From d210dcf4bc0ca540ad8bd7c602e09272be61ac38 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 22 Oct 2024 03:24:28 +0000
Subject: [PATCH] Fix CLI tests

---
 packages/apollo-cli/README.md                 | 1088 +++++++++++++++++
 .../src/commands/assembly/add-from-gff.ts     |   32 +-
 packages/apollo-cli/src/utils.ts              |    8 +-
 packages/apollo-cli/test/test.py              |  150 +--
 packages/website/docs/cli/assembly.md         |   15 +-
 5 files changed, 1177 insertions(+), 116 deletions(-)

diff --git a/packages/apollo-cli/README.md b/packages/apollo-cli/README.md
index bd1ca6fc..b0faa1f0 100644
--- a/packages/apollo-cli/README.md
+++ b/packages/apollo-cli/README.md
@@ -29,7 +29,850 @@ USAGE
 
 <!-- commands -->
 
+- [`apollo assembly add-from-fasta INPUT`](#apollo-assembly-add-from-fasta-input)
+- [`apollo assembly add-from-gff INPUT-FILE`](#apollo-assembly-add-from-gff-input-file)
+- [`apollo assembly check`](#apollo-assembly-check)
+- [`apollo assembly delete`](#apollo-assembly-delete)
+- [`apollo assembly get`](#apollo-assembly-get)
+- [`apollo assembly sequence`](#apollo-assembly-sequence)
+- [`apollo change get`](#apollo-change-get)
+- [`apollo config [KEY] [VALUE]`](#apollo-config-key-value)
+- [`apollo feature add-child`](#apollo-feature-add-child)
+- [`apollo feature check`](#apollo-feature-check)
+- [`apollo feature copy`](#apollo-feature-copy)
+- [`apollo feature delete`](#apollo-feature-delete)
+- [`apollo feature edit`](#apollo-feature-edit)
+- [`apollo feature edit-attribute`](#apollo-feature-edit-attribute)
+- [`apollo feature edit-coords`](#apollo-feature-edit-coords)
+- [`apollo feature edit-type`](#apollo-feature-edit-type)
+- [`apollo feature get`](#apollo-feature-get)
+- [`apollo feature get-id`](#apollo-feature-get-id)
+- [`apollo feature import INPUT-FILE`](#apollo-feature-import-input-file)
+- [`apollo feature search`](#apollo-feature-search)
+- [`apollo file delete`](#apollo-file-delete)
+- [`apollo file download`](#apollo-file-download)
+- [`apollo file get`](#apollo-file-get)
+- [`apollo file upload INPUT-FILE`](#apollo-file-upload-input-file)
 - [`apollo help [COMMANDS]`](#apollo-help-commands)
+- [`apollo jbrowse get-config`](#apollo-jbrowse-get-config)
+- [`apollo jbrowse set-config INPUTFILE`](#apollo-jbrowse-set-config-inputfile)
+- [`apollo login`](#apollo-login)
+- [`apollo logout`](#apollo-logout)
+- [`apollo refseq add-alias INPUT-FILE`](#apollo-refseq-add-alias-input-file)
+- [`apollo refseq get`](#apollo-refseq-get)
+- [`apollo status`](#apollo-status)
+- [`apollo user get`](#apollo-user-get)
+
+## `apollo assembly add-from-fasta INPUT`
+
+Add a new assembly from fasta input
+
+```
+USAGE
+  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-f] [-e] [--fai <value>]
+    [--gzi <value>] [-z | -d]
+
+ARGUMENTS
+  INPUT  Input fasta file, local or remote, or id of a previously uploaded file. For local or remote files, it is
+         assumed the file is bgzip'd with `bgzip` and indexed with `samtools faidx`. The indexes are assumed to be at
+         <my.fasta.gz>.fai and <my.fasta.gz>.gzi unless the options --fai and --gzi are provided.
+
+FLAGS
+  -a, --assembly=<value>     Name for this assembly. Use the file name if omitted
+  -d, --decompressed         For local file input: Override autodetection and instruct that input is decompressed
+  -e, --editable             Instead of using indexed fasta lookup, the sequence is loaded into the Apollo database and
+                             is editable. Use with caution, as editing the sequence often has unintended side effects.
+  -f, --force                Delete existing assembly, if it exists
+  -z, --gzip                 For local file input: Override autodetection and instruct that input is gzip compressed
+      --config-file=<value>  Use this config file (mostly for testing)
+      --fai=<value>          Fasta index of the (not-editable) fasta file
+      --gzi=<value>          Gzi index of the (not-editable) fasta file
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add a new assembly from fasta input
+
+  Add new assembly. The input fasta may be:
+  * A local file
+  * An external fasta file
+  * The id of a file previously uploaded to Apollo
+
+EXAMPLES
+  From local file:
+
+    $ apollo assembly add-from-fasta genome.fa -a myAssembly
+
+  From external source we also need the URL of the index:
+
+    $ apollo assembly add-from-fasta https://.../genome.fa -x https://.../genome.fa.fai -a myAssembly
+```
+
+_See code:
+[src/commands/assembly/add-from-fasta.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/add-from-fasta.ts)_
+
+## `apollo assembly add-from-gff INPUT-FILE`
+
+Add new assembly from gff or gft file
+
+```
+USAGE
+  $ apollo assembly add-from-gff INPUT-FILE [--profile <value>] [--config-file <value>] [-a <value>] [-o] [-f]
+
+ARGUMENTS
+  INPUT-FILE  Input gff file
+
+FLAGS
+  -a, --assembly=<value>     Name for this assembly. Use the file name if omitted
+  -f, --force                Delete existing assembly, if it exists
+  -o, --omit-features        Do not import features, only upload the sequences
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add new assembly from gff or gft file
+
+  The gff file is expected to contain sequences as per gff specifications. Features are also imported by default.
+
+EXAMPLES
+  Import sequences and features:
+
+    $ apollo assembly add-from-gff genome.gff -a myAssembly
+
+  Import sequences only:
+
+    $ apollo assembly add-from-gff genome.gff -a myAssembly -o
+```
+
+_See code:
+[src/commands/assembly/add-from-gff.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/add-from-gff.ts)_
+
+## `apollo assembly check`
+
+Add, view, or delete checks to assembly
+
+```
+USAGE
+  $ apollo assembly check [--profile <value>] [--config-file <value>] [-a <value>] [-c <value>] [-d]
+
+FLAGS
+  -a, --assembly=<value>     Manage checks in this assembly
+  -c, --check=<value>...     Add these check names or IDs. If unset, print the checks set for assembly
+  -d, --delete               Delete (instead of adding) checks
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add, view, or delete checks to assembly
+
+  Manage checks, i.e. the rules ensuring features in an assembly are plausible. This command only sets the checks to
+  apply, to retrieve features flagged by these checks use `apollo feature check`.
+
+EXAMPLES
+  View available check types:
+
+    $ apollo assembly check
+
+  View checks set for assembly hg19:
+
+    $ apollo assembly check -a hg19
+
+  Add checks to assembly:
+
+    $ apollo assembly check -a hg19 -c CDSCheck
+
+  Delete checks from assembly:
+
