Skip to content

Latest commit

 

History

History
657 lines (549 loc) · 32.4 KB

sm6_RNAseq_preprocessing.md

File metadata and controls

657 lines (549 loc) · 32.4 KB

STAT540 - Seminar 6: RNA-seq preprocessing - BAM files to count tables

Attributions

This seminar was developed by Keegan Korthauer

Overview

This seminar focuses on a portion of the upstream preprocessing of RNA-seq: going from aligned reads (BAM files) to count tables that will be used in differential expression analysis. Note that we are skipping the step of going from raw reads (fastq files) to aligned reads (BAM files), as this is outside the scope of this course. Refer to the lecture materials on High-dimensional genomics assays & data for high-level details and resources.

In order to use RNA-Seq data for the purposes of differential expression analysis, we need to obtain an expression value for each gene (or transcript). The digital nature of RNA-seq data allows us to use the number of reads (an integer count) which align to a specific feature (gene or transcript) as its expression value. In this seminar, we will explore how to use BAM (or SAM) files to generate a count table of reads aligning to the human transcriptome.

By the end of this seminar, you should be able to:

  • use the Rsamtools package to sort and index a BAM file
  • use the Rsubread package to count the number of reads that align to each gene/transcript
  • extract raw counts from the output of featureCounts, and calculate normalized expression units using the cpm() and rpkm() functions in edgeR

Loading libraries

Before we begin, we’ll need to load the necessary R packages for this seminar. It is likely you don’t already have all of these installed on your machine unless you’ve done a similar analysis in the past. If this is the case, you’ll need to run this code chunk to install them (currently set to eval = FALSE):

library(BiocManager)
install(c("Rsamtools", "Rsubread", "RNAseqData.HNRNPC.bam.chr14", "edgeR"))

After they are successfully installed, we’ll load them for use in our session.

library(Rsamtools)
library(Rsubread)
library(RNAseqData.HNRNPC.bam.chr14)
library(ggplot2)
theme_set(theme_bw())
library(dplyr)
library(edgeR)
library(testthat)

BAM/SAM - Aligned Sequence data format

SAM (sequence alignment map) and BAM (the binary version of SAM) files are the preferred output of most alignment tools. SAM and BAM files carry the same information. The only difference is that SAM is human readable, meaning that you can visually inspect each of the reads. You can learn more about the SAM file format here.

The Rsamtools package is one of many software tools that have been developed for working with SAM/BAM alignment files - it is an R implementation of the widely used command line tool Samtools. The Rsubread package is a tool that summarizes SAM/BAM files into count tables - it is an R implementation of the command line program Subread which has tools for alignment and quantification. The tool we’ll use within Subread is the featureCounts tool.

Although you could use the standalone command line versions of both of these tools, to make things as convenient as possible, we’ll use the R implementations and run today’s seminar entirely within R.

HeLa cell line transcription

The alignment BAM file we will be working with was created by aligning raw reads from an RNA-seq experiment of HNRNPC gene knockdown cell line and control HeLa cells (Zarnack et al. 2012). We will specifically work with one of the control HeLa cell samples. HeLa cells are immortalized cervical cancer cells derived taken from cancer patient Henrietta Lacks in 1951. Henrietta Lacks was a 31-year-old African-American mother of five and a patient at Johns Hopkins Hospital. She died from cervical cancer on October 4, 1951. Her cells were taken from her without her knowledge or consent, and the HeLa cell line is now the oldest and most used immortal cell line in scientific research. To read more about Henrietta’s legacy and the ethical issues involved in procuring and using her cells, read The Immortal Life of Henrietta Lacks.

In this tutorial, we are working with an already aligned BAM file, but the raw reads (fastq files) from this experiment are available in the European Nucleotide Archive.

RNA-seq upstream analysis pipeline

In this tutorial we will only be dealing with a portion of the RNA-seq analysis pipeline. Here is an overview of the entire pipeline (image source: Yang & Kim 2015). Note that this figure is simplistic in its depiction of downstream analysis - differential expression is not the only downstream analysis in typical experiments. For example, we’ll learn about things like gene network and enrichment analyses, clustering, and supervised learning later in the course.

