config-HiC+Phase.yaml

# Specify output directory - either absolute path or relative to Snakefile.
# If using relative paths for subsequent files, these should be relative to
# this working directory.
workdir: GM12878-HiC/

# CSV file with cell type, experimental group, replicate number,
# read (forward/reverse) and path each FASTQ files.
data:  ../config/samples.tsv

# Bed file of genomic regions to perform HiC analysis.
# These may be whole chromosomes for normal HiC or specific capture regions
# for region capture HiC.
regions: ../config/regions.bed

# FASTA references to align data. Must specify a reference for each cell type
# defined in config['data'].
genome :
    S2Rplus : ../genome/GRCh38.fa.gz

build: GRCh38

# Set True to perform phasing and haplotype assembly pipeline.
phase: True

# Path to unphased variant calls, tagged by cell type
unphasedVCF:
    GM12878 : ../genome/GM12878-unphasedVariants.vcf

# List of binsizes to analyse HiC data at different resolutions.
# The first binsize defines the base resolution, all subsequence bin sizes
# must be whole divisible by the base bin size e.g. [1000, 1500] is invalid.
resolution:
    base : 1000
    bins : [3000]

# Parameters for cutadapt - see https://cutadapt.readthedocs.io/en/stable/guide.html
cutadapt:
    forwardAdapter: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
    reverseAdapter: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
    overlap: 6
    errorRate: 0.1
    minimumLength: 20
    qualityCutoff: 20
    GCcontent: 43


# List of restriction sequence in order of protocol usage. Cut site is denoted
# using the '^' symbol. Ensure restriction enzyme names are given as strings.
restrictionSeqs:
    A:
        DpnII : '^GATC'

HiCParams:
    minBins:              50
    minDistance:          300
    maxLibraryInsertSize: 1000
    minMappingQuality:    15
    keepSelfLigation:     False
    keepSelfCircles:      False
    nofill:               False
    makeBam:              False
    compartmentScore:     False # Run Cscore compartment analysis.
    threads:              4 # Threads for building HiC matrix.
    multiplicativeValue:  10000 # HiC counts are normalised to this value.
    microC:               False # Treat data as microC (experimental)

compareMatrices:
    colourmap:      bwr # Matplotlib colour map for differential comparisons.
    zThreshold:     2 # Minimum Z-score for defining a diffTAD / ASTAD.
    vMax:           1 # Absolute value of colour scale, vMin set to -vMax.
    allPairs:       False # Compute all pairwise comparisons (e.g. A vs. B, and B vs. A)
    minSum:         0 # Remove interactions with fewer than this number of raw interactions.

plotParams:
    distanceNorm:   False # Plot obs/exp matrix instead of log counts.
    plain:          True # Plot additional figure without overlaid TAD / loop annotations.
    raw:            False # Plot raw HiC matrix (without KR normalisation).
    colourmap:      Purples # Matplotlib colourmap to use for HiC matrices.
    coordinates:    ../config/plot_coordinates.bed # BED file of regions to plot.
    viewpoints:     ../config/viewpoints.bed
    viewpointRange: 150_000
    plotRep:        True # Plot individual replicates in addition to merged data.
    vLines:         ../config/vlines.bed # Coordinates to add vLines to plots.
    includeRegions: True # Plot config['regions'] in addition to config['plotParams']['coordinates'].
    filetype:       svg # Plot filetype.

# Gene annotation to include with HiC plots.
Genes:
    gff3: ../genome/Homo_sapiens.GRCh38.104.gff3.gz # Path to GFF3 gene annotation.
    typeKey: biotype                     # Attribute key describing gene type
    label: Name                          # Attribute key to label on plot
    geneID: gene_id                      # Attribute key identifying gene ID

# Assorted BigWig annotations include with HiC plots
bigWig:
    CTCF: ../genome/GRCh38-CTCF.bigWig

QC:
    runQC        : True
    flipSNP      : False
    QCsample     : 100000
    fastqScreen  : ../config/fastq_screen.config
    multiQCconfig: ../config/multiqc_config.yaml
    runHiCRep    : True # Run HiCRep - May take a while for high res datasets.
    HiCRep_bin   : 3000