTrue(p.stdout.startswith(">"))
         self.assertTrue("cattgttgcggagttgaaca" in p.stdout)
 
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable test_data/tiny.fasta",
+            f"{apollo} assembly add-from-fasta {P} -f test_data/tiny.fasta",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
 
         # Setting --gzi & --fai
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable test_data/tiny2.fasta.gz --gzi test_data/tiny.fasta.gz.gzi --fai test_data/tiny.fasta.gz.fai"
+            f"{apollo} assembly add-from-fasta {P} -f test_data/tiny2.fasta.gz --gzi test_data/tiny.fasta.gz.gzi --fai test_data/tiny.fasta.gz.fai"
         )
         p = shell(f"{apollo} assembly sequence {P} -a tiny2.fasta.gz")
         self.assertTrue(p.stdout.startswith(">"))
@@ -1122,48 +1081,48 @@ def testAddAssemblyFromFilesNotEditable(self):
     def testAddAssemblyFromFileIdsNotEditable(self):
         # Upload and get Ids for: bgzip fasta, fai and gzi
         p = shell(
-            f"{apollo} file upload {P} -i test_data/tiny.fasta.gz -t application/x-bgzip-fasta"
+            f"{apollo} file upload {P} test_data/tiny.fasta.gz -t application/x-bgzip-fasta"
         )
         fastaId = json.loads(p.stdout)["_id"]
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gz.fai")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gz.fai")
         faiId = json.loads(p.stdout)["_id"]
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gz.gzi")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gz.gzi")
         gziId = json.loads(p.stdout)["_id"]
 
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable {fastaId} --fai test_data/tiny.fasta.gz.fai --gzi test_data/tiny.fasta.gz.gzi"
+            f"{apollo} assembly add-from-fasta {P} -f {fastaId} --fai test_data/tiny.fasta.gz.fai --gzi test_data/tiny.fasta.gz.gzi"
         )
         p = shell(f"{apollo} assembly sequence {P} -a {fastaId}")
         self.assertTrue(p.stdout.startswith(">"))
         self.assertTrue("cattgttgcggagttgaaca" in p.stdout)
 
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable {fastaId} --fai {faiId} --gzi {gziId}"
+            f"{apollo} assembly add-from-fasta {P} -f {fastaId} --fai {faiId} --gzi {gziId}"
         )
         p = shell(f"{apollo} assembly sequence {P} -a {fastaId}")
         self.assertTrue(p.stdout.startswith(">"))
 
     def testAddAssemblyFromFileId(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         fid = json.loads(p.stdout)["_id"]
-        p = shell(f"{apollo} assembly add-from-fasta {P} {fid} -a up -f")
+        p = shell(f"{apollo} assembly add-from-fasta {P} {fid} -a up -e -f")
         out = json.loads(p.stdout)
         self.assertEqual("up", out["name"])
         self.assertEqual(fid, out["fileIds"]["fa"])
 
         # shell(f"{apollo} assembly delete {P} -a up")
         # shell(
-        #     f"{apollo} file upload {P} -i test_data/tiny.fasta | {apollo} assembly add-from-fasta {P} -a up -f"
+        #     f"{apollo} file upload {P} test_data/tiny.fasta | {apollo} assembly add-from-fasta {P} -a up -e -f"
         # )
         # p = shell(f"{apollo} assembly get {P} -a up")
         # out = json.loads(p.stdout)
         # self.assertEqual("up", out[0]["name"])
 
     def testGetFiles(self):
-        shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        shell(f"{apollo} file upload {P} test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         fid = json.loads(p.stdout)["_id"]
 
         p = shell(f"{apollo} file get {P}")
@@ -1180,7 +1139,7 @@ def testGetFiles(self):
         self.assertEqual(0, len(out))
 
     def testDownloadFile(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         up = json.loads(p.stdout)
         if os.path.exists(up["basename"]):
             raise Exception(
@@ -1206,9 +1165,9 @@ def testDownloadFile(self):
         self.assertTrue(p.stdout.strip().endswith("accc"))
 
     def testDeleteFile(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         up1 = json.loads(p.stdout)
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         up2 = json.loads(p.stdout)
 
         p = shell(f"{apollo} file delete {P} -i {up1['_id']} {up2['_id']}")
diff --git a/packages/apollo-collaboration-server/.development.env b/packages/apollo-collaboration-server/.development.env
index 76a4040e..4a746102 100644
--- a/packages/apollo-collaboration-server/.development.env
+++ b/packages/apollo-collaboration-server/.development.env
@@ -57,7 +57,7 @@ DESCRIPTION=A server for Apollo development purposes
 # URL (relative or absolute) of the Apollo JBrowse plugin.
 # Defaults to relative URL 'apollo.js'
 PLUGIN_LOCATION=http://localhost:9000/dist/jbrowse-plugin-apollo.umd.development.js
-FEATURE_TYPE_ONTOLOGY_LOCATION=test_data/so-v3.1.json
+FEATURE_TYPE_ONTOLOGY_LOCATION=http://localhost:9000/test_data/so-v3.1.json
 
 # Application port, defaults to 3999
 # PORT=3999
diff --git a/packages/apollo-collaboration-server/package.json b/packages/apollo-collaboration-server/package.json
index 31031c92..2b796778 100644
--- a/packages/apollo-collaboration-server/package.json
+++ b/packages/apollo-collaboration-server/package.json
@@ -109,6 +109,7 @@
     "jest": "^29.6.2",
     "mongodb": "^4.7.0",
     "rimraf": "^3.0.2",
+    "serve": "^14.0.1",
     "source-map-support": "^0.5.20",
     "supertest": "^6.1.3",
     "ts-jest": "^29.1.1",
diff --git a/packages/apollo-collaboration-server/src/changes/changes.module.ts b/packages/apollo-collaboration-server/src/changes/changes.module.ts
index bf861208..55889d3b 100644
--- a/packages/apollo-collaboration-server/src/changes/changes.module.ts
+++ b/packages/apollo-collaboration-server/src/changes/changes.module.ts
@@ -6,6 +6,7 @@ import idValidator from 'mongoose-id-validator'
 
 import { AssembliesModule } from '../assemblies/assemblies.module'
 import { CountersModule } from '../counters/counters.module'
+import { ChecksModule } from '../checks/checks.module'
 import { FeaturesModule } from '../features/features.module'
 import { FilesModule } from '../files/files.module'
 import { JBrowseModule } from '../jbrowse/jbrowse.module'
@@ -37,6 +38,7 @@ import { ChangesService } from './changes.service'
     FilesModule,
     UsersModule,
     CountersModule,
+    ChecksModule,
     MessagesModule,
     JBrowseModule,
   ],
diff --git a/packages/apollo-collaboration-server/src/changes/changes.service.ts b/packages/apollo-collaboration-server/src/changes/changes.service.ts
index 71b9704e..7385fc3a 100644
--- a/packages/apollo-collaboration-server/src/changes/changes.service.ts
+++ b/packages/apollo-collaboration-server/src/changes/changes.service.ts
@@ -9,6 +9,8 @@ import {
   AssemblyDocument,
   Change,
   ChangeDocument,
+  Check,
+  CheckDocument,
   Feature,
   FeatureDocument,
   File,
@@ -68,6 +70,8 @@ export class ChangesService {
     private readonly jbrowseConfigModel: Model<JBrowseConfigDocument>,
     @InjectModel(Change.name)
     private readonly changeModel: Model<ChangeDocument>,
+    @InjectModel(Check.name)
+    private readonly checkModel: Model<CheckDocument>,
     private readonly filesService: FilesService,
     private readonly countersService: CountersService,
     private readonly pluginsService: PluginsService,
@@ -123,6 +127,7 @@ export class ChangesService {
           fileModel: this.fileModel,
           userModel: this.userModel,
           jbrowseConfigModel: this.jbrowseConfigModel,
+          checkModel: this.checkModel,
           session,
           filesService: this.filesService,
           counterService: this.countersService,
@@ -176,15 +181,15 @@ export class ChangesService {
         )
         try {
           // We cannot use Mongo 'session' / transaction here because Mongo has 16 MB limit for transaction
-          await this.refSeqChunkModel.updateMany(
+          await this.assemblyModel.updateMany(
             { $and: [{ status: -1, user: uniqUserId }] },
             { $set: { status: 0 } },
           )
-          await this.featureModel.updateMany(
+          await this.refSeqChunkModel.updateMany(
             { $and: [{ status: -1, user: uniqUserId }] },
             { $set: { status: 0 } },
           )
-          await this.assemblyModel.updateMany(
+          await this.featureModel.updateMany(
             { $and: [{ status: -1, user: uniqUserId }] },
             { $set: { status: 0 } },
           )
diff --git a/packages/apollo-collaboration-server/src/checks/checks.module.ts b/packages/apollo-collaboration-server/src/checks/checks.module.ts
index b2854844..a083f817 100644
--- a/packages/apollo-collaboration-server/src/checks/checks.module.ts
+++ b/packages/apollo-collaboration-server/src/checks/checks.module.ts
@@ -97,7 +97,7 @@ import { SequenceModule } from '../sequence/sequence.module'
     ]),
   ],
 
-  exports: [ChecksService],
+  exports: [ChecksService, MongooseModule],
   controllers: [ChecksController],
 })
 export class ChecksModule {}
diff --git a/packages/apollo-collaboration-server/src/files/filesUtil.ts b/packages/apollo-collaboration-server/src/files/filesUtil.ts
index 79bf1d51..31c6f416 100644
--- a/packages/apollo-collaboration-server/src/files/filesUtil.ts
+++ b/packages/apollo-collaboration-server/src/files/filesUtil.ts
@@ -99,29 +99,17 @@ async function unzip(input: FileHandle): Promise<Buffer> {
 }
 
 export class LocalFileGzip implements GenericFilehandle {
-  private fileHandle: Promise<FileHandle> | undefined
-  private contents: Promise<Buffer> | undefined
+  private fileHandle: Promise<FileHandle>
+  private contents: Promise<Buffer>
   private filename: string
   private opts: FilehandleOptions
 
   public constructor(source: string, opts: FilehandleOptions = {}) {
     this.filename = source
     this.opts = opts
-  }
-
-  private getFileHandle(): Promise<FileHandle> {
-    if (!this.fileHandle) {
-      this.fileHandle = open(this.filename)
-    }
-    return this.fileHandle
-  }
-
-  private async getContents(): Promise<Buffer> {
-    if (!this.contents) {
-      const fileHandle = await this.getFileHandle()
-      this.contents = unzip(fileHandle)
-    }
-    return this.contents
+    const fhPromise = open(source)
+    this.fileHandle = fhPromise
+    this.contents = fhPromise.then((fh) => unzip(fh))
   }
 
   public async read(
@@ -130,7 +118,7 @@ export class LocalFileGzip implements GenericFilehandle {
     length: number,
     position = 0,
   ): Promise<{ bytesRead: number; buffer: Buffer }> {
-    const unzippedContents = await this.getContents()
+    const unzippedContents = await this.contents
     const bytesRead = unzippedContents.copy(
       buffer,
       position,
@@ -154,7 +142,7 @@ export class LocalFileGzip implements GenericFilehandle {
   public async readFile(
     _options?: FilehandleOptions | BufferEncoding,
   ): Promise<Buffer | string> {
-    const unzippedContents = await this.getContents()
+    const unzippedContents = await this.contents
     if (this.opts.encoding) {
       return unzippedContents.toString(this.opts.encoding)
     }
@@ -163,12 +151,12 @@ export class LocalFileGzip implements GenericFilehandle {
 