Typical workflow for RNA sequencing data analysis (Yang & Kim 2015)

Typical workflow for RNA sequencing data analysis (Yang & Kim 2015)

As you can see, there are many steps to go from the raw reads to the aligned bam files (red to light blue). These have been done for us in this example, as we are making use of the aligned data in the Bioconductor package RNAseqData.HNRNPC.bam.chr14. Briefly, this package has preprocessed the data from Zarnack et al. 2012. The reads (paired-end) were aligned to the full human genome (version hg19) with TopHat2. In addition, the data have been subset to only include reads mapped to Chromosome 14. This will reduce the computational time for our tutorial compared to running on the entire genome.

In this tutorial, we are only going to deal with the dark blue box: “Expression Quantification”. Specifically, we are going to learn how to convert a SAM/BAM alignment file to a count table that can be used for differential expression analysis. Along the way, we will learn more about the SAM and BAM files.

Viewing BAM files

The first thing we are going to do is look at the alignment file, so we can learn more about the structure of BAM/SAM files. Since we’re not downloading the BAM file directly, but instead using a BAM file included in the RNAseqData.HNRNPC.bam.chr14 package files, we first need to find out the file location of where the BAM file is stored. From the package documentation, we learn that the file names are stored in the object RNAseqData.HNRNPC.bam.chr14_BAMFILES.

RNAseqData.HNRNPC.bam.chr14_BAMFILES
##                                                                                                                      ERR127306 
## "/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/RNAseqData.HNRNPC.bam.chr14/extdata/ERR127306_chr14.bam" 
##                                                                                                                      ERR127307 
## "/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/RNAseqData.HNRNPC.bam.chr14/extdata/ERR127307_chr14.bam" 
##                                                                                                                      ERR127308 
## "/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/RNAseqData.HNRNPC.bam.chr14/extdata/ERR127308_chr14.bam" 
##                                                                                                                      ERR127309 
## "/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/RNAseqData.HNRNPC.bam.chr14/extdata/ERR127309_chr14.bam" 
##                                                                                                                      ERR127302 
## "/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/RNAseqData.HNRNPC.bam.chr14/extdata/ERR127302_chr14.bam" 
##                                                                                                                      ERR127303 
## "/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/RNAseqData.HNRNPC.bam.chr14/extdata/ERR127303_chr14.bam" 
##                                                                                                                      ERR127304 
## "/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/RNAseqData.HNRNPC.bam.chr14/extdata/ERR127304_chr14.bam" 
##                                                                                                                      ERR127305 
## "/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/RNAseqData.HNRNPC.bam.chr14/extdata/ERR127305_chr14.bam"

We can see we have 8 BAM files. We’ll use sample ERR127306, which we can determine from the data repository is a control HeLa sample.

bamfile <- RNAseqData.HNRNPC.bam.chr14_BAMFILES[grepl("ERR127306",
                                                RNAseqData.HNRNPC.bam.chr14_BAMFILES)]

This file is not human readable, so we are going to convert it into a SAM file, which we can read. The asSam function converts BAM files to SAM files. The argument destination = will specify the name of the newly created SAM file. We’ll save a SAM file to the current working directory.

asSam(bamfile, destination = "hela")
## [1] "hela.sam"

We have created the file “hela.sam”. We’ll take a peek at the top of the header:

cat(system("head hela.sam", intern = TRUE), sep = '\n')
## @HD  VN:1.0  SO:coordinate
## @SQ  SN:chr1 LN:249250621
## @SQ  SN:chr10    LN:135534747
## @SQ  SN:chr11    LN:135006516
## @SQ  SN:chr11_gl000202_random    LN:40103
## @SQ  SN:chr12    LN:133851895
## @SQ  SN:chr13    LN:115169878
## @SQ  SN:chr14    LN:107349540
## @SQ  SN:chr15    LN:102531392
## @SQ  SN:chr16    LN:90354753

