diff --git a/tests/.test_download.py.swp b/tests/.test_download.py.swp deleted file mode 100644 index 7dc637b7b..000000000 Binary files a/tests/.test_download.py.swp and /dev/null differ diff --git a/tests/old-tests/test_features.py b/tests/old-tests/test_features.py deleted file mode 100644 index 55db150f3..000000000 --- a/tests/old-tests/test_features.py +++ /dev/null @@ -1,66 +0,0 @@ -import requests -from unittest import TestCase -from test_functions import compare_get_request, compare_post_request - -class TestFeatures(TestCase): - - def test_advancedSearch(self): - compare_get_request("/advancedSearch") - - def test_resetPassword(self): - compare_get_request("/resetPassword") - - def test_browse(self): - compare_get_request("/browse") - - def test_sparql(self): - compare_get_request("/sparql", headers = {"Accept": "text/html"}) - - def test_searchQuery(self): - compare_get_request("/search/:query?", route_parameters = ["I0462"]) - - def test_searchCount(self): - compare_get_request("/searchCount/:query?", route_parameters = ["I0462"]) - -# def test_advancedSearchQuery(self): -# compare_get_request("/advancedSearch/:query?", route_parameters = ["I0462"]) - - def test_rootCollections(self): - compare_get_request("/rootCollections") - - def test_typeCount(self): - compare_get_request("/:type/count", route_parameters = ["Component"]) - - def test_public_collection_collectionid_displayid_copyFromRemote(self): - compare_get_request("public/:collectionId/:displayId/:version/copyFromRemote", route_parameters = ["testid0","BBa_I0462", "1"]) - -# def test_public_collection_collectionid_displayid_sbolnr(self): -# compare_get_request("/public/:collectionId/:displayId/sbolnr", route_parameters = ["testid0","BBa_I0462"]) - -# def test_public_collection_collectionid_displayid_search_query(self): -# compare_get_request("public/:collectionId/:displayId/search/:query?", route_parameters = ["testid0","BBa_I0462", "test"]) - - def test_public_collection_collectionid_displayId_verion_addOwner(self): - compare_get_request("public/:collectionId/:displayId/:version/addOwner", route_parameters = ["testid0","BBa_I0462", "1"]) - - def test_public_collection_collectionid_displayid_version_metadata(self): - compare_get_request("/public/:collectionId/:displayId/:version/metadata", route_parameters = ["testid0","BBa_I0462", "1"]) - - def test_public_collection_collectionid_displayid_version_metadata(self): - compare_get_request("/public/:collectionId/:displayId/:version/visualization", route_parameters = ["testid0","BBa_I0462", "1"]) - - def test_public_collection_collectionid_displayid_version_uses(self): - compare_get_request("/public/:collectionId/:displayId/:version/uses", route_parameters = ["testid0","BBa_I0462", "1"]) - -# def test_public_collection_collectionid_displayid_version_uses(self): -# compare_get_request("/public/:collectionId/:displayId/:version/search/:query?", route_parameters = ["testid0","BBa_I0462", "1", "test"]) - - def test_public_collection_collectionid_displayid_version_metadata(self): - compare_get_request("/public/:collectionId/:displayId/:version/visualization", route_parameters = ["testid0","BBa_I0462", "1"]) - - def test_public_collection_collectionid_displayid_version_metadata(self): - compare_get_request("/public/:collectionId/:displayId(*)/:version", route_parameters = ["testid0","BBa_I0462", "1"]) - - def test_public_collection_collectionid_displayid_version_metadata(self): - compare_get_request("/public/:collectionId/:displayId/:version/visualization", route_parameters = ["testid0","BBa_I0462", "1"]) - diff --git a/tests/old-tests/test_login.py b/tests/old-tests/test_login.py deleted file mode 100644 index 1d911686b..000000000 --- a/tests/old-tests/test_login.py +++ /dev/null @@ -1,15 +0,0 @@ -from unittest import TestCase -from test_functions import compare_get_request, compare_post_request, login_with - - -class TestSetup(TestCase): - - def test_post_login_token(self): - logininfo = {'email' : 'test@user.synbiohub', - 'password' : 'test'} - login_with(logininfo) - - def test_profile(TestCase): - compare_get_request("/profile") - - diff --git a/tests/old-tests/test_logout.py b/tests/old-tests/test_logout.py deleted file mode 100644 index 6746e7061..000000000 --- a/tests/old-tests/test_logout.py +++ /dev/null @@ -1,8 +0,0 @@ -import requests -from unittest import TestCase -from test_functions import compare_get_request, compare_post_request - - -class TestLogout(TestCase): - def test_logout(self): - compare_get_request("/logout") diff --git a/tests/old-tests/test_public_collection.py b/tests/old-tests/test_public_collection.py deleted file mode 100644 index dd9ae0fae..000000000 --- a/tests/old-tests/test_public_collection.py +++ /dev/null @@ -1,51 +0,0 @@ -import requests -from unittest import TestCase -from test_functions import compare_get_request, compare_post_request - - -class TestPublicCollection(TestCase): - - def make_new_collection(self, uniqueid): - # create the collection - data = {'id':(None, 'testid' + uniqueid), - 'version' : (None, '1'), - 'name' : (None, 'testcollection' + uniqueid), - 