   // todo memoize
   public async stat(): Promise<Stats> {
-    const contents = await this.getContents()
+    const contents = await this.contents
     return { size: contents.length }
   }
 
   public async close(): Promise<void> {
-    const fh = await this.getFileHandle()
+    const fh = await this.fileHandle
     return fh.close()
   }
 }
diff --git a/packages/apollo-collaboration-server/src/operations/operations.module.ts b/packages/apollo-collaboration-server/src/operations/operations.module.ts
index af2ea63a..3385f00c 100644
--- a/packages/apollo-collaboration-server/src/operations/operations.module.ts
+++ b/packages/apollo-collaboration-server/src/operations/operations.module.ts
@@ -1,6 +1,7 @@
 import { Module, forwardRef } from '@nestjs/common'
 
 import { AssembliesModule } from '../assemblies/assemblies.module'
+import { ChecksModule } from '../checks/checks.module'
 import { CountersModule } from '../counters/counters.module'
 import { FeaturesModule } from '../features/features.module'
 import { FilesModule } from '../files/files.module'
@@ -22,6 +23,7 @@ import { OperationsService } from './operations.service'
     CountersModule,
     MessagesModule,
     JBrowseModule,
+    ChecksModule,
   ],
   providers: [OperationsService],
   exports: [OperationsService],
diff --git a/packages/apollo-collaboration-server/src/operations/operations.service.ts b/packages/apollo-collaboration-server/src/operations/operations.service.ts
index f7604b69..0efeb1f2 100644
--- a/packages/apollo-collaboration-server/src/operations/operations.service.ts
+++ b/packages/apollo-collaboration-server/src/operations/operations.service.ts
@@ -2,6 +2,8 @@ import { Operation, operationRegistry } from '@apollo-annotation/common'
 import {
   Assembly,
   AssemblyDocument,
+  Check,
+  CheckDocument,
   Feature,
   FeatureDocument,
   File,
@@ -40,6 +42,8 @@ export class OperationsService {
     private readonly refSeqModel: Model<RefSeqDocument>,
     @InjectModel(RefSeqChunk.name)
     private readonly refSeqChunkModel: Model<RefSeqChunkDocument>,
+    @InjectModel(Check.name)
+    private readonly checkModel: Model<CheckDocument>,
     private readonly filesService: FilesService,
     private readonly countersService: CountersService,
     private readonly pluginsService: PluginsService,
@@ -53,6 +57,7 @@ export class OperationsService {
   ): Promise<ReturnType<T['executeOnServer']>> {
     const {
       assemblyModel,
+      checkModel,
       connection,
       countersService,
       featureModel,
@@ -79,6 +84,7 @@ export class OperationsService {
       fileModel,
       userModel,
       jbrowseConfigModel,
+      checkModel,
       session,
       filesService,
       counterService: countersService,
diff --git a/packages/apollo-collaboration-server/test/data/volvox.fa.gz b/packages/apollo-collaboration-server/test/data/volvox.fa.gz
new file mode 100644
index 00000000..eb7b2995
Binary files /dev/null and b/packages/apollo-collaboration-server/test/data/volvox.fa.gz differ
diff --git a/packages/apollo-collaboration-server/test/data/volvox.fa.gz.fai b/packages/apollo-collaboration-server/test/data/volvox.fa.gz.fai
new file mode 100644
index 00000000..a42fcf67
--- /dev/null
+++ b/packages/apollo-collaboration-server/test/data/volvox.fa.gz.fai
@@ -0,0 +1,2 @@
+ctgA	50001	22	60	61
+ctgB	6079	50879	100	101
diff --git a/packages/apollo-collaboration-server/test/data/volvox.fa.gz.gzi b/packages/apollo-collaboration-server/test/data/volvox.fa.gz.gzi
new file mode 100644
index 00000000..1b1cb4d4
Binary files /dev/null and b/packages/apollo-collaboration-server/test/data/volvox.fa.gz.gzi differ
diff --git a/packages/apollo-common/src/Operation.ts b/packages/apollo-common/src/Operation.ts
index 6a42a63a..ea8dba2a 100644
--- a/packages/apollo-common/src/Operation.ts
+++ b/packages/apollo-common/src/Operation.ts
@@ -12,6 +12,7 @@ import {
   RefSeqDocument,
   JBrowseConfigDocument,