+    $ apollo assembly check -a hg19 -c CDSCheck --delete
+```
+
+_See code:
+[src/commands/assembly/check.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/check.ts)_
+
+## `apollo assembly delete`
+
+Delete assemblies
+
+```
+USAGE
+  $ apollo assembly delete -a <value> [--profile <value>] [--config-file <value>] [-v]
+
+FLAGS
+  -a, --assembly=<value>...  (required) Assembly names or IDs to delete
+  -v, --verbose              Print to stdout the array of assemblies deleted
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Delete assemblies
+
+  Assemblies to delete may be names or IDs
+
+EXAMPLES
+  Delete multiple assemblies using name or ID:
+
+    $ apollo assembly delete -a mouse 6605826fbd0eee691f83e73f
+```
+
+_See code:
+[src/commands/assembly/delete.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/delete.ts)_
+
+## `apollo assembly get`
+
+Get available assemblies
+
+```
+USAGE
+  $ apollo assembly get [--profile <value>] [--config-file <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>...  Get assemblies in this list of names or IDs
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get available assemblies
+
+  Print to stdout the list of assemblies in json format
+```
+
+_See code:
+[src/commands/assembly/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/get.ts)_
+
+## `apollo assembly sequence`
+
+Get reference sequence in fasta format
+
+```
+USAGE
+  $ apollo assembly sequence [--profile <value>] [--config-file <value>] [-a <value>] [-r <value>] [-s <value>] [-e
+    <value>]
+
+FLAGS
+  -a, --assembly=<value>     Find input reference sequence in this assembly
+  -e, --end=<value>          End coordinate
+  -r, --refseq=<value>       Reference sequence. If unset, get all sequences
+  -s, --start=<value>        [default: 1] Start coordinate (1-based)
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get reference sequence in fasta format
+
+  Return the reference sequence for a given assembly and coordinates
+
+EXAMPLES
+  Get all sequences in myAssembly:
+
+    $ apollo assembly sequence -a myAssembly
+
+  Get sequence in coordinates chr1:1..1000:
+
+    $ apollo assembly sequence -a myAssembly -r chr1 -s 1 -e 1000
+```
+
+_See code:
+[src/commands/assembly/sequence.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/assembly/sequence.ts)_
+
+## `apollo change get`
+
+Get list of changes
+
+```
+USAGE
+  $ apollo change get [--profile <value>] [--config-file <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>...  Get changes only for these assembly names or IDs (but see description)
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get list of changes
+
+  Return the change log in json format. Note that when an assembly is deleted the link between common name and ID is
+  lost (it can still be recovered by inspecting the change log but at present this task is left to the user). In such
+  cases you need to use the assembly ID.
+```
+
+_See code:
+[src/commands/change/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/change/get.ts)_
+
+## `apollo config [KEY] [VALUE]`
+
+Get or set apollo configuration options
+
+```
+USAGE
+  $ apollo config [KEY] [VALUE] [--profile <value>] [---file <value>] [--get-config-file]
+
+ARGUMENTS
+  KEY    Name of configuration parameter
+  VALUE  Parameter value
+
+FLAGS
+  --config-file=<value>  Use this config file (mostly for testing)
+  --get-config-file      Return the path to the config file and exit (this file may not exist yet)
+  --profile=<value>      Profile to create or edit
+
+DESCRIPTION
+  Get or set apollo configuration options
+
+  Use this command to create or edit a user profile with credentials to access Apollo. Configuration options are:
+
+  - address:
+  Address and port e.g http://localhost:3999
+
+  - accessType:
+  How to access Apollo. accessType is typically one of: google, microsoft, guest, root. Allowed types depend on your
+  Apollo setup
+
+  - accessToken:
+  Access token. Usually inserted by `apollo login`
+
+  - rootCredentials.username:
+  Username of root account. Only set this for "root" access type
+
+  - rootCredentials.password:
+  Password for root account. Only set this for "root" access type
+
+EXAMPLES
+  Interactive setup:
+
+    $ apollo config
+
+  Setup with key/value pairs:
+
+    $ apollo config --profile admin address http://localhost:3999
+
+  Get current address for default profile:
+
+    $ apollo config address
+```
+
+_See code:
+[src/commands/config.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/config.ts)_
+
+## `apollo feature add-child`
+
+Add a child feature (e.g. add an exon to an mRNA)
+
+```
+USAGE
+  $ apollo feature add-child -s <value> -e <value> -t <value> [--profile <value>] [--config-file <value>] [-i <value>]
+
+FLAGS
+  -e, --end=<value>          (required) End coordinate of the child feature (1-based)
+  -i, --feature-id=<value>   [default: -] Add a child to this feature ID; use - to read it from stdin
+  -s, --start=<value>        (required) Start coordinate of the child feature (1-based)
+  -t, --type=<value>         (required) Type of child feature
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add a child feature (e.g. add an exon to an mRNA)
+
+  See the other commands under `apollo feature` to retrive the parent ID of interest and to populate the child feature
+  with attributes.
+
+EXAMPLES
+  Add an exon at genomic coordinates 10..20 to this feature ID:
+
+    $ apollo feature add-child -i 660...73f -t exon -s 10 -e 20
+```
+
+_See code:
+[src/commands/feature/add-child.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/add-child.ts)_
+
+## `apollo feature check`
+
+Get check results
+
+```
+USAGE
+  $ apollo feature check [--profile <value>] [--config-file <value>] [-i <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>       Get checks for this assembly
+  -i, --feature-id=<value>...  Get checks for these feature identifiers
+      --config-file=<value>    Use this config file (mostly for testing)
+      --profile=<value>        Use credentials from this profile
+
+DESCRIPTION
+  Get check results
+
+  Use this command to view which features fail checks along with the reason for failing.Use `apollo assembly check` for
+  managing which checks should be applied to an assembly
+
+EXAMPLES
+  Get all check results in the database:
+
+    $ apollo feature check
+
+  Get check results for assembly hg19:
+
+    $ apollo feature check -a hg19
+```
+
+_See code:
+[src/commands/feature/check.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/check.ts)_
+
+## `apollo feature copy`
+
+Copy a feature to another location
+
+```
+USAGE