This contains information on the format and contents of the file. And at the last few lines of the file, which illustrates some reads and their mapping location, along with lots of extra mysterious-looking information:

cat(system("tail hela.sam", intern = TRUE), sep = '\n')
## ERR127306.10965452   163 chr14   106981278   50  72M =   106981361   155 AAGAAACTTACAGTCATGATGGAAAGGGCAGCAAACACGTACCTCTTCACATGGCTGCAGGAGAGAGAAATG    +++++++++++*++++++++++++++++*+++++++++++++++++++)++++*+*+&+++++*++++*+)*    AS:i:-3 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:69G2   YT:Z:UU NH:i:1
## ERR127306.10965452   83  chr14   106981361   50  72M =   106981278   -155    GGGAGGCCCTTTATATAACCATCAGGTCTTGTGAGAACTCACTCACTAATAGGATAAAAGCATGGAGAGAAC    ##+)+++%+*&+++++++*++)+++++++++++++++)+++*+++++++)++*+%++++*++++++)+++++    AS:i:-3 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:68A3   YT:Z:UU NH:i:1
## ERR127306.11919172   163 chr14   106986423   50  72M =   106986528   177 CGGTGGTGTCCTCAGTGGCCCCTGGTGTCCTGAGCATCCCCTGGTGTCCTGAGTGCCCCCTGGTGGTTGTGA    ++**+++&+++)++)*++++++()*"''''++(+***)++*&**&)'')&'%&%'&'&''!$""%$"$$!!!    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:72 YT:Z:UU NH:i:1
## ERR127306.11919172   83  chr14   106986528   50  72M =   106986423   -177    CCTGAGAGCCCCTTGCTGTCCTGAGCACCTCCTGGTGTTCTGAGCGCCCTCTGGTGTTCTGATCACTCTCTG    &'&)%*&&)(*****+*+**+*+*++))++*++++++++++++++++**+(+++++++++++++++++++++    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:72 YT:Z:UU NH:i:1
## ERR127306.3567919    99  chr14   106989680   50  72M =   106989780   172 CAACTTTTATTTCTTAAACACAAGACATTCCAATGAGAAAGCTGTTCTCAGGTGAGCTGTCGAGCAGGGAGG    ++++++++*+++++++*++++++)++++++++++++++++++++++++++++)+&+)++*++*))*+++)+&    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:72 YT:Z:UU NH:i:1
## ERR127306.3567919    147 chr14   106989780   50  72M =   106989680   -172    GAAATTGCTGAAACTTGAAGACCAAGGCCACCTCTGAGGGGCAGAGATCCACCTATGAGTACATCACATCAG    (+++++++&+++)'*+++++*++++++*+*+++++++++++++++++)++++++*+++++++++++++++++    AS:i:-3 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:62G9   YT:Z:UU NH:i:1
## ERR127306.21510817   99  chr14   106994763   50  72M =   106994819   128 CAAAGCTGGATGTGTCTAGTGTTTTTATCAGAACCCACTTTCCGTAATAAGAGCATGTGTGGTTTTGCTGCC    ++++++++++++++++++*+)++++++++++++++++++++++++++++*+*++*++)+*+(*++***+**+    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:72 YT:Z:UU NH:i:1
## ERR127306.21510817   147 chr14   106994819   50  72M =   106994763   -128    GTGTGGTTTTGCTGCCCTCCAGCACTCTTCTGAAAATATGGAGAGAACTAGGATCCAGGCACATTAATTTTC    +%++*+*(**++++**+&++*++)+++++++++++++++++++++++*++++++++++++++++++++++++    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:72 YT:Z:UU NH:i:1
## ERR127306.661203 163 chr14   107003080   50  72M =   107003171   163 AAGGAACCCTTGAACTCCCTTGGCGACATGTACTCCTACTAGCACTGTGGCATTATGGTCCTCTGCCTCAAG    +++++++++++++++++++++++++++++++++++*++*+*')++++)*+++++(+*()+'*++*+((**')    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:72 YT:Z:UU NH:i:1
## ERR127306.661203 83  chr14   107003171   50  72M =   107003080   -163    CATGACTTGATGGCTGGAACAAATACATTTAGAGATTTTACCTCCAATACTAGCCTTTGCCATACAGTATTT    +(&+*)+)+++++*+++*+*++++*&+&++++++)+'+)(+)+++++++++*++++++++++*+++++++++    AS:i:-3 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:46G25  YT:Z:UU NH:i:1