   UserDocument,
+  CheckDocument,
 } from '@apollo-annotation/schemas'
 import type { LoggerService } from '@nestjs/common'
 import type { ClientSession, Model } from 'mongoose'
@@ -36,6 +37,7 @@ export interface ServerDataStore {
   assemblyModel: Model<AssemblyDocument>
   refSeqModel: Model<RefSeqDocument>
   refSeqChunkModel: Model<RefSeqChunkDocument>
+  checkModel: Model<CheckDocument>
   fileModel: Model<FileDocument>
   userModel: Model<UserDocument>
   jbrowseConfigModel: Model<JBrowseConfigDocument>
diff --git a/packages/apollo-shared/src/Changes/AddAssemblyAndFeaturesFromFileChange.ts b/packages/apollo-shared/src/Changes/AddAssemblyAndFeaturesFromFileChange.ts
index 9ac764cf..3f08a57f 100644
--- a/packages/apollo-shared/src/Changes/AddAssemblyAndFeaturesFromFileChange.ts
+++ b/packages/apollo-shared/src/Changes/AddAssemblyAndFeaturesFromFileChange.ts
@@ -65,7 +65,7 @@ export class AddAssemblyAndFeaturesFromFileChange extends FromFileBaseChange {
    * @returns
    */
   async executeOnServer(backend: ServerDataStore) {
-    const { assemblyModel, fileModel, filesService, user } = backend
+    const { assemblyModel, checkModel, fileModel, filesService, user } = backend
     const { assembly, changes, logger } = this
     for (const change of changes) {
       const { assemblyName, fileIds } = change
@@ -89,9 +89,12 @@ export class AddAssemblyAndFeaturesFromFileChange extends FromFileBaseChange {
       if (assemblyDoc) {
         throw new Error(`Assembly "${assemblyName}" already exists`)
       }
+      // get checks
+      const checkDocs = await checkModel.find({ default: true }).exec()
+      const checks = checkDocs.map((checkDoc) => checkDoc._id.toHexString())
       // Add assembly
       const [newAssemblyDoc] = await assemblyModel.create([
-        { _id: assembly, name: assemblyName, user, status: -1, fileId },
+        { _id: assembly, name: assemblyName, user, status: -1, fileId, checks },
       ])
       logger.debug?.(
         `Added new assembly "${assemblyName}", docId "${newAssemblyDoc._id.toHexString()}"`,
diff --git a/packages/apollo-shared/src/Changes/AddAssemblyFromExternalChange.ts b/packages/apollo-shared/src/Changes/AddAssemblyFromExternalChange.ts
index 913d821b..b311f7da 100644
--- a/packages/apollo-shared/src/Changes/AddAssemblyFromExternalChange.ts
+++ b/packages/apollo-shared/src/Changes/AddAssemblyFromExternalChange.ts
@@ -67,7 +67,7 @@ export class AddAssemblyFromExternalChange extends AssemblySpecificChange {
    * @returns
    */
   async executeOnServer(backend: ServerDataStore) {
-    const { assemblyModel, refSeqModel, user } = backend
+    const { assemblyModel, checkModel, refSeqModel, user } = backend
     const { assembly, changes, logger } = this
     const { CHUNK_SIZE } = process.env
     const customChunkSize = CHUNK_SIZE && Number(CHUNK_SIZE)
@@ -97,6 +97,8 @@ export class AddAssemblyFromExternalChange extends AssemblySpecificChange {
       if (assemblyDoc) {
         throw new Error(`Assembly "${assemblyName}" already exists`)
       }
+      const checkDocs = await checkModel.find({ default: true }).exec()
+      const checks = checkDocs.map((checkDoc) => checkDoc._id.toHexString())
       const [newAssemblyDoc] = await assemblyModel.create([
         {
           _id: assembly,
@@ -104,6 +106,7 @@ export class AddAssemblyFromExternalChange extends AssemblySpecificChange {
           user,
           status: -1,
           externalLocation,
+          checks,
         },
       ])
       logger.debug?.(
diff --git a/packages/apollo-shared/src/Changes/AddAssemblyFromFileChange.ts b/packages/apollo-shared/src/Changes/AddAssemblyFromFileChange.ts
index 8a963649..50b5ebed 100644
--- a/packages/apollo-shared/src/Changes/AddAssemblyFromFileChange.ts
+++ b/packages/apollo-shared/src/Changes/AddAssemblyFromFileChange.ts
@@ -88,8 +88,14 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
     }
 