+  $ apollo feature copy -r <value> -s <value> [--profile <value>] [--config-file <value>] [-i <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>     Name or ID of target assembly. Not required if refseq is unique in the database
+  -i, --feature-id=<value>   [default: -] Feature ID to copy to; use - to read it from stdin
+  -r, --refseq=<value>       (required) Name or ID of target reference sequence
+  -s, --start=<value>        (required) Start position in target reference sequence
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Copy a feature to another location
+
+  The feature may be copied to the same or to a different assembly. The destination reference sequence may be selected
+  by name only if unique in the database or by name and assembly or by identifier.
+
+EXAMPLES
+  Copy this feature ID to chr1:100 in assembly hg38:
+
+    $ apollo feature copy -i 6605826fbd0eee691f83e73f -r chr1 -s 100 -a hg38
+```
+
+_See code:
+[src/commands/feature/copy.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/copy.ts)_
+
+## `apollo feature delete`
+
+Delete one or more features by ID
+
+```
+USAGE
+  $ apollo feature delete [--profile <value>] [--config-file <value>] [-i <value>] [-f] [-n]
+
+FLAGS
+  -f, --force                  Ignore non-existing features
+  -i, --feature-id=<value>...  [default: -] Feature IDs to delete
+  -n, --dry-run                Only show what would be delete
+      --config-file=<value>    Use this config file (mostly for testing)
+      --profile=<value>        Use credentials from this profile
+
+DESCRIPTION
+  Delete one or more features by ID
+
+  Note that deleting a child feature after deleting its parent will result in an error unless you set -f/--force.
+```
+
+_See code:
+[src/commands/feature/delete.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/delete.ts)_
+
+## `apollo feature edit`
+
+Edit features using an appropiate json input
+
+```
+USAGE
+  $ apollo feature edit [--profile <value>] [--config-file <value>] [-j <value>]
+
+FLAGS
+  -j, --json-input=<value>   [default: -] Json string or json file or "-" to read json from stdin
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Edit features using an appropiate json input
+
+  Edit a feature by submitting a json input with all the required attributes for Apollo to process it. This is a very
+  low level command which most users probably do not need.
+
+  Input may be a json string or a json file and it may be an array of changes. This is an example input for editing
+  feature type:
+
+  {
+  "typeName": "TypeChange",
+  "changedIds": [
+  "6613f7d22c957525d631b1cc"
+  ],
+  "assembly": "6613f7d1360321540a11e5ed",
+  "featureId": "6613f7d22c957525d631b1cc",
+  "oldType": "BAC",
+  "newType": "G_quartet"
+  }
+
+EXAMPLES
+  Editing by passing a json to stdin:
+
+    echo '{"typeName": ... "newType": "G_quartet"}' | apollo feature edit -j -
+```
+
+_See code:
+[src/commands/feature/edit.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit.ts)_
+
+## `apollo feature edit-attribute`
+
+Add, edit, or view a feature attribute
+
+```
+USAGE
+  $ apollo feature edit-attribute -a <value> [--profile <value>] [--config-file <value>] [-i <value>] [-v <value>] [-d]
+
+FLAGS
+  -a, --attribute=<value>    (required) Attribute key to add or edit
+  -d, --delete               Delete this attribute
+  -i, --feature-id=<value>   [default: -] Feature ID to edit or "-" to read it from stdin
+  -v, --value=<value>...     New attribute value. Separated mutliple values by space to them as a list. If unset return
+                             current value
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add, edit, or view a feature attribute
+
+  Be aware that there is no checking whether attributes names and values are valid. For example, you can create
+  non-unique ID attributes or you can set gene ontology terms to non-existing terms
+
+EXAMPLES
+  Add attribute "domains" with a list of values:
+
+    $ apollo feature edit-attribute -i 66...3f -a domains -v ABC PLD
+
+  Print values in "domains" as json array:
+
+    $ apollo feature edit-attribute -i 66...3f -a domains
+
+  Delete attribute "domains"
+
+    $ apollo feature edit-attribute -i 66...3f -a domains -d
+```
+
+_See code:
+[src/commands/feature/edit-attribute.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit-attribute.ts)_
+
+## `apollo feature edit-coords`
+
+Edit feature start and/or end coordinates
+
+```
+USAGE
+  $ apollo feature edit-coords [--profile <value>] [--config-file <value>] [-i <value>] [-s <value>] [-e <value>]
+
+FLAGS
+  -e, --end=<value>          New end coordinate (1-based)
+  -i, --feature-id=<value>   [default: -] Feature ID to edit or "-" to read it from stdin
+  -s, --start=<value>        New start coordinate (1-based)
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Edit feature start and/or end coordinates
+
+  If editing a child feature that new coordinates must be within the parent's coordinates.To get the identifier of the
+  feature to edit consider using `apollo feature get` or `apollo feature search`
+
+EXAMPLES
+  Edit start and end:
+
+    $ apollo feature edit-coords -i abc...xyz -s 10 -e 1000
+
+  Edit end and leave start as it is:
+
+    $ apollo feature edit-coords -i abc...xyz -e 2000
+```
+
+_See code:
+[src/commands/feature/edit-coords.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit-coords.ts)_
+
+## `apollo feature edit-type`
+
+Edit or view feature type
+
+```
+USAGE
+  $ apollo feature edit-type [--profile <value>] [--config-file <value>] [-i <value>] [-t <value>]
+
+FLAGS
+  -i, --feature-id=<value>   [default: -] Feature ID to edit or "-" to read it from stdin
+  -t, --type=<value>         Assign feature to this type. If unset return the current type
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Edit or view feature type
+
+  Feature type is column 3 in gff format.It must be a valid sequence ontology term although but the valifdity of the new
+  term is not checked.
+```
+
+_See code:
+[src/commands/feature/edit-type.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/edit-type.ts)_
+
+## `apollo feature get`
+
+Get features in assembly, reference sequence or genomic window
+
+```
+USAGE
+  $ apollo feature get [--profile <value>] [--config-file <value>] [-a <value>] [-r <value>] [-s <value>] [-e
+    <value>]
+
+FLAGS
+  -a, --assembly=<value>     Find input reference sequence in this assembly
+  -e, --end=<value>          End coordinate
+  -r, --refseq=<value>       Reference sequence. If unset, query all sequences
+  -s, --start=<value>        [default: 1] Start coordinate (1-based)
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get features in assembly, reference sequence or genomic window
+
+EXAMPLES
+  Get all features in myAssembly:
+
+    $ apollo feature get -a myAssembly
+
+  Get features intersecting chr1:1..1000. You can omit the assembly name if there are no other reference sequences
+  named chr1:
+
+    $ apollo feature get -a myAssembly -r chr1 -s 1 -e 1000
+```
+
+_See code:
+[src/commands/feature/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/get.ts)_
+
+## `apollo feature get-id`
+
+Get features given their identifiers
+
+```
+USAGE
+  $ apollo feature get-id [--profile <value>] [--config-file <value>] [-i <value>]
+
+FLAGS
+  -i, --feature-id=<value>...  [default: -] Retrieves feature with these IDs. Use "-" to read IDs from stdin (one per
+                               line)
+      --config-file=<value>    Use this config file (mostly for testing)
+      --profile=<value>        Use credentials from this profile
+
+DESCRIPTION
+  Get features given their identifiers
+
+  Invalid identifiers or identifiers not found in the database will be silently ignored
+
+EXAMPLES
+  Get features for these identifiers:
+
+    $ apollo feature get-id -i abc...zyz def...foo
+```
+
+_See code:
+[src/commands/feature/get-id.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/get-id.ts)_
+
+## `apollo feature import INPUT-FILE`
+
+Import features from local gff file
+
+```
+USAGE
+  $ apollo feature import INPUT-FILE -a <value> [--profile <value>] [--config-file <value>] [-d]
+
+ARGUMENTS
+  INPUT-FILE  Input gff file
+
+FLAGS
+  -a, --assembly=<value>     (required) Import into this assembly name or assembly ID
+  -d, --delete-existing      Delete existing features before importing
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Import features from local gff file
+
+  By default, features are added to the existing ones.
+
+EXAMPLES
+  Delete features in myAssembly and then import features.gff3:
+
+    $ apollo feature import features.gff3 -d -a myAssembly
+```
+
+_See code:
+[src/commands/feature/import.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/import.ts)_
+
+## `apollo feature search`
+
+Free text search for feature in one or more assemblies
+
+```
+USAGE
+  $ apollo feature search -t <value> [--profile <value>] [--config-file <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>...  Assembly names or IDs to search; use "-" to read it from stdin. If omitted search all
+                             assemblies
+  -t, --text=<value>         (required) Search for this text query
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Free text search for feature in one or more assemblies
+
+  Return features matching a query string. This command searches only in:
+
+  - Attribute *values* (not attribute names)
+  - Source field (which in fact is stored as an attribute)
+  - Feature type
+
+  The search mode is:
+
+  - Case insensitive
+  - Match only full words, but not necessarily the full value
+  - Common words are ignored. E.g. "the", "with"
+
+  For example, given this feature:
+
+  chr1 example SNP 10 30 0.987 . . "someKey=Fingerprint BAC with reads"
+
+  Queries "bac" or "mRNA" return the feature. Instead these queries will NOT match:
+
+  - "someKey"
+  - "with"
+  - "Finger"
+  - "chr1"
+  - "0.987"
+
+EXAMPLES
+  Search "bac" in these assemblies:
+
+    $ apollo feature search -a mm9 mm10 -t bac
+```
+
+_See code:
+[src/commands/feature/search.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/feature/search.ts)_
+
+## `apollo file delete`
+
+Delete files from the Apollo server
+
+```
+USAGE
+  $ apollo file delete [--profile <value>] [--config-file <value>] [-i <value>]
+
+FLAGS
+  -i, --file-id=<value>...   [default: -] IDs of the files to delete
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Delete files from the Apollo server
+
+  Deleted files are printed to stdout. See also `apollo file get` to list the files on the server
+
+EXAMPLES
+  Delete file multiple files:
+
+    $ apollo file delete -i 123...abc xyz...789
+```
+
+_See code:
+[src/commands/file/delete.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/delete.ts)_
+
+## `apollo file download`
+
+Download a file from the Apollo server
+
+```
+USAGE
+  $ apollo file download [--profile <value>] [--config-file <value>] [-i <value>] [-o <value>]
+
+FLAGS
+  -i, --file-id=<value>      [default: -] ID of the file to download
+  -o, --output=<value>       Write output to this file or "-" for stdout. Default to the name of the uploaded file.
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Download a file from the Apollo server
+
+  See also `apollo file get` to list the files on the server
+
+EXAMPLES
+  Download file with id xyz
+
+    $ apollo file download -i xyz -o genome.fa
+```
+
+_See code:
+[src/commands/file/download.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/download.ts)_
+
+## `apollo file get`
+
+Get list of files uploaded to the Apollo server
+
+```
+USAGE
+  $ apollo file get [--profile <value>] [--config-file <value>] [-i <value>]
+
+FLAGS
+  -i, --file-id=<value>...   Get files matching this IDs
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get list of files uploaded to the Apollo server
+
+  Print to stdout the list of files in json format
+
+EXAMPLES
+  Get files by id:
+
+    $ apollo file get -i xyz abc
+```
+
+_See code:
+[src/commands/file/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/get.ts)_
+
+## `apollo file upload INPUT-FILE`
+
+Upload a local file to the Apollo server
+
+```
+USAGE
+  $ apollo file upload INPUT-FILE [--profile <value>] [--config-file <value>] [-t
+    text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi] [-z | -d]
+
+ARGUMENTS
+  INPUT-FILE  Local file to upload
+
+FLAGS
+  -d, --decompressed         Override autodetection and instruct that input is decompressed
+  -t, --type=<option>        Set file type or autodetected it if not set.
+                             NB: There is no check for whether the file complies to this type
+                             <options: text/x-fasta|text/x-gff3|application/x-bgzip-fasta|text/x-fai|application/x-gzi>
+  -z, --gzip                 Override autodetection and instruct that input is gzip compressed
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Upload a local file to the Apollo server
+
+  This command only uploads a file and returns the corresponding file id.
+  To add an assembly based on this file or to upload & add an assembly in a single pass   see `apollo assembly
+  add-from-fasta` and `add-from-gff`
+
+EXAMPLES
+  Upload local file, type auto-detected:
+
+    $ apollo file upload genome.fa > file.json
+```
+
+_See code:
+[src/commands/file/upload.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/file/upload.ts)_
 