You can see that each line corresponds to a single read, and each field refers to a different descriptor of the read. For a detailed explanation of what each field means, see this document. Understanding what each field means is not of immediate relevence to the following steps. However, it is always good to have a general understanding of the structure of the files you are working with.

Sorting and indexing BAM files

In order to be able to do things like extract reads that align to a certain chromosome, or that map to a certain genomic region, we need to have a BAM file index. The index acts as a table of contents so that tools can quickly jump to parts of the BAM file without having to look through all of the sequences. In this example dataset, one has already been generated for us. But for illustration we’ll review how to create one. To do this, we first have to sort the file. We can do this using the following command to sort our BAM file by chromosome and positions of each read:

sortBam(bamfile, destination="hela_sorted")
## [1] "hela_sorted.bam"

This generated a file ‘hela_sorted.bam’ in our current working directory. Once this file has been sorted, we can generate an index file:

indexBam("hela_sorted.bam")
##       hela_sorted.bam 
## "hela_sorted.bam.bai"

Note: you must always sort before indexing a file!

Viewing basic information about our BAM file

We don’t want to have to look through our entire file line by line. Let’s instead use some of the handy parsing functions in RSamtools to view some basic summary info about our file (note these functions can use the non-human readable BAM file, which is more efficient than the human-readable SAM file.

First, we create a special reference to the BAM file, which will be passed to the parsing functions (this contains more information than just the path to the BAM file - also points to the location of the BAM index file):

# view basic info of bam
bamFile <- BamFile(bamfile)
bamFile
## class: BamFile 
## path: /Library/Frameworks/R.framework/Versions/4.4-arm64/.../ERR127306_chr14.bam
## index: /Library/Frameworks/R.framework/Versions/4.4-a.../ERR127306_chr14.bam.bai
## isOpen: FALSE 
## yieldSize: NA 
## obeyQname: FALSE 
## asMates: FALSE 
## qnamePrefixEnd: NA 
## qnameSuffixStart: NA

We’ll pass this special reference to countBam, which will by default tell us how many reads and bases are contained in our BAM file.

countBam(bamFile) 
##   space start end width                file records nucleotides
## 1    NA    NA  NA    NA ERR127306_chr14.bam  800484    57634848

We can see we have 800484 reads, which amounts to a total of about 57.6 million nucleotides. From this output, can you determine how long are our reads?

Next, we’ll use the quickBamFlagSummary function to look at the different ‘flags’ for our reads.

quickBamFlagSummary(bamFile)
##                                 group |    nb of |    nb of | mean / max
##                                    of |  records |   unique | records per
##                               records | in group |   QNAMEs | unique QNAME
## All records........................ A |   800484 |   393300 | 2.04 / 10
##   o template has single segment.... S |        0 |        0 |   NA / NA
##   o template has multiple segments. M |   800484 |   393300 | 2.04 / 10
##       - first segment.............. F |   400242 |   393300 | 1.02 / 5
##       - last segment............... L |   400242 |   393300 | 1.02 / 5
##       - other segment.............. O |        0 |        0 |   NA / NA
## 
## Note that (S, M) is a partitioning of A, and (F, L, O) is a partitioning of M.
## Indentation reflects this.
## 
## Details for group M:
##   o record is mapped.............. M1 |   800484 |   393300 | 2.04 / 10
##       - primary alignment......... M2 |   779228 |   389614 |    2 / 2
##       - secondary alignment....... M3 |    21256 |    10052 | 2.11 / 8
##   o record is unmapped............ M4 |        0 |        0 |   NA / NA
## 
## Details for group F:
##   o record is mapped.............. F1 |   400242 |   393300 | 1.02 / 5
##       - primary alignment......... F2 |   389614 |   389614 |    1 / 1
##       - secondary alignment....... F3 |    10628 |    10052 | 1.06 / 4
##   o record is unmapped............ F4 |        0 |        0 |   NA / NA
## 
## Details for group L:
##   o record is mapped.............. L1 |   400242 |   393300 | 1.02 / 5
##       - primary alignment......... L2 |   389614 |   389614 |    1 / 1
##       - secondary alignment....... L3 |    10628 |    10052 | 1.06 / 4
##   o record is unmapped............ L4 |        0 |        0 |   NA / NA