     const { fa, fai, gzi } = fileIds
-    const { assemblyModel, fileModel, filesService, refSeqModel, user } =
-      backend
+    const {
+      assemblyModel,
+      checkModel,
+      fileModel,
+      filesService,
+      refSeqModel,
+      user,
+    } = backend
 
     const faDoc = await fileModel.findById(fa)
     const faChecksum = faDoc?.checksum
@@ -122,6 +128,8 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
     if (assemblyDoc) {
       throw new Error(`Assembly "${assemblyName}" already exists`)
     }
+    const checkDocs = await checkModel.find({ default: true }).exec()
+    const checks = checkDocs.map((checkDoc) => checkDoc._id.toHexString())
     const [newAssemblyDoc] = await assemblyModel.create([
       {
         _id: this.assembly,
@@ -129,6 +137,7 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
         user,
         status: -1,
         fileIds,
+        checks,
       },
     ])
     this.logger.debug?.(
@@ -157,7 +166,7 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
     assemblyName: string,
     fileId: string,
   ) {
-    const { assemblyModel, fileModel, user } = backend
+    const { assemblyModel, checkModel, fileModel, user } = backend
     // Get file checksum
     const fileDoc = await fileModel.findById(fileId).exec()
     if (!fileDoc) {
@@ -172,6 +181,8 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
     if (assemblyDoc) {
       throw new Error(`Assembly "${assemblyName}" already exists`)
     }
+    const checkDocs = await checkModel.find({ default: true }).exec()
+    const checks = checkDocs.map((checkDoc) => checkDoc._id.toHexString())
     // Add assembly
     const [newAssemblyDoc] = await assemblyModel.create([
       {
@@ -180,6 +191,7 @@ export class AddAssemblyFromFileChange extends FromFileBaseChange {
         user,
         status: -1,
         fileIds: { fa: fileId },
+        checks,
       },
     ])
     this.logger.debug?.(
diff --git a/packages/apollo-shared/src/Changes/ImportJBrowseConfigChange.ts b/packages/apollo-shared/src/Changes/ImportJBrowseConfigChange.ts
index c8eec77e..3e60d28a 100644
--- a/packages/apollo-shared/src/Changes/ImportJBrowseConfigChange.ts
+++ b/packages/apollo-shared/src/Changes/ImportJBrowseConfigChange.ts
@@ -39,7 +39,8 @@ export interface SerializedImportJBrowseConfigChange {
 }
 