 ## `apollo help [COMMANDS]`
 
@@ -52,4 +895,249 @@ DESCRIPTION
 _See code:
 [@oclif/plugin-help](https://github.com/oclif/plugin-help/blob/v6.0.8/src/commands/help.ts)_
 
+## `apollo jbrowse get-config`
+
+Get JBrowse configuration from Apollo
+
+```
+USAGE
+  $ apollo jbrowse get-config [--profile <value>] [--config-file <value>]
+
+FLAGS
+  --config-file=<value>  Use this config file (mostly for testing)
+  --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get JBrowse configuration from Apollo
+
+  Print to stdout the JBrowse configuration from Apollo in JSON format
+
+EXAMPLES
+  Get JBrowse configuration:
+
+    $ apollo jbrowse get-config > config.json
+```
+
+_See code:
+[src/commands/jbrowse/get-config.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/jbrowse/get-config.ts)_
+
+## `apollo jbrowse set-config INPUTFILE`
+
+Set JBrowse configuration
+
+```
+USAGE
+  $ apollo jbrowse set-config INPUTFILE [--profile <value>] [--config-file <value>]
+
+ARGUMENTS
+  INPUTFILE  JBrowse configuration file
+
+FLAGS
+  --config-file=<value>  Use this config file (mostly for testing)
+  --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Set JBrowse configuration
+
+  Set JBrowse configuration in Apollo collaboration server
+
+EXAMPLES
+  Add JBrowse configuration:
+
+    $ apollo jbrowse set-config config.json
+```
+
+_See code:
+[src/commands/jbrowse/set-config.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/jbrowse/set-config.ts)_
+
+## `apollo login`
+
+Login to Apollo
+
+```
+USAGE
+  $ apollo login [--profile <value>] [--config-file <value>] [-a <value>] [-u <value>] [-p <value>] [-f]
+    [--port <value>]
+
+FLAGS
+  -a, --address=<value>      Address of Apollo server
+  -f, --force                Force re-authentication even if user is already logged in
+  -p, --password=<value>     Password for <username>
+  -u, --username=<value>     Username for root login
+      --config-file=<value>  Use this config file (mostly for testing)
+      --port=<value>         [default: 3000] Get token by listening to this port number (usually this is >= 1024 and <
+                             65536)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Login to Apollo
+
+  Use the provided credentials to obtain and save the token to access Apollo. Once the token for the given profile has
+  been saved in the configuration file, users do not normally need to execute this command again unless the token has
+  expired. To setup a new profile use "apollo config"
+
+EXAMPLES
+  The most basic and probably most typical usage is to login using the default profile in configuration file:
+
+    $ apollo login
+
+  Login with a different profile:
+
+    $ apollo login --profile my-profile
+```
+
+_See code:
+[src/commands/login.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/login.ts)_
+
+## `apollo logout`
+
+Logout of Apollo
+
+```
+USAGE
+  $ apollo logout [--profile <value>] [--config-file <value>]
+
+FLAGS
+  --config-file=<value>  Use this config file (mostly for testing)
+  --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Logout of Apollo
+
+  Logout by removing the access token from the selected profile
+
+EXAMPLES
+  Logout default profile:
+
+    $ apollo logout
+
+  Logout selected profile
+
+    $ apollo logout --profile my-profile
+```
+
+_See code:
+[src/commands/logout.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/logout.ts)_
+
+## `apollo refseq add-alias INPUT-FILE`
+
+Add reference name aliases from a file
+
+```
+USAGE
+  $ apollo refseq add-alias INPUT-FILE -a <value> [--profile <value>] [--config-file <value>]
+
+ARGUMENTS
+  INPUT-FILE  Input refname alias file
+
+FLAGS
+  -a, --assembly=<value>     (required) Name for this assembly.
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Add reference name aliases from a file
+
+  Reference name aliasing is a process to make chromosomes that are named slightly differently but which refer to the
+  same thing render properly. This command reads a file with reference name aliases and adds them to the database.
+
+EXAMPLES
+  Add reference name aliases:
+
+    $ apollo refseq add-alias alias.txt -a myAssembly
+```
+
+_See code:
+[src/commands/refseq/add-alias.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/refseq/add-alias.ts)_
+
+## `apollo refseq get`
+
+Get reference sequences
+
+```
+USAGE
+  $ apollo refseq get [--profile <value>] [--config-file <value>] [-a <value>]
+
+FLAGS
+  -a, --assembly=<value>...  Get reference sequences for these assembly names or IDs; use - to read it from stdin
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get reference sequences
+
+  Output the reference sequences in one or more assemblies in json format. This command returns the sequence
+  characteristics (e.g., name, ID, etc), not the DNA sequences. Use `assembly sequence` for that.
+
+EXAMPLES
+  All sequences in the database:
+
+    $ apollo refseq get
+
+  Only sequences for these assemblies:
+
+    $ apollo refseq get -a mm9 mm10
+```
+
+_See code:
+[src/commands/refseq/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/refseq/get.ts)_
+
+## `apollo status`
+
+View authentication status
+
+```
+USAGE
+  $ apollo status [--profile <value>] [--config-file <value>]
+
+FLAGS
+  --config-file=<value>  Use this config file (mostly for testing)
+  --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  View authentication status
+
+  This command returns "<profile>: Logged in" if the selected profile has an access token and "<profile>: Logged out"
+  otherwise.Note that this command does not check the validity of the access token.
+```
+
+_See code:
+[src/commands/status.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/status.ts)_
+
+## `apollo user get`
+
+Get list of users
+
+```
+USAGE
+  $ apollo user get [--profile <value>] [--config-file <value>] [-u <value>] [-r <value>]
+
+FLAGS
+  -r, --role=<value>         Get users with this role
+  -u, --username=<value>     Find this username
+      --config-file=<value>  Use this config file (mostly for testing)
+      --profile=<value>      Use credentials from this profile
+
+DESCRIPTION
+  Get list of users
+
+  If set, filters username and role must be both satisfied to return an entry
+
+EXAMPLES
+  By username:
+
+    $ apollo user get -u Guest
+
+  By role:
+
+    $ apollo user get -r admin
+
+  Use jq for more control:
+
+    $ apollo user get | jq '.[] | select(.createdAt > "2024-03-18")'
+```
+
+_See code:
+[src/commands/user/get.ts](https://github.com/GMOD/Apollo3/blob/v0.1.20/packages/apollo-cli/src/commands/user/get.ts)_
+
 <!-- commandsstop -->
diff --git a/packages/apollo-cli/src/commands/assembly/add-from-gff.ts b/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
index acbb0713..1eede29b 100644
--- a/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
+++ b/packages/apollo-cli/src/commands/assembly/add-from-gff.ts
@@ -6,6 +6,11 @@ import { ObjectId } from 'bson'
 
 import { FileCommand } from '../../fileCommand.js'
 import { submitAssembly } from '../../utils.js'
+import type {
+  SerializedAddAssemblyAndFeaturesFromFileChange,
+  SerializedAddAssemblyFromExternalChange,
+  SerializedAddAssemblyFromFileChange,
+} from '@apollo-annotation/shared'
 
 export default class AddGff extends FileCommand {
   static summary = 'Add new assembly from gff or gft file'
@@ -63,19 +68,24 @@ export default class AddGff extends FileCommand {
       args['input-file'].endsWith('.gz'),
     )
 
-    let typeName = 'AddAssemblyAndFeaturesFromFileChange'
-    if (flags['omit-features']) {
-      typeName = 'AddAssemblyFromFileChange'
-    }
-
     const assemblyName = flags.assembly ?? path.basename(args['input-file'])
 
-    const body = {
-      assemblyName,
-      fileIds: { fa: fileId },
-      typeName,
-      assembly: new ObjectId().toHexString(),
-    }
+    const body:
+      | SerializedAddAssemblyFromFileChange
+      | SerializedAddAssemblyFromExternalChange
+      | SerializedAddAssemblyAndFeaturesFromFileChange = flags['omit-features']
+      ? {
+          assemblyName,
+          fileIds: { fa: fileId },
+          typeName: 'AddAssemblyFromFileChange',
+          assembly: new ObjectId().toHexString(),
+        }
+      : {
+          assemblyName,
+          fileIds: { fa: fileId },
+          typeName: 'AddAssemblyAndFeaturesFromFileChange',
+          assembly: new ObjectId().toHexString(),
+        }
     const rec = await submitAssembly(
       access.address,
       access.accessToken,
diff --git a/packages/apollo-cli/src/utils.ts b/packages/apollo-cli/src/utils.ts
index 4f50a7af..897dd574 100644
--- a/packages/apollo-cli/src/utils.ts
+++ b/packages/apollo-cli/src/utils.ts
@@ -3,10 +3,11 @@ import EventEmitter from 'node:events'
 import * as fs from 'node:fs'
 import { stdin, stderr } from 'node:process'
 
-import {
+import type {
+  SerializedAddAssemblyAndFeaturesFromFileChange,
   SerializedAddAssemblyFromExternalChange,
   SerializedAddAssemblyFromFileChange,
-  type SerializedDeleteAssemblyChange,
+  SerializedDeleteAssemblyChange,
 } from '@apollo-annotation/shared'
 
 import { Agent, RequestInit, Response, fetch } from 'undici'
@@ -362,7 +363,8 @@ export async function submitAssembly(
   accessToken: string,
   body:
     | SerializedAddAssemblyFromFileChange
-    | SerializedAddAssemblyFromExternalChange,
+    | SerializedAddAssemblyFromExternalChange
+    | SerializedAddAssemblyAndFeaturesFromFileChange,
   force: boolean,
 ): Promise<object> {
   let assemblies = await queryApollo(address, accessToken, 'assemblies')
diff --git a/packages/apollo-cli/test/test.py b/packages/apollo-cli/test/test.py
index e0436d3b..6cd28de7 100755
--- a/packages/apollo-cli/test/test.py
+++ b/packages/apollo-cli/test/test.py
@@ -105,9 +105,9 @@ def testFeatureGet(self):
         self.assertTrue("returned 0 assemblies" in p.stderr)
 
     def testAssemblyGet(self):
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv2 -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv3 -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv2 -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv3 -e -f")
         p = shell(f"{apollo} assembly get {P}")
         self.assertTrue("vv1" in p.stdout)
         self.assertTrue("vv2" in p.stdout)
@@ -257,7 +257,7 @@ def testAddAssemblyLargeInput(self):
                 i += 1
 
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -f",
+            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -e -f",
             timeout=60,
         )
         shell(
@@ -266,7 +266,7 @@ def testAddAssemblyLargeInput(self):
             timeout=60,
         )
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -f",
+            f"{apollo} assembly add-from-fasta {P} test_data/tmp.fa -a test -e -f",
             timeout=60,
         )
 
@@ -274,7 +274,7 @@ def testAddAssemblyLargeInput(self):
 
     def testAddAssemblyFromLocalFasta(self):
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e -f"
         )
         out = json.loads(p.stdout)
         self.assertTrue("fa" in out["fileIds"].keys())
@@ -282,18 +282,18 @@ def testAddAssemblyFromLocalFasta(self):
         p = shell(f"{apollo} assembly get {P} -a vv1")
         self.assertTrue("vv1" in p.stdout)
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1",
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
         self.assertTrue('Error: Assembly "vv1" already exists' in p.stderr)
 
-        p = shell(f"{apollo} assembly add-from-fasta {P} na.fa -a vv1 -f", strict=False)
+        p = shell(f"{apollo} assembly add-from-fasta {P} na.fa -a vv1 -e -f", strict=False)
         self.assertTrue(p.returncode != 0)
         self.assertTrue("Input" in p.stderr)
 
         # Test default name
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -e -f")
         p = shell(f"{apollo} assembly get {P} -a tiny.fasta")
         self.assertTrue("tiny.fasta" in p.stdout)
 
@@ -312,7 +312,7 @@ def testAddAssemblyFromExternalFasta(self):
         self.assertEqual(seq[1], "cattgttgcg")
 
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} -a vv1 -f https://x.fa -x https://x.fai",
+            f"{apollo} assembly add-from-fasta {P} -a vv1 -f https://x.fa.gz --fai https://x.fa.gz.fai --gzi https://x.fa.gz.gzi",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
@@ -617,33 +617,33 @@ def testAddChildFeatures(self):
         self.assertEqual(p.returncode, 0)
 
     def testImportFeatures(self):
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -f")
-        shell(f"{apollo} feature import {P} -i test_data/tiny.fasta.gff3 -a vv1")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a vv1 -e -f")
+        shell(f"{apollo} feature import {P} test_data/tiny.fasta.gff3 -a vv1")
         p = shell(f"{apollo} feature search {P} -a vv1 -t contig")
         out = json.loads(p.stdout)
         self.assertEqual(len(out), 2)
 
         # Import again: Add to existing feature
-        p = shell(f"{apollo} feature import {P} -i test_data/tiny.fasta.gff3 -a vv1")
+        p = shell(f"{apollo} feature import {P} test_data/tiny.fasta.gff3 -a vv1")
         p = shell(f"{apollo} feature search {P} -a vv1 -t contig")
         out = json.loads(p.stdout)
         self.assertEqual(len(out), 4)
 
         # Import again: delete {P} existing
-        p = shell(f"{apollo} feature import {P} -d -i test_data/tiny.fasta.gff3 -a vv1")
+        p = shell(f"{apollo} feature import {P} -d test_data/tiny.fasta.gff3 -a vv1")
         p = shell(f"{apollo} feature search {P} -a vv1 -t contig")
         out = json.loads(p.stdout)
         self.assertEqual(len(out), 2)
 
         p = shell(f"{apollo} assembly delete {P} -a vv2")
         p = shell(
-            f"{apollo} feature import {P} -i test_data/tiny.fasta.gff3 -a vv2",
+            f"{apollo} feature import {P} test_data/tiny.fasta.gff3 -a vv2",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
         self.assertTrue('Assembly "vv2" does not exist' in p.stderr)
 
-        p = shell(f"{apollo} feature import {P} -i foo.gff3 -a vv1", strict=False)
+        p = shell(f"{apollo} feature import {P} foo.gff3 -a vv1", strict=False)
         self.assertTrue(p.returncode != 0)
         self.assertTrue('File "foo.gff3" does not exist' in p.stderr)
 
@@ -651,8 +651,8 @@ def testCopyFeature(self):
         shell(
             f"{apollo} assembly add-from-gff {P} test_data/tiny.fasta.gff3 -a source -f"
         )
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest2 -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a dest2 -e -f")
         p = shell(f"{apollo} feature search {P} -a source -t contig")
         fid = json.loads(p.stdout)[0]["_id"]
 
@@ -697,13 +697,13 @@ def testCopyFeature(self):
 
     def testGetChanges(self):
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a myAssembly -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a myAssembly -e -f"
         )
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a yourAssembly -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a yourAssembly -e -f"
         )
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a ourAssembly -f"
+            f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a ourAssembly -e -f"
         )
 
         p = shell(f"{apollo} change get {P}")
@@ -725,8 +725,8 @@ def testGetChanges(self):
         self.assertEqual(len(out), 0)
 
     def testGetSequence(self):
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v1 -f")
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v2 -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v1 -e -f")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta -a v2 -e -f")
 
         p = shell(f"{apollo} assembly sequence {P} -a nonExistant", strict=False)
         self.assertTrue(p.returncode != 0)
@@ -798,7 +798,8 @@ def testAssemblyChecks(self):
 
         # Test view checks set for assembly
         p = shell(f"{apollo} assembly check {P} -a v1")
-        self.assertEqual(p.stdout.strip(), "[]")
+        out = json.loads(p.stdout)
+        self.assertEqual(len(out), 1)
 