'description':(None, 'testdescription' + uniqueid), - 'citations':(None, 'none'), - 'overwrite_merge':(None, '0')} - - files = {'file':("./SBOLTestRunner/src/main/resources/SBOLTestSuite/SBOL2/BBa_I0462.xml", - open('./SBOLTestRunner/src/main/resources/SBOLTestSuite/SBOL2/BBa_I0462.xml', 'rb'))} - - compare_post_request("submit", data, headers = {"Accept": "text/plain"}, - files = files, test_name = "generic_collection" + uniqueid) - return data - - """ def test_bad_make_public(self): - data = self.make_new_collection("1") - - data['tabState'] = 'new' - - # try to remove the collection but don't enter a id - del data['id'] - with self.assertRaises(requests.exceptions.HTTPError): - compare_post_request("/user/:userId/:collectionId/:displayId/:version/makePublic", route_parameters = ["testuser", "testid1", "testid_collection1", "1"], data = data) - TODO: uncomment when this does raise an HTTPError in synbiohub - """ - - - def test_make_public(self): - data = self.make_new_collection("0") - - - # get the view - compare_get_request("/user/:userId/:collectionId/:displayId/:version/makePublic", route_parameters = ["testuser", "testid0", "testid0_collection", "1"]) - - data['tabState'] = 'new' - - # make the collection public - compare_post_request("/user/:userId/:collectionId/:displayId/:version/makePublic", route_parameters = ["testuser", "testid0", "testid0_collection", "1"], data = data) - - # try to delete the collection - with self.assertRaises(requests.exceptions.HTTPError): - compare_get_request("/public/:collectionId/:displayId/:version/removeCollection", route_parameters = ["testid0", "testid0_collection", "1"], test_name = 'remove') diff --git a/tests/old-tests/test_user_features.py b/tests/old-tests/test_user_features.py deleted file mode 100644 index 5ad48dba6..000000000 --- a/tests/old-tests/test_user_features.py +++ /dev/null @@ -1,7 +0,0 @@ -import requests -from unittest import TestCase -from test_functions import compare_get_request, compare_post_request - -class TestFeatures(TestCase): - def test_user_part_addOwner(self): - compare_get_request("/user/:userId/:collectionId/:displayId/:version/addOwner", route_parameters = ["testuser","testid0","BBa_I0462", "1"]) diff --git a/tests/previousresults/get_file_json_public-:collectionId-:displayId-:version-summary_.xml b/tests/previousresults/get_file_json_public-:collectionId-:displayId-:version-summary_.xml new file mode 100644 index 000000000..7d9a6de22 --- /dev/null +++ b/tests/previousresults/get_file_json_public-:collectionId-:displayId-:version-summary_.xml @@ -0,0 +1,1612 @@ +{ + "componentDefinitions": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1", + "displayId": "part_pIKE_Toggle_1", + "version": "1", + "description": "LacI/TetR Toggle Switch", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000280" + ], + "components": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/pIKERightCassette_1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/pIKERightCassette_1", + "displayId": "pIKERightCassette_1", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/pIKELeftCassette_1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/pIKELeftCassette_1", + "displayId": "pIKELeftCassette_1", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + } + ], + "sequenceAnnotations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/anno1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/anno1", + "displayId": "anno1", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/anno1/location1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/anno1/location1", + "displayId": "location1", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 1, + "end": 1285, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/pIKELeftCassette_1/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/anno2/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/anno2", + "displayId": "anno2", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/anno2/location2/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/anno2/location2", + "displayId": "location2", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 1286, + "end": 2834, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKE_Toggle_1/pIKERightCassette_1/1" + } + ] + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1", + "displayId": "part_pIKELeftCassette_1", + "version": "1", + "description": "TetR Inverter", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000280" + ], + "components": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/ECK120029600/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/ECK120029600", + "displayId": "ECK120029600", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/ECK120029600/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/BBa_J61101/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/BBa_J61101", + "displayId": "BBa_J61101", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/BBa_J61101/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/BBa_R0040/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/BBa_R0040", + "displayId": "BBa_R0040", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/BBa_R0040/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/BBa_C0012/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/BBa_C0012", + "displayId": "BBa_C0012", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/BBa_C0012/1" + } + ], + "sequenceAnnotations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno1", + "displayId": "anno1", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno1/location1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno1/location1", + "displayId": "location1", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 