 export function filterJBrowseConfig(config: JBrowseConfig): JBrowseConfig {
-  const { assemblies, internetAccounts, plugins, tracks, ...rest } = config
+  const { __v, _id, assemblies, internetAccounts, plugins, tracks, ...rest } =
+    config
   const filteredAssemblies = assemblies?.filter(
     (a) => a.sequence.adapter.type !== 'ApolloSequenceAdapter',
   )
diff --git a/packages/website/docs/cli/assembly.md b/packages/website/docs/cli/assembly.md
index 830eb5e0..e1771b6b 100644
--- a/packages/website/docs/cli/assembly.md
+++ b/packages/website/docs/cli/assembly.md
@@ -15,21 +15,20 @@ Add a new assembly from fasta input
 
 ```
 USAGE
-  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-x <value>] [-f] [-n]
-    [--fai <value>] [--gzi <value>] [-z | -d]
+  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-f] [-e] [--fai <value>]
+    [--gzi <value>] [-z | -d]
 
 ARGUMENTS
-  INPUT  Input fasta file, local or remote, or id of a previously uploaded file
+  INPUT  Input fasta file, local or remote, or id of a previously uploaded file. For local or remote files, it is
+         assumed the file is bgzip'd with `bgzip` and indexed with `samtools faidx`. The indexes are assumed to be at
+         <my.fasta.gz>.fai and <my.fasta.gz>.gzi unless the options --fai and --gzi are provided.
 
 FLAGS
   -a, --assembly=<value>     Name for this assembly. Use the file name if omitted
   -d, --decompressed         For local file input: Override autodetection and instruct that input is decompressed
+  -e, --editable             Instead of using indexed fasta lookup, the sequence is loaded into the Apollo database and
+                             is editable. Use with caution, as editing the sequence often has unintended side effects.
   -f, --force                Delete existing assembly, if it exists
-  -n, --not-editable         The fasta sequence is not editable. Apollo will not load it into the database and instead
-                             use the provided indexes to query it. This option assumes the fasta file is bgzip'd with
-                             `bgzip` and indexed with `samtools faidx`. Indexes should be named <my.fasta.gz>.gzi and
-                             <my.fasta.gz>.fai unless options --fai and --gzi are set
-  -x, --index=<value>        URL of the index. Required if input is an external source
   -z, --gzip                 For local file input: Override autodetection and instruct that input is gzip compressed
       --config-file=<value>  Use this config file (mostly for testing)
       --fai=<value>          Fasta index of the (not-editable) fasta file
@@ -83,7 +82,7 @@ DESCRIPTION
 EXAMPLES
   Import sequences and features:
 
-    $ apollo assembly add-from-gff -i genome.gff -a myAssembly
+    $ apollo assembly add-from-gff genome.gff -a myAssembly
 
   Import sequences only:
 
diff --git a/packages/website/docs/cli/feature.md b/packages/website/docs/cli/feature.md
index 00d9ca7b..8722363c 100644
--- a/packages/website/docs/cli/feature.md
+++ b/packages/website/docs/cli/feature.md
@@ -12,7 +12,7 @@ Commands to manage features
 - [`apollo feature edit-type`](#apollo-feature-edit-type)
 - [`apollo feature get`](#apollo-feature-get)
 - [`apollo feature get-id`](#apollo-feature-get-id)
-- [`apollo feature import`](#apollo-feature-import)
+- [`apollo feature import INPUT-FILE`](#apollo-feature-import-input-file)
 - [`apollo feature search`](#apollo-feature-search)
 
 ## `apollo feature add-child`
@@ -336,18 +336,20 @@ EXAMPLES
 _See code:
 [src/commands/feature/get-id.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/get-id.ts)_
 
-## `apollo feature import`
+## `apollo feature import INPUT-FILE`
 
 Import features from local gff file
 
 ```
 USAGE
-  $ apollo feature import -i <value> -a <value> [--profile <value>] [--config-file <value>] [-d]
+  $ apollo feature import INPUT-FILE -a <value> [--profile <value>] [--config-file <value>] [-d]
+
+ARGUMENTS
+  INPUT-FILE  Input gff file
 
 FLAGS
   -a, --assembly=<value>     (required) Import into this assembly name or assembly ID
   -d, --delete-existing      Delete existing features before importing
-  -i, --input-file=<value>   (required) Input gff file
       --config-file=<value>  Use this config file (mostly for testing)
       --profile=<value>      Use credentials from this profile
 
@@ -359,7 +361,7 @@ DESCRIPTION
 EXAMPLES
   Delete features in myAssembly and then import features.gff3:
 