         # Test non-existant assembly
         p = shell(f"{apollo} assembly check {P} -a non-existant", strict=False)
@@ -836,25 +837,6 @@ def testFeatureChecks(self):
         shell(f"{apollo} assembly add-from-gff {P} test_data/tiny.fasta.gff3 -a v1 -f")
         shell(f"{apollo} assembly check {P} -a v1 -c CDSCheck")
         p = shell(f"{apollo} feature check {P} -a v1")
-        ## If we don't edit a feature, checks are not activated (!?)
-        self.assertEqual(p.stdout.strip(), "[]")
-
-        p = shell(f"{apollo} feature get {P} -a v1")
-        ff = json.loads(p.stdout)
-        g1 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["MyGene"]
-        ][0]
-        g2 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["AnotherGene"]
-        ][0]
-
-        shell(f"{apollo} feature edit-coords {P} -i {g1['_id']} -e 201")
-        shell(f"{apollo} feature edit-coords {P} -i {g2['_id']} -e 251")
-        p = shell(f"{apollo} feature check {P} -a v1")
         out = json.loads(p.stdout)
         self.assertTrue(len(out) > 1)
         self.assertTrue("InternalStopCodonCheck" in p.stdout)
@@ -872,30 +854,10 @@ def testFeatureChecks(self):
 
     def testFeatureChecksIndexed(self):
         shell(
-            f"{apollo} assembly add-from-fasta {P} -a v1 test_data/tiny.fasta.gz --not-editable -f"
+            f"{apollo} assembly add-from-fasta {P} -a v1 test_data/tiny.fasta.gz -f"
         )
-        shell(f"{apollo} feature import {P} -a v1 -i test_data/tiny.fasta.gff3 -d")
-        # shell(f"{apollo} assembly add-from-gff {P} test_data/tiny.fasta.gff3 -a v1 -f")
         shell(f"{apollo} assembly check {P} -a v1 -c CDSCheck")
-        p = shell(f"{apollo} feature check {P} -a v1")
-        ## If we don't edit a feature, checks are not activated (!?)
-        self.assertEqual(p.stdout.strip(), "[]")
-
-        p = shell(f"{apollo} feature get {P} -a v1")
-        ff = json.loads(p.stdout)
-        g1 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["MyGene"]
-        ][0]
-        g2 = [
-            x
-            for x in ff
-            if x["type"] == "gene" and x["attributes"]["gff_id"] == ["AnotherGene"]
-        ][0]
-
-        shell(f"{apollo} feature edit-coords {P} -i {g1['_id']} -e 201")
-        shell(f"{apollo} feature edit-coords {P} -i {g2['_id']} -e 251")
+        shell(f"{apollo} feature import {P} -a v1 test_data/tiny.fasta.gff3 -d")
         p = shell(f"{apollo} feature check {P} -a v1")
         out = json.loads(p.stdout)
         self.assertTrue(len(out) > 1)
@@ -992,13 +954,13 @@ def testRefNameAliasConfiguration(self):
         asm_id = json.loads(p.stdout)[0]["_id"]
 
         p = shell(
-            f"{apollo} refseq add-alias {P} -i test_data/alias.txt -a asm2",
+            f"{apollo} refseq add-alias {P} test_data/alias.txt -a asm2",
             strict=False,
         )
         self.assertTrue("Assembly asm2 not found" in p.stderr)
 
         p = shell(
-            f"{apollo} refseq add-alias {P} -i test_data/alias.txt -a asm1",
+            f"{apollo} refseq add-alias {P} test_data/alias.txt -a asm1",
             strict=False,
         )
         self.assertTrue(
@@ -1029,23 +991,23 @@ def testLogin(self):
         # This should be ok
         shell(f"{apollo} login {P} --force", timeout=5, strict=True)
     def testFileUpload(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         out = json.loads(p.stdout)
         self.assertEqual("text/x-fasta", out["type"])
         self.assertTrue(out["_id"])
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         out = json.loads(p.stdout)
         self.assertEqual("text/x-fasta", out["type"])
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gff3")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gff3")
         out = json.loads(p.stdout)
         self.assertEqual("text/x-gff3", out["type"])
 
-        p = shell(f"{apollo} file upload {P} -i test_data/guest.yaml", strict=False)
+        p = shell(f"{apollo} file upload {P} test_data/guest.yaml", strict=False)
         self.assertTrue(p.returncode != 0)
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gz", strict=False)
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gz", strict=False)
         self.assertTrue("it may be gzip or bgzip compressed" in p.stderr)
         self.assertTrue(p.returncode != 0)
 
@@ -1054,15 +1016,15 @@ def testFileUploadGzip(self):
         with open("test_data/tiny.fasta.gz", "rb") as gz:
             md5 = hashlib.md5(gz.read()).hexdigest()
         p = shell(
-            f"{apollo} file upload {P} -i test_data/tiny.fasta.gz -t text/x-fasta"
+            f"{apollo} file upload {P} test_data/tiny.fasta.gz -t text/x-fasta"
         )
         out = json.loads(p.stdout)
         self.assertEqual(md5, out["checksum"])
-        shell(f"{apollo} assembly add-from-fasta {P} -f {out['_id']}")
+        shell(f"{apollo} assembly add-from-fasta {P} -e -f {out['_id']}")
 
     def testAddAssemblyGzip(self):
         # Autodetect format
-        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta.gz -f -a vv1")
+        shell(f"{apollo} assembly add-from-fasta {P} test_data/tiny.fasta.gz -e -f -a vv1")
         p = shell(f"{apollo} assembly sequence {P} -a vv1")
         self.assertTrue(p.stdout.startswith(">"))
         self.assertTrue("cattgttgcggagttgaaca" in p.stdout)
@@ -1070,7 +1032,7 @@ def testAddAssemblyGzip(self):
         # Skip autodetect
         shutil.copy("test_data/tiny.fasta", "test_data/tmp.gz")
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/tmp.gz -f -a vv1 --decompressed"
+            f"{apollo} assembly add-from-fasta {P} test_data/tmp.gz -e -f -a vv1 --decompressed"
         )
         p = shell(f"{apollo} assembly sequence {P} -a vv1")
         self.assertTrue(p.stdout.startswith(">"))
@@ -1079,7 +1041,7 @@ def testAddAssemblyGzip(self):
 
         shutil.copy("test_data/tiny.fasta.gz", "test_data/fasta.tmp")
         shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -f -a vv1 --gzip"
+            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -e -f -a vv1 --gzip"
         )
         p = shell(f"{apollo} assembly sequence {P} -a vv1")
         self.assertTrue(p.stdout.startswith(">"))
@@ -1087,7 +1049,7 @@ def testAddAssemblyGzip(self):
 