1, + "end": 55, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/BBa_R0040/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno2/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno2", + "displayId": "anno2", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno2/location2/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno2/location2", + "displayId": "location2", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 56, + "end": 68, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/BBa_J61101/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno3/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno3", + "displayId": "anno3", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno3/location3/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno3/location3", + "displayId": "location3", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 69, + "end": 1197, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/BBa_C0012/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno4/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno4", + "displayId": "anno4", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno4/location4/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/anno4/location4", + "displayId": "location4", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 1198, + "end": 1288, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKELeftCassette_1/ECK120029600/1" + } + ] + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1", + "displayId": "part_pIKERightCassette_1", + "version": "1", + "description": "LacI Inverter", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000280" + ], + "components": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_R0010/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_R0010", + "displayId": "BBa_R0010", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/BBa_R0010/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/ECK120033736/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/ECK120033736", + "displayId": "ECK120033736", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/ECK120033736/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_J61120/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_J61120", + "displayId": "BBa_J61120", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/BBa_J61120/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_J61130/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_J61130", + "displayId": "BBa_J61130", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/BBa_J61130/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_C0040/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_C0040", + "displayId": "BBa_C0040", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/BBa_C0040/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_E0040/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_E0040", + "displayId": "BBa_E0040", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "access": "http://sbols.org/v2#public", + "definition": "http://localhost:7777/public/testid1/BBa_E0040/1" + } + ], + "sequenceAnnotations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno1", + "displayId": "anno1", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno1/location1/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno1/location1", + "displayId": "location1", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 1, + "end": 55, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_R0010/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno2/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno2", + "displayId": "anno2", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno2/location2/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno2/location2", + "displayId": "location2", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 56, + "end": 68, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_J61120/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno3/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno3", + "displayId": "anno3", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno3/location3/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno3/location3", + "displayId": "location3", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 69, + "end": 729, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_C0040/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno4/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno4", + "displayId": "anno4", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno4/location4/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno4/location4", + "displayId": "location4", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 