These ‘flags’ can be used to get detailed counts of certain types of reads. As a quick example, we might want to grab the count of reads that on the minus strand, we could do the following:

params <- ScanBamParam(flag = scanBamFlag(isMinusStrand = TRUE))
countBam(bamFile, param = params)
##   space start end width                file records nucleotides
## 1    NA    NA  NA    NA ERR127306_chr14.bam  400242    28817424

There’s a ton more possibilities - explore the documentation of the RSamtools package (in particular the scanBamFlag and scanBamParam functions), as well as the meaning of SAM flags if you’d like to learn more. These can be really helpful for quality control of our alignment - to make sure we have what we generally expect (e.g. if we performed stranded sequencing, we expect that roughly half of the reads map to each strand). We don’t need to dive too deep into the flags if we are satisfied with our alignment and just want to proceed to get our count table, however.

Generating a count table

Let’s take stock of where we are: we have a BAM file, a SAM file and a BAI (BAM index) file. It is hard to do much analysis with what we have, because even though we know which chromosome our reads map to, we don’t know which genes (or transcripts) they map to.

A variety of different tools can be used to generate a count table - i.e a table of how many reads align to each gene. HTSeq, RSEM, and featureCounts are examples of such programs that are command line tools. Each tool works optimally with the output of different aligners, so it is best to read up on how the BAM files you are working with were processed, and to use the feature counting tools.

Today, we are going to use featureCounts as implemented in the RSubread package, as the BAM files we are using were generated using the Tophat2 aligner, which generates BAM files that are compatible with featureCounts. Because we are trying to associate each read with a gene ID, we need an alignment file (such as a GTF file) that contains information on the genomic coordinates of each transcript.

This type of alignment file can be downloaded from a database such as Gencode, but conveniently, RSubread has some RefSeq annotations built-in, including for mm10, mm9, hg38, and hg19. It is critical that you use the same genome version as the genome version used to align raw reads to your BAM file. Our BAM file was generated by aligning reads to hg19, so that’s what we’ll use. These built-in annotations allow for summarizing counts over genes (the default, and also the option we’ll choose) or exons. Note that external annotation files can be used for other genomes and to summarize over transcript/isoform annotations.

Now we’re ready to apply the featureCounts function that will do the counting of reads over genes. Note that this step can take a while if we have a large BAM file. We specify isPairedEnd = TRUE since as we mentioned above our sequencing protocol generated paired end reads. We also specify strandSpecific = 1 to indicate that our sequencing protocol was stranded.