-    $ apollo feature import -d -i features.gff3 -a myAssembly
+    $ apollo feature import features.gff3 -d -a myAssembly
 ```
 
 _See code:
diff --git a/packages/website/docs/cli/file.md b/packages/website/docs/cli/file.md
index eb8972a6..fce49797 100644
--- a/packages/website/docs/cli/file.md
+++ b/packages/website/docs/cli/file.md
@@ -5,7 +5,7 @@ Commands to manage files
 - [`apollo file delete`](#apollo-file-delete)
 - [`apollo file download`](#apollo-file-download)
 - [`apollo file get`](#apollo-file-get)
-- [`apollo file upload`](#apollo-file-upload)
+- [`apollo file upload INPUT-FILE`](#apollo-file-upload-input-file)
 
 ## `apollo file delete`
 
@@ -89,18 +89,20 @@ EXAMPLES
 _See code:
 [src/commands/file/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/get.ts)_
 
-## `apollo file upload`
+## `apollo file upload INPUT-FILE`
 
 Upload a local file to the Apollo server
 
 ```
 USAGE
-  $ apollo file upload -i <value> [--profile <value>] [--config-file <value>] [-t
+  $ apollo file upload INPUT-FILE [--profile <value>] [--config-file <value>] [-t
     text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi] [-z | -d]
 
+ARGUMENTS
+  INPUT-FILE  Local file to upload
+
 FLAGS
   -d, --decompressed         Override autodetection and instruct that input is decompressed
-  -i, --input-file=<value>   (required) Local file to upload
   -t, --type=<option>        Set file type or autodetected it if not set.
                              NB: There is no check for whether the file complies to this type
                              <options: text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi>
@@ -118,7 +120,7 @@ DESCRIPTION
 EXAMPLES
   Upload local file, type auto-detected:
 
-    $ apollo file upload -i genome.fa > file.json
+    $ apollo file upload genome.fa > file.json
 ```
 
 _See code:
diff --git a/packages/website/docs/cli/refseq.md b/packages/website/docs/cli/refseq.md
index c3a29149..16c7ef5a 100644
--- a/packages/website/docs/cli/refseq.md
+++ b/packages/website/docs/cli/refseq.md
@@ -2,20 +2,22 @@
 
 Commands to manage reference sequences
 
-- [`apollo refseq add-alias`](#apollo-refseq-add-alias)
+- [`apollo refseq add-alias INPUT-FILE`](#apollo-refseq-add-alias-input-file)
 - [`apollo refseq get`](#apollo-refseq-get)
 
-## `apollo refseq add-alias`
+## `apollo refseq add-alias INPUT-FILE`
 
 Add reference name aliases from a file
 
 ```
 USAGE
-  $ apollo refseq add-alias -i <value> -a <value> [--profile <value>] [--config-file <value>]
+  $ apollo refseq add-alias INPUT-FILE -a <value> [--profile <value>] [--config-file <value>]
+
+ARGUMENTS
+  INPUT-FILE  Input refname alias file
 
 FLAGS
   -a, --assembly=<value>     (required) Name for this assembly.
-  -i, --input-file=<value>   (required) Input refname alias file
       --config-file=<value>  Use this config file (mostly for testing)
       --profile=<value>      Use credentials from this profile
 
@@ -28,7 +30,7 @@ DESCRIPTION
 EXAMPLES
   Add reference name aliases:
 
-    $ apollo refseq add-alias -i alias.txt -a myAssembly
+    $ apollo refseq add-alias alias.txt -a myAssembly
 ```
 
 _See code:
diff --git a/yarn.lock b/yarn.lock
index 8b631e52..ae9e8993 100644
--- a/yarn.lock
+++ b/yarn.lock
@@ -428,6 +428,7 @@ __metadata:
     rimraf: "npm:^3.0.2"
     rxjs: "npm:^7.4.0"
     sanitize-filename: "npm:^1.6.3"
+    serve: "npm:^14.0.1"
     socket.io: "npm:^4.5.3"
     source-map-support: "npm:^0.5.20"
     stream-concat: "npm:^1.0.0"