730, + "end": 742, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_J61130/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno5/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno5", + "displayId": "anno5", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno5/location5/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno5/location5", + "displayId": "location5", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 743, + "end": 1463, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/BBa_E0040/1" + }, + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno6/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno6", + "displayId": "anno6", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "locations": [ + { + "uri": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno6/location6/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/anno6/location6", + "displayId": "location6", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "start": 1464, + "end": 1554, + "orientation": "http://sbols.org/v2#inline" + } + ], + "component": "http://localhost:7777/public/testid1/part_pIKERightCassette_1/ECK120033736/1" + } + ] + }, + { + "uri": "http://localhost:7777/public/testid1/BBa_C0012/1", + "persistentIdentity": "http://localhost:7777/public/testid1/BBa_C0012", + "displayId": "BBa_C0012", + "version": "1", + "description": "lacI coding sequence", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/BBa_C0012/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000316" + ], + "sequences": [ + "http://localhost:7777/public/testid1/part_BBa_C0012/1" + ] + }, + { + "uri": "http://localhost:7777/public/testid1/BBa_C0040/1", + "persistentIdentity": "http://localhost:7777/public/testid1/BBa_C0040", + "displayId": "BBa_C0040", + "version": "1", + "description": "tetR coding sequence", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/BBa_C0040/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000316" + ], + "sequences": [ + "http://localhost:7777/public/testid1/part_BBa_C0040/1" + ] + }, + { + "uri": "http://localhost:7777/public/testid1/BBa_E0040/1", + "persistentIdentity": "http://localhost:7777/public/testid1/BBa_E0040", + "displayId": "BBa_E0040", + "version": "1", + "description": "gfp coding sequence", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/BBa_E0040/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000316" + ], + "sequences": [ + "http://localhost:7777/public/testid1/part_BBa_E0040/1" + ] + }, + { + "uri": "http://localhost:7777/public/testid1/BBa_J61101/1", + "persistentIdentity": "http://localhost:7777/public/testid1/BBa_J61101", + "displayId": "BBa_J61101", + "version": "1", + "description": "RBS1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/BBa_J61101/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000139" + ], + "sequences": [ + "http://localhost:7777/public/testid1/part_BBa_J61101/1" + ] + }, + { + "uri": "http://localhost:7777/public/testid1/BBa_J61120/1", + "persistentIdentity": "http://localhost:7777/public/testid1/BBa_J61120", + "displayId": "BBa_J61120", + "version": "1", + "description": "RBS2", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/BBa_J61120/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000139" + ], + "sequences": [ + "http://localhost:7777/public/testid1/part_BBa_J61120/1" + ] + }, + { + "uri": "http://localhost:7777/public/testid1/BBa_J61130/1", + "persistentIdentity": "http://localhost:7777/public/testid1/BBa_J61130", + "displayId": "BBa_J61130", + "version": "1", + "description": "RBS2", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/BBa_J61130/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000139" + ], + "sequences": [ + "http://localhost:7777/public/testid1/part_BBa_J61130/1" + ] + }, + { + "uri": "http://localhost:7777/public/testid1/BBa_R0010/1", + "persistentIdentity": "http://localhost:7777/public/testid1/BBa_R0010", + "displayId": "BBa_R0010", + "version": "1", + "description": "pLacI promoter", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/BBa_R0010/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000167" + ], + "sequences": [ + "http://localhost:7777/public/testid1/part_BBa_R0010/1" + ] + }, + { + "uri": "http://localhost:7777/public/testid1/BBa_R0040/1", + "persistentIdentity": "http://localhost:7777/public/testid1/BBa_R0040", + "displayId": "BBa_R0040", + "version": "1", + "description": "pTet promoter", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/BBa_R0040/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000167" + ], + "sequences": [ + "http://localhost:7777/public/testid1/part_BBa_R0040/1" + ] + }, + { + "uri": "http://localhost:7777/public/testid1/ECK120029600/1", + "persistentIdentity": "http://localhost:7777/public/testid1/ECK120029600", + "displayId": "ECK120029600", + "version": "1", + "description": "Terminator1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/ECK120029600/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000141" + ], + "sequences": [ + "http://localhost:7777/public/testid1/part_ECK120029600/1" + ] + }, + { + "uri": "http://localhost:7777/public/testid1/ECK120033736/1", + "persistentIdentity": "http://localhost:7777/public/testid1/ECK120033736", + "displayId": "ECK120033736", + "version": "1", + "description": "Terminator2", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/ECK120033736/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "types": [ + "http://www.biopax.org/release/biopax-level3.owl#DnaRegion" + ], + "roles": [ + "http://identifiers.org/so/SO:0000141" + ], + "sequences": [ + "http://localhost:7777/public/testid1/part_ECK120033736/1" + ] + } + ], + "sequences": [ + { + "uri": "http://localhost:7777/public/testid1/part_BBa_C0012/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_BBa_C0012", + "displayId": "part_BBa_C0012", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_BBa_C0012/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "elements": "atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataa", + "encoding": "http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html" + }, + { + "uri": "http://localhost:7777/public/testid1/part_BBa_C0040/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_BBa_C0040", + "displayId": "part_BBa_C0040", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_BBa_C0040/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "elements": "atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataa", + "encoding": "http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html" + }, + { + "uri": "http://localhost:7777/public/testid1/part_BBa_E0040/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_BBa_E0040", + "displayId": "part_BBa_E0040", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_BBa_E0040/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "elements": "atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa", + "encoding": "http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html" + }, + { + "uri": "http://localhost:7777/public/testid1/part_BBa_J61101/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_BBa_J61101", + "displayId": "part_BBa_J61101", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_BBa_J61101/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "elements": "aaagacaggacc", + "encoding": "http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html" + }, + { + "uri": "http://localhost:7777/public/testid1/part_BBa_J61120/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_BBa_J61120", + "displayId": "part_BBa_J61120", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_BBa_J61120/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "elements": "aaagacaggacc", + "encoding": "http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html" + }, + { + "uri": "http://localhost:7777/public/testid1/part_BBa_J61130/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_BBa_J61130", + "displayId": "part_BBa_J61130", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_BBa_J61130/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "elements": "aaagaaacgaca", + "encoding": "http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html" + }, + { + "uri": "http://localhost:7777/public/testid1/part_BBa_R0010/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_BBa_R0010", + "displayId": "part_BBa_R0010", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_BBa_R0010/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "elements": "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac", + "encoding": "http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html" + }, + { + "uri": "http://localhost:7777/public/testid1/part_BBa_R0040/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_BBa_R0040", + "displayId": "part_BBa_R0040", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_BBa_R0040/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "elements": "tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac", + "encoding": "http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html" + }, + { + "uri": "http://localhost:7777/public/testid1/part_ECK120029600/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_ECK120029600", + "displayId": "part_ECK120029600", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_ECK120029600/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "elements": "ttcagccaaaaaacttaagaccgccggtcttgtccactaccttgcagtaatgcggtggacaggatcggcggttttcttttctcttctcaa", + "encoding": "http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html" + }, + { + "uri": "http://localhost:7777/public/testid1/part_ECK120033736/1", + "persistentIdentity": "http://localhost:7777/public/testid1/part_ECK120033736", + "displayId": "part_ECK120033736", + "version": "1", + "annotations": [ + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#topLevel", + "value": "http://localhost:7777/public/testid1/part_ECK120033736/1" + }, + { + "type": "uri", + "name": "http://wiki.synbiohub.org/wiki/Terms/synbiohub#ownedBy", + "value": "http://localhost:7777/user/testuser" + }, + { + "type": "string", + "name": "http://purl.obolibrary.org/obo/OBI_0001617", + "value": "none" + } + ], + "elements": "ttcagccaaaaaacttaagaccgccggtcttgtccactaccttgcagtaatgcggtggacaggatcggcggttttcttttctcttctcaa", + "encoding": "http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html" + } + ] +} \ No newline at end of file diff --git a/tests/previousresults/get_file_public-:collectionId-:displayId-:version-gff_.xml b/tests/previousresults/get_file_public-:collectionId-:displayId-:version-gff_.xml index 8caad8eae..a1d4b3dae 100644 --- a/tests/previousresults/get_file_public-:collectionId-:displayId-:version-gff_.xml +++ b/tests/previousresults/get_file_public-:collectionId-:displayId-:version-gff_.xml @@ -1,158 +1,86 @@ - - - part_pIKELeftCassette_1 + + + part_pIKE_Toggle_1 1 - TetR Inverter - TetR Inverter - + LacI/TetR Toggle Switch + LacI/TetR Toggle Switch + none - - - BBa_J61101 - 1 - - - none - - - - - - - - BBa_C0012 - 1 - - - none - - - - - - - - BBa_R0040 + + + pIKERightCassette_1 1 - + none - + - - - ECK120029600 + + + pIKELeftCassette_1 1 - + none - + - - - anno4 - 1 - - - none - - - - location4 - 1 - - - none - 1198 - 1288 - - - - - - - - - - anno3 + + + anno2 1 - + none - - - location3 + + + location2 1 - + none - 69 - 1197 + 1286 + 2834 - + - - + + anno1 1 - + none - - + + location1 1 - + none 1 - 55 - - - - - - - - - - anno2 - 1 - - - none - - - - location2 - 1 - - - none - 56 - 68 + 1285 - + @@ -167,30 +95,6 @@ none - - - - BBa_R0010 - 1 - - - none - - - - - - - - BBa_E0040 - 1 - - - none - - - - @@ -204,15 +108,15 @@ - - - BBa_J61120 + + + BBa_J61130 1 none - + @@ -228,65 +132,41 @@ - - - BBa_J61130 + + + BBa_R0010 1 none - + - - - - anno5 + + + + BBa_J61120 1 none - - - - location5 - 1 - - - none - 743 - 1463 - - - - - - - - - - anno3 + + + + + + + + BBa_E0040 1 none - - - - location3 - 1 - - - none - 69 - 729 - - - - - - + + + + @@ -360,27 +240,231 @@ - - - anno1 + + + anno3 1 none - - - location1 + + + location3 1 none - 1 - 55 + 69 + 729 - + + + + + + + anno1 + 1 + + + none + + + + location1 + 1 + + + none + 1 + 55 + + + + + + + + + + anno5 + 1 + + + none + + + + location5 + 1 + + + none + 743 + 1463 + + + + + + + + + + part_pIKELeftCassette_1 + 1 + TetR Inverter + TetR Inverter + + + none + + + + + + BBa_J61101 + 1 + + + none + + + + + + + + BBa_C0012 + 1 + + + none + + + + + + + + ECK120029600 + 1 + + + none + + + + + + + + BBa_R0040 + 1 + + + none + + + + + + + + anno3 + 1 + + + none + + + + location3 + 1 + + + none + 69 + 1197 + + + + + + + + + + anno4 + 1 + + + none + + + + location4 + 1 + + + none + 1198 + 1288 + + + + + + + + + + anno1 + 1 + + + none + + + + location1 + 1 + + + none + 1 + 55 + + + + + + + + + + anno2 + 1 + + + none + + + + location2 + 1 + + + none + 56 + 68 + + + + @@ -475,90 +559,6 @@ - - - part_pIKE_Toggle_1 - 1 - LacI/TetR Toggle Switch - LacI/TetR Toggle Switch - - - none - - - - - - pIKELeftCassette_1 - 1 - - - none - - - - - - - - pIKERightCassette_1 - 1 - - - none - - - - - - - - anno2 - 1 - - - none - - - - location2 - 1 - - - none - 1286 - 2834 - - - - - - - - - - anno1 - 1 - - - none - - - - location1 - 1 - - - none - 1 - 1285 - - - - - - - BBa_C0040 diff --git a/tests/previousresults/get_file_public-:collectionId-:displayId-:version-omex_.xml b/tests/previousresults/get_file_public-:collectionId-:displayId-:version-omex_.xml index 1b9ab4109..2358f767e 100644 Binary files a/tests/previousresults/get_file_public-:collectionId-:displayId-:version-omex_.xml and b/tests/previousresults/get_file_public-:collectionId-:displayId-:version-omex_.xml differ diff --git a/tests/previousresults/get_file_public-:collectionId-:displayId-:version-sbol_.xml b/tests/previousresults/get_file_public-:collectionId-:displayId-:version-sbol_.xml index b0d3321ba..a77e61d2e 100644 --- a/tests/previousresults/get_file_public-:collectionId-:displayId-:version-sbol_.xml +++ b/tests/previousresults/get_file_public-:collectionId-:displayId-:version-sbol_.xml @@ -12,26 +12,26 @@ - - - pIKELeftCassette_1 + + + pIKERightCassette_1 1 none - + - - - pIKERightCassette_1 + + + pIKELeftCassette_1 1 none - + @@ -96,14 +96,14 @@ - - - BBa_C0012 + + + ECK120029600 1 none - + @@ -132,14 +132,14 @@ - - - ECK120029600 + + + BBa_C0012 1 none - + @@ -252,50 +252,50 @@ - - - BBa_J61120 + + + BBa_R0010 1 none - + - - - BBa_J61130 + + + ECK120033736 1 none - + - - - BBa_R0010 + + + BBa_J61120 1 none - + - - - ECK120033736 + + + BBa_J61130 1 none - + diff --git a/tests/previousresults/get_file_public-:collectionId-:displayId-:version-sbolnr_.xml b/tests/previousresults/get_file_public-:collectionId-:displayId-:version-sbolnr_.xml index 772e3801d..e7ef983c0 100644 --- a/tests/previousresults/get_file_public-:collectionId-:displayId-:version-sbolnr_.xml +++ b/tests/previousresults/get_file_public-:collectionId-:displayId-:version-sbolnr_.xml @@ -12,26 +12,26 @@ - - - pIKELeftCassette_1 + + + pIKERightCassette_1 1 none - + - - - pIKERightCassette_1 + + + pIKELeftCassette_1 1 none - + diff --git a/tests/previousresults/get_file_public-:collectionId-:displayId-sbol_.xml b/tests/previousresults/get_file_public-:collectionId-:displayId-sbol_.xml index b0d3321ba..a77e61d2e 100644 --- a/tests/previousresults/get_file_public-:collectionId-:displayId-sbol_.xml +++ b/tests/previousresults/get_file_public-:collectionId-:displayId-sbol_.xml @@ -12,26 +12,26 @@ - - - pIKELeftCassette_1 + + + pIKERightCassette_1 1 none - + - - - pIKERightCassette_1 + + + pIKELeftCassette_1 1 none - + @@ -96,14 +96,14 @@ - - - BBa_C0012 + + + ECK120029600 1 none - + @@ -132,14 +132,14 @@ - - - ECK120029600 + + + BBa_C0012 1 none - + @@ -252,50 +252,50 @@ - - - BBa_J61120 + + + BBa_R0010 1 none - + - - - BBa_J61130 + + + ECK120033736 1 none - + - - - BBa_R0010 + + + BBa_J61120 1 none - + - - - ECK120033736 + + + BBa_J61130 1 none - + diff --git a/tests/previousresults/get_file_public-:collectionId-:displayId-sbolnr_.xml b/tests/previousresults/get_file_public-:collectionId-:displayId-sbolnr_.xml index b0d3321ba..a77e61d2e 100644 --- a/tests/previousresults/get_file_public-:collectionId-:displayId-sbolnr_.xml +++ b/tests/previousresults/get_file_public-:collectionId-:displayId-sbolnr_.xml @@ -12,26 +12,26 @@ - - - pIKELeftCassette_1 + + + pIKERightCassette_1 1 none - + - - - pIKERightCassette_1 + + + pIKELeftCassette_1 1 none - + @@ -96,14 +96,14 @@ - - - BBa_C0012 + + + ECK120029600 1 none - + @@ -132,14 +132,14 @@ - - - ECK120029600 + + + BBa_C0012 1 none - + @@ -252,50 +252,50 @@ - - - BBa_J61120 + + + BBa_R0010 1 none - + - - - BBa_J61130 + + + ECK120033736 1 none - + - - - BBa_R0010 + + + BBa_J61120 1 none - + - - - ECK120033736 + + + BBa_J61130 1 none - + diff --git a/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-gff_.xml b/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-gff_.xml index 05deab4e3..dbb0967e3 100644 --- a/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-gff_.xml +++ b/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-gff_.xml @@ -13,6 +13,71 @@ + + + BBa_J61120 + 1 + BBa_J61101 RBS + RBS2 + + + none + + + + + + + BBa_C0040 + 1 + tetR + tetR coding sequence + + + none + + + + + + + BBa_C0012 + 1 + lacI + lacI coding sequence + + + none + + + + + + + ECK120033736 + 1 + ECK120033736 + Terminator2 + + + none + + + + + + + BBa_E0040 + 1 + gfp + gfp coding sequence + + + none + + + + part_pIKELeftCassette_1 @@ -37,15 +102,15 @@ - - - ECK120029600 + + + BBa_C0012 1 none - + @@ -61,15 +126,15 @@ - - - BBa_C0012 + + + ECK120029600 1 none - + @@ -120,6 +185,30 @@ + + + + anno3 + 1 + + + none + + + + location3 + 1 + + + none + 69 + 1197 + + + + + + @@ -144,108 +233,116 @@ + + + + part_pIKE_Toggle_1 + 1 + LacI/TetR Toggle Switch + LacI/TetR Toggle Switch + + + none + + + + + + pIKERightCassette_1 + 1 + + + none + + + + + + + + pIKELeftCassette_1 + 1 + + + none + + + + + + + + anno2 + 1 + + + none + + + + location2 + 1 + + + none + 1286 + 2834 + + + + + + - - - anno3 + + + anno1 1 - + none - - - location3 + + + location1 1 - + none - 69 - 1197 + 1 + 1285 - + - - - BBa_J61120 + + + BBa_J61101 1 BBa_J61101 RBS - RBS2 - + RBS1 + none - - - - - BBa_C0040 - 1 - tetR - tetR coding sequence - - - none - - - - - - - BBa_C0012 - 1 - lacI - lacI coding sequence - - - none - - - - - - - ECK120033736 - 1 - ECK120033736 - Terminator2 - - - none - - - - - - - BBa_E0040 - 1 - gfp - gfp coding sequence - - - none - - - + - - - BBa_J61101 + + + BBa_J61130 1 BBa_J61101 RBS - RBS1 - + RBS2 + none - + @@ -258,6 +355,18 @@ none + + + + BBa_J61130 + 1 + + + none + + + + @@ -271,15 +380,15 @@ - - - ECK120033736 + + + BBa_J61120 1 none - + @@ -307,75 +416,63 @@ - - - BBa_J61130 - 1 - - - none - - - - - - - - BBa_J61120 + + + ECK120033736 1 none - + - - - anno6 + + + anno5 1 none - - - location6 + + + location5 1 none - 1464 - 1554 + 743 + 1463 - + - - - anno2 + + + anno6 1 none - - - location2 + + + location6 1 none - 56 - 68 + 1464 + 1554 - + @@ -403,51 +500,51 @@ - - - anno5 + + + anno1 1 none - - - location5 + + + location1 1 none - 743 - 1463 + 1 + 55 - + - - - anno1 + + + anno2 1 none - - - location1 + + + location2 1 none - 1 - 55 + 56 + 68 - + @@ -475,103 +572,6 @@ - - - BBa_J61130 - 1 - BBa_J61101 RBS - RBS2 - - - none - - - - - - - part_pIKE_Toggle_1 - 1 - LacI/TetR Toggle Switch - LacI/TetR Toggle Switch - - - none - - - - - - pIKERightCassette_1 - 1 - - - none - - - - - - - - pIKELeftCassette_1 - 1 - - - none - - - - - - - - anno2 - 1 - - - none - - - - location2 - 1 - - - none - 1286 - 2834 - - - - - - - - - - anno1 - 1 - - - none - - - - location1 - 1 - - - none - 1 - 1285 - - - - - - - BBa_R0040 diff --git a/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-omex_.xml b/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-omex_.xml index a0edd373d..03f5438a9 100644 Binary files a/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-omex_.xml and b/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-omex_.xml differ diff --git a/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-sbol_.xml b/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-sbol_.xml index 1c6f6bbc6..21d27b593 100644 --- a/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-sbol_.xml +++ b/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-:version-sbol_.xml @@ -95,18 +95,6 @@ none - - - - BBa_R0040 - 1 - - - none - - - - @@ -143,6 +131,18 @@ + + + + BBa_R0040 + 1 + + + none + + + + @@ -276,50 +276,50 @@ - - - BBa_C0040 + + + BBa_J61130 1 none - + - - - ECK120033736 + + + BBa_R0010 1 none - + - - - BBa_J61130 + + + BBa_C0040 1 none - + - - - BBa_R0010 + + + ECK120033736 1 none - + diff --git a/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-sbol_.xml b/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-sbol_.xml index 1c6f6bbc6..21d27b593 100644 --- a/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-sbol_.xml +++ b/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-sbol_.xml @@ -95,18 +95,6 @@ none - - - - BBa_R0040 - 1 - - - none - - - - @@ -143,6 +131,18 @@ + + + + BBa_R0040 + 1 + + + none + + + + @@ -276,50 +276,50 @@ - - - BBa_C0040 + + + BBa_J61130 1 none - + - - - ECK120033736 + + + BBa_R0010 1 none - + - - - BBa_J61130 + + + BBa_C0040 1 none - + - - - BBa_R0010 + + + ECK120033736 1 none - + diff --git a/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-sbolnr_.xml b/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-sbolnr_.xml index 1c6f6bbc6..21d27b593 100644 --- a/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-sbolnr_.xml +++ b/tests/previousresults/get_file_user-:userId-:collectionId-:displayId-sbolnr_.xml @@ -95,18 +95,6 @@ none - - - - BBa_R0040 - 1 - - - none - - - - @@ -143,6 +131,18 @@ + + + + BBa_R0040 + 1 + + + none + + + + @@ -276,50 +276,50 @@ - - - BBa_C0040 + + + BBa_J61130 1 none - + - - - ECK120033736 + + + BBa_R0010 1 none - + - - - BBa_J61130 + + + BBa_C0040 1 none - + - - - BBa_R0010 + + + ECK120033736 1 none - + diff --git a/tests/test_download.py b/tests/test_download.py index 53a73a7fc..5fef877b2 100644 --- a/tests/test_download.py +++ b/tests/test_download.py @@ -1,6 +1,6 @@ import requests from unittest import TestCase -from test_functions import compare_get_request, compare_get_request_download,compare_post_request +from test_functions import compare_get_request, compare_get_request_download,compare_post_request,compare_get_request_json class TestDownload(TestCase): @@ -19,7 +19,7 @@ def test_download(self): compare_get_request_download("/public/:collectionId/:displayId/:version/gff", route_parameters = ["testid1","part_pIKE_Toggle_1","1"], headers = {"Accept": "text/html"}) compare_get_request_download("/public/:collectionId/:displayId/:version/omex", route_parameters = ["testid1","part_pIKE_Toggle_1","1"], headers = {"Accept": "text/html"}) compare_get_request_download("/public/:collectionId/:displayId/:version/fasta", route_parameters = ["testid1","part_pIKE_Toggle_1","1"], headers = {"Accept": "text/html"}) - # compare_get_request_download("/public/:collectionId/:displayId/summary", route_parameters = ["testid1","part_pIKE_Toggle_1"], headers = {"Accept": "text/html"}) + compare_get_request_json("/public/:collectionId/:displayId/:version/summary", route_parameters = ["testid1","part_pIKE_Toggle_1","1"], headers = {"Accept": "text/html"}) compare_get_request_download("/user/:userId/:collectionId/:displayId/:version/gff", route_parameters = ["testuser","test_attachment","part_pIKE_Toggle_1","1"], headers = {"Accept": "text/html"}) compare_get_request_download("/user/:userId/:collectionId/:displayId/:version/omex", route_parameters = ["testuser","test_attachment","part_pIKE_Toggle_1","1"], headers = {"Accept": "text/html"}) diff --git a/tests/test_functions.py b/tests/test_functions.py index 83d904b27..c9029df09 100644 --- a/tests/test_functions.py +++ b/tests/test_functions.py @@ -152,10 +152,6 @@ def compare_request(requestcontent, request, requesttype, route_parameters, file if args.resetalltests: with open(file_path, 'w') as rfile: rfile.write(requestcontent) - elif requesttype[0:8] == "get_file" and request in args.resetgetrequests: - test_print("resetting get_file request " + request + " and saving to file " + file_path) - with open(file_path, 'w') as file: - file.write(requestcontent) elif requesttype[0:3] == "get" and request in args.resetgetrequests: test_print("resetting get request " + request + " and saving to file " + file_path) with open(file_path, 'w') as rfile: @@ -165,11 +161,46 @@ def compare_request(requestcontent, request, requesttype, route_parameters, file with open(file_path, 'w') as rfile: rfile.write(requestcontent) else: - if requesttype[0:8] == "get_file": + if requesttype[0:13] == "get_file_json": + file_diff_json(requestcontent, request, requesttype, route_parameters, file_path) + elif requesttype[0:8] == "get_file": file_diff_download(requestcontent, request, requesttype, route_parameters, file_path) elif requesttype[0:3] == "get" or requesttype[0:4] == "post": file_diff(requestcontent, request, requesttype, route_parameters, file_path) +def file_diff(requestcontent, request, requesttype, route_parameters, file_path): + olddata = None + try: + with open (file_path, "r") as oldfile: + olddata=oldfile.read() + except IOError as e: + raise Exception("\n[synbiohub test] Could not open previous result for the " + \ + requesttype + " " + request + ". If the