genecounts <- featureCounts(bamfile,
                        annot.inbuilt = "hg19",
                        isPairedEnd = TRUE,
                        strandSpecific = 1)
## NCBI RefSeq annotation for hg19 (build 37.2) is used.
## 
##         ==========     _____ _    _ ____  _____  ______          _____  
##         =====         / ____| |  | |  _ \|  __ \|  ____|   /\   |  __ \ 
##           =====      | (___ | |  | | |_) | |__) | |__     /  \  | |  | |
##             ====      \___ \| |  | |  _ <|  _  /|  __|   / /\ \ | |  | |
##               ====    ____) | |__| | |_) | | \ \| |____ / ____ \| |__| |
##         ==========   |_____/ \____/|____/|_|  \_\______/_/    \_\_____/
##        Rsubread 2.20.0
## 
## //========================== featureCounts setting ===========================\\
## ||                                                                            ||
## ||             Input files : 1 BAM file                                       ||
## ||                                                                            ||
## ||                           ERR127306_chr14.bam                              ||
## ||                                                                            ||
## ||              Paired-end : yes                                              ||
## ||        Count read pairs : yes                                              ||
## ||              Annotation : inbuilt (hg19)                                   ||
## ||      Dir for temp files : .                                                ||
## ||                 Threads : 1                                                ||
## ||                   Level : meta-feature level                               ||
## ||      Multimapping reads : counted                                          ||
## || Multi-overlapping reads : not counted                                      ||
## ||   Min overlapping bases : 1                                                ||
## ||                                                                            ||
## \\============================================================================//
## 
## //================================= Running ==================================\\
## ||                                                                            ||
## || Load annotation file hg19_RefSeq_exon.txt ...                              ||
## ||    Features : 225074                                                       ||
## ||    Meta-features : 25702                                                   ||
## ||    Chromosomes/contigs : 52                                                ||
## ||                                                                            ||
## || Process BAM file ERR127306_chr14.bam...                                    ||
## ||    Strand specific : stranded                                              ||
## ||    Paired-end reads are included.                                          ||
## ||    Total alignments : 400242                                               ||
## ||    Successfully assigned alignments : 171267 (42.8%)                       ||
## ||    Running time : 0.01 minutes                                             ||
## ||                                                                            ||
## || Write the final count table.                                               ||
## || Write the read assignment summary.                                         ||
## ||                                                                            ||
## \\============================================================================//

You can change other options, such as the minMQS, the minimum mapping quality score to include in the counts. To learn more about different parameters, see the help fule for the featureCounts function.

Let’s take a peek at the output.

str(genecounts)
## List of 4
##  $ counts    : int [1:25702, 1] 0 0 0 0 0 0 0 0 0 0 ...
##   ..- attr(*, "dimnames")=List of 2
##   .. ..$ : chr [1:25702] "653635" "100422834" "645520" "79501" ...
##   .. ..$ : chr "ERR127306_chr14.bam"
##  $ annotation:'data.frame':  25702 obs. of  6 variables:
##   ..$ GeneID: int [1:25702] 653635 100422834 645520 79501 729737 100507658 100132287 100288646 729759 100131754 ...
##   ..$ Chr   : chr [1:25702] "chr1;chr1;chr1;chr1;chr1;chr1;chr1;chr1;chr1;chr1;chr1" "chr1" "chr1;chr1;chr1" "chr1" ...
##   ..$ Start : chr [1:25702] "14362;14970;15796;16607;16858;17233;17606;17915;18268;24738;29321" "30366" "34611;35277;35721" "69091" ...
##   ..$ End   : chr [1:25702] "14829;15038;15947;16765;17055;17368;17742;18061;18366;24891;29370" "30503" "35174;35481;36081" "70008" ...
##   ..$ Strand: chr [1:25702] "-;-;-;-;-;-;-;-;-;-;-" "+" "-;-;-" "+" ...
##   ..$ Length: int [1:25702] 1769 138 1130 918 3402 793 4370 472 939 1019 ...
##  $ targets   : chr "ERR127306_chr14.bam"
##  $ stat      :'data.frame':  14 obs. of  2 variables:
##   ..$ Status             : chr [1:14] "Assigned" "Unassigned_Unmapped" "Unassigned_Read_Type" "Unassigned_Singleton" ...
##   ..$ ERR127306_chr14.bam: int [1:14] 171267 0 0 0 0 0 0 0 0 0 ...

It looks like the counts are stored in the counts slot and the gene annotation is stored in the annotation slot. There are also a couple more slots for experiment metadata (targets has sample name, and stat contains some stats about our BAM file).

Let’s take a peek at the count table, subsetted for genes on chromosome 14 (since our bam file was subsetted to reads mapping to chr 14).

chr14 <- which(grepl("chr14", genecounts$annotation$Chr))
str(chr14)
##  int [1:1044] 6746 6747 6748 6749 6750 6751 6752 6753 6754 6755 ...
head(genecounts$counts[chr14,])
## 100132257    440153    404785 100506092 100506303 100506350 
##         0         0         0         0         4         1
sum(genecounts$counts[chr14,] > 0)
## [1] 499
sum(genecounts$counts[-chr14,] > 0)
## [1] 0

Looks like there are 1044 genes on chromosome 14, 499 of which have non-zero expression. And as we expected, no genes on any other chromosomes have any counts.

Note that the gene IDs are RefSeq IDs. If we’d like to convert them to another ID, such as Hugo symbols or Ensembl IDs, we can use things like the biomaRt package, or annotation packages specific to the organism we are dealing with (e.g. for human: org.Hs.eg.db)

Let’s look at a density of expression of the chr14 genes (log-transformed).

data.frame(count = genecounts$counts[chr14,]) %>%
  ggplot(aes(x = count + 1)) +
    geom_density() +
    scale_x_log10()

We can save the count table to a text file for importing into future R sessions for downstream analysis (such as with DESeq2 or edgeR. We also include a column for gene length, since we might want to use this to obtain quantities like RPKM.

write.table(data.frame(genecounts$annotation[,c("GeneID","Length")],
                       genecounts$counts),
            file = "hela_counts.txt", quote = FALSE, sep = "\t", row.names = FALSE)

Lastly, we’ll cleanup our directory by removing the SAM/BAM/index files we generated earlier, and the text file of counts (comment the last line if you’d like to keep the text file).

file.remove("hela.sam")
file.remove("hela_sorted.bam")
file.remove("hela_sorted.bam.bai")
file.remove("hela_counts.txt")

Deliverable

Now we have a table that summarizes the number of reads that align to each transcript. The is the perfect input to use for methods mentioned above like DESeq2 and edgeR, whose algorithm requires reads be in integer counts, not normalized by library size. For visualization purposes, however, it may be helpful to use reads that are normalized first.

Your exercise is to convert the existing count data into Counts per Million (CPM) and Reads Per Kilobase per Million mapped reads (RPKM) as defined by Bo Li et al. in this paper.

Hint: check out the cpm and rpkm functions in the edgeR package. Format each of your answers as a numeric matrix of values.

# your code here
CPM <- "FILL_THIS_IN"

RPKM <- "FILL_THIS_IN"

This next code chunk will test whether you have correctly calculated CPM and RPKM in the previous chunk. The answers are hidden as an encrypted hash, but the function will return Test passed if it matches. Note that it assumes your answers are each formatted as a numeric matrix (with one column).

test_that("Calculation of CPM:", {
          local_edition(2)
          expect_known_hash(round(CPM, 3), "1aaf27dc9e2203812d775a2be5963d84")
})
## ── Error: Calculation of CPM: ──────────────────────────────────────────────────
## Error in `round(CPM, 3)`: non-numeric argument to mathematical function
## Backtrace:
##     ▆
##  1. └─testthat::expect_known_hash(round(CPM, 3), "1aaf27dc9e2203812d775a2be5963d84")
##  2.   └─testthat::quasi_label(enquo(object), arg = "object")
##  3.     └─rlang::eval_bare(expr, quo_get_env(quo))

## Error:
## ! Test failed
test_that("Calculation of RPKM:", {
          local_edition(2)
          expect_known_hash(round(RPKM, 3), "36af8065f3dbb3b240d1f228faec5577")
})
## ── Error: Calculation of RPKM: ─────────────────────────────────────────────────
## Error in `round(RPKM, 3)`: non-numeric argument to mathematical function
## Backtrace:
##     ▆
##  1. └─testthat::expect_known_hash(round(RPKM, 3), "36af8065f3dbb3b240d1f228faec5577")
##  2.   └─testthat::quasi_label(enquo(object), arg = "object")
##  3.     └─rlang::eval_bare(expr, quo_get_env(quo))

## Error:
## ! Test failed