         # Autodetect false positive
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -f -a vv1",
+            f"{apollo} assembly add-from-fasta {P} test_data/fasta.tmp -e -f -a vv1",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
@@ -1096,21 +1058,21 @@ def testAddAssemblyGzip(self):
     def testAddAssemblyFromFilesNotEditable(self):
         # It would be good to check that really there was no sequence loading
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable test_data/tiny.fasta.gz"
+            f"{apollo} assembly add-from-fasta {P} -f test_data/tiny.fasta.gz"
         )
         p = shell(f"{apollo} assembly sequence {P} -a tiny.fasta.gz")
         self.assertTrue(p.stdout.startswith(">"))
         self.assertTrue("cattgttgcggagttgaaca" in p.stdout)
 
         p = shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable test_data/tiny.fasta",
+            f"{apollo} assembly add-from-fasta {P} -f test_data/tiny.fasta",
             strict=False,
         )
         self.assertTrue(p.returncode != 0)
 
         # Setting --gzi & --fai
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable test_data/tiny2.fasta.gz --gzi test_data/tiny.fasta.gz.gzi --fai test_data/tiny.fasta.gz.fai"
+            f"{apollo} assembly add-from-fasta {P} -f test_data/tiny2.fasta.gz --gzi test_data/tiny.fasta.gz.gzi --fai test_data/tiny.fasta.gz.fai"
         )
         p = shell(f"{apollo} assembly sequence {P} -a tiny2.fasta.gz")
         self.assertTrue(p.stdout.startswith(">"))
@@ -1119,48 +1081,48 @@ def testAddAssemblyFromFilesNotEditable(self):
     def testAddAssemblyFromFileIdsNotEditable(self):
         # Upload and get Ids for: bgzip fasta, fai and gzi
         p = shell(
-            f"{apollo} file upload {P} -i test_data/tiny.fasta.gz -t application/x-bgzip-fasta"
+            f"{apollo} file upload {P} test_data/tiny.fasta.gz -t application/x-bgzip-fasta"
         )
         fastaId = json.loads(p.stdout)["_id"]
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gz.fai")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gz.fai")
         faiId = json.loads(p.stdout)["_id"]
 
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta.gz.gzi")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta.gz.gzi")
         gziId = json.loads(p.stdout)["_id"]
 
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable {fastaId} --fai test_data/tiny.fasta.gz.fai --gzi test_data/tiny.fasta.gz.gzi"
+            f"{apollo} assembly add-from-fasta {P} -f {fastaId} --fai test_data/tiny.fasta.gz.fai --gzi test_data/tiny.fasta.gz.gzi"
         )
         p = shell(f"{apollo} assembly sequence {P} -a {fastaId}")
         self.assertTrue(p.stdout.startswith(">"))
         self.assertTrue("cattgttgcggagttgaaca" in p.stdout)
 
         shell(
-            f"{apollo} assembly add-from-fasta {P} -f --not-editable {fastaId} --fai {faiId} --gzi {gziId}"
+            f"{apollo} assembly add-from-fasta {P} -f {fastaId} --fai {faiId} --gzi {gziId}"
         )
         p = shell(f"{apollo} assembly sequence {P} -a {fastaId}")
         self.assertTrue(p.stdout.startswith(">"))
 
     def testAddAssemblyFromFileId(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         fid = json.loads(p.stdout)["_id"]
-        p = shell(f"{apollo} assembly add-from-fasta {P} {fid} -a up -f")
+        p = shell(f"{apollo} assembly add-from-fasta {P} {fid} -a up -e -f")
         out = json.loads(p.stdout)
         self.assertEqual("up", out["name"])
         self.assertEqual(fid, out["fileIds"]["fa"])
 
         # shell(f"{apollo} assembly delete {P} -a up")
         # shell(
-        #     f"{apollo} file upload {P} -i test_data/tiny.fasta | {apollo} assembly add-from-fasta {P} -a up -f"
+        #     f"{apollo} file upload {P} test_data/tiny.fasta | {apollo} assembly add-from-fasta {P} -a up -e -f"
         # )
         # p = shell(f"{apollo} assembly get {P} -a up")
         # out = json.loads(p.stdout)
         # self.assertEqual("up", out[0]["name"])
 
     def testGetFiles(self):
-        shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        shell(f"{apollo} file upload {P} test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         fid = json.loads(p.stdout)["_id"]
 
         p = shell(f"{apollo} file get {P}")
@@ -1177,7 +1139,7 @@ def testGetFiles(self):
         self.assertEqual(0, len(out))
 
     def testDownloadFile(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         up = json.loads(p.stdout)
         if os.path.exists(up["basename"]):
             raise Exception(
@@ -1203,9 +1165,9 @@ def testDownloadFile(self):
         self.assertTrue(p.stdout.strip().endswith("accc"))
 
     def testDeleteFile(self):
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         up1 = json.loads(p.stdout)
-        p = shell(f"{apollo} file upload {P} -i test_data/tiny.fasta")
+        p = shell(f"{apollo} file upload {P} test_data/tiny.fasta")
         up2 = json.loads(p.stdout)
 
         p = shell(f"{apollo} file delete {P} -i {up1['_id']} {up2['_id']}")
diff --git a/packages/website/docs/cli/assembly.md b/packages/website/docs/cli/assembly.md
index ad29d11a..e1771b6b 100644
--- a/packages/website/docs/cli/assembly.md
+++ b/packages/website/docs/cli/assembly.md
@@ -15,21 +15,20 @@ Add a new assembly from fasta input
 
 ```
 USAGE
-  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-x <value>] [-f] [-n]
-    [--fai <value>] [--gzi <value>] [-z | -d]
+  $ apollo assembly add-from-fasta INPUT [--profile <value>] [--config-file <value>] [-a <value>] [-f] [-e] [--fai <value>]
+    [--gzi <value>] [-z | -d]
 
 ARGUMENTS
-  INPUT  Input fasta file, local or remote, or id of a previously uploaded file
+  INPUT  Input fasta file, local or remote, or id of a previously uploaded file. For local or remote files, it is
+         assumed the file is bgzip'd with `bgzip` and indexed with `samtools faidx`. The indexes are assumed to be at
+         <my.fasta.gz>.fai and <my.fasta.gz>.gzi unless the options --fai and --gzi are provided.
 
 FLAGS
   -a, --assembly=<value>     Name for this assembly. Use the file name if omitted
   -d, --decompressed         For local file input: Override autodetection and instruct that input is decompressed
+  -e, --editable             Instead of using indexed fasta lookup, the sequence is loaded into the Apollo database and
+                             is editable. Use with caution, as editing the sequence often has unintended side effects.
   -f, --force                Delete existing assembly, if it exists
-  -n, --not-editable         The fasta sequence is not editable. Apollo will not load it into the database and instead
-                             use the provided indexes to query it. This option assumes the fasta file is bgzip'd with
-                             `bgzip` and indexed with `samtools faidx`. Indexes should be named <my.fasta.gz>.gzi and
-                             <my.fasta.gz>.fai unless options --fai and --gzi are set
-  -x, --index=<value>        URL of the index. Required if input is an external source
   -z, --gzip                 For local file input: Override autodetection and instruct that input is gzip compressed
       --config-file=<value>  Use this config file (mostly for testing)
       --fai=<value>          Fasta index of the (not-editable) fasta file