Skip to content

Latest commit

 

History

History
289 lines (229 loc) · 7.17 KB

README.md

File metadata and controls

289 lines (229 loc) · 7.17 KB

Pangenome Heritability Tool

A Python tool for processing pangenome structural variants and generating PLINK format files. This tool helps analyze structural variants in pangenomes by performing sequence alignment, k-mer window analysis, and converting results to PLINK format.

Features

  • Process VCF files containing structural variants
  • Align variant sequences using MUSCLE
  • K-mer based variant quantification
  • Generate PLINK format files (ped/map/bfile)
  • Parallel processing support
  • Progress tracking and logging

Quick Start

Installation with Conda (Recommended)

# Create environment
conda create -n panherit python=3.8
conda activate panherit

# Install panherit
git clone https://github.com/PeixiongYuan/pangenome_heritability.git
cd pangenome_heritability
conda install -c conda-forge pandas numpy biopython click tqdm
pip install -e .

# Install MUSCLE and PLINK
mkdir -p ~/local/bin
cd ~/local/bin
wget https://github.com/rcedgar/muscle/releases/download/v5.3/muscle-linux-x86.v5.3
wget https://s3.amazonaws.com/plink1-assets/plink_linux_x86_64_20230116.zip
unzip plink_linux_x86_64_20230116.zip
chmod +x muscle-linux-x86.v5.3
mv muscle-linux-x86.v5.3 muscle
chmod +x plink
echo 'export PATH="$HOME/local/bin:$PATH"' >> ~/.bashrc
source ~/.bashrc

# Install MAFFT
conda install conda-forge::mafft

Usage Guide

The Pangenome Heritability Tool provides several commands to process variants, perform alignments, and generate PLINK files. Each step can be run independently or as part of a pipeline.

Command Overview

The tool provides four main commands:

  • process-vcf: Process VCF file and group overlapping variants
  • run-alignments: Perform sequence alignments using MUSCLE
  • process-kmers: Generate and analyze k-mer windows
  • convert-to-plink: Convert results to PLINK format
  • run-all: Run the entire workflow in one command

Note

Important: The VCF and reference FASTA files must use numeric chromosome identifiers (e.g., 1, 2, 3 for chromosomes) without additional prefixes or suffixes. Ensure your files adhere to this convention to avoid processing errors.

Example of a VCF File Header:

##source=YourTool
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO
1       12345   rs123   A       T       50      PASS    .
2       67890   rs456   G       C       99      PASS    .

Example of a FASTA File:

>1
AGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAG
>2
TGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATG

Quickly Usage

panherit run-all \
    --vcf input.vcf \
    --ref reference.fasta \
    --out output_directory \
    --window-size 4 \
    --threads 4

Options:

  • --vcf: Input VCF file containing structural variants
  • --ref: Reference genome FASTA file
  • --out: Output directory for processed variants and FASTA files
  • --window-size: Size of k-mer windows (default: 4)
  • --threads: Number of parallel threads (default: 1)

Detailed Usage

Step 1: Process VCF File

# Process VCF and generate FASTA sequences
panherit process-vcf \
    --vcf input.vcf \
    --ref reference.fasta \
    --out output_directory

Options:

  • --vcf: Input VCF file containing structural variants
  • --ref: Reference genome FASTA file
  • --out: Output directory for processed variants and FASTA files

Step 2: Run Alignments

# Perform sequence alignments
panherit run-alignments \
    --grouped-variants output_directory/variants.fasta \
    --ref reference.fasta \
    --out alignments_directory \
    --threads 4

Options:

  • --grouped-variants: FASTA file from previous step
  • --ref: Reference genome FASTA file
  • --out: Output directory for alignments
  • --threads: Number of parallel threads (default: 1)

Step 3: Process K-mer Windows

# Process k-mer windows
panherit process-kmers \
    --alignments temp_alignments \
    --window-size 4 \
    --out kmers_directory

Options:

  • --alignments: Directory containing alignment results
  • --window-size: Size of k-mer windows (default: 4)
  • --out: Output directory for k-mer results

Step 4: Convert to PLINK

# Generate PLINK files
panherit convert-to-plink \
    --kmer-results kmers_directory \
    --grouped-variants output_directory/variants.fasta \ 
    --out plink_files

Options:

  • --kmer-results: Directory containing k-mer analysis results
  • --grouped-variants: FASTA file from previous step
  • --out: Output directory for PLINK files

Output Files

Each step produces specific output files:

Process VCF

output_directory/
├── variants.fasta      # Grouped variant sequences
└── variants.log       # Processing log file

Alignments

/path/to/output/
├── temp_alignments/
│   ├── Group_2_59_input.fasta
│   ├── Group_2_59_aligned.fasta
├── error_logs/
│   ├── Group_2_59_input_error.log

K-mer Windows

kmers_directory/
├── windows.csv       # K-mer window analysis
└── comparison.log    # Processing log file

PLINK Files

plink_files/
├── variants.bed      # Binary genotype file
├── variants.bim      # Variant information file
└── variants.fam      # Sample information file

Example Pipeline

Complete pipeline example:

# 1. Process VCF
panherit process-vcf \
    --vcf input.vcf \
    --ref reference.fasta \
    --out step1_output

# 2. Run alignments
panherit run-alignments \
    --grouped-variants step1_output/variants.fasta \
    --ref reference.fasta \
    --out step2_output \
    --threads 4

# 3. Process k-mers
panherit process-kmers \
    --alignments step2_output \
    --window-size 4 \
    --out step3_output

# 4. Generate PLINK files
panherit convert-to-plink \
    --kmer-results step3_output \
    --out final_output

Notes

  • Each command will create its output directory if it doesn't exist
  • Log files are generated for each step
  • Use --help with any command for detailed options
  • For large datasets, adjust thread count based on available resources

Error Handling

If any step fails, the tool will:

  1. Display an error message
  2. Log the error details
  3. Exit with a non-zero status code

Example error checking:

panherit process-vcf --vcf input.vcf --ref ref.fa --out output || {
    echo "VCF processing failed"
    exit 1
}

Documentation

Requirements

  • Python 3.8+
  • MUSCLE 5
  • MAFFT V7.526
  • PLINK 1.90
  • External dependencies:
    • pandas
    • numpy
    • biopython
    • click
    • tqdm

Performance Tips

  1. Adjust thread count based on available CPU cores
  2. Ensure sufficient disk space for temporary files

Troubleshooting

Common issues and solutions are documented in our troubleshooting guide.

Contributing

Contributions are welcome! Please read our contributing guidelines.

License

This project is licensed under the MIT License - see the LICENSE file for details.

Citation

If you use this tool in your research, please cite:

[Citation information to be added]

Contact

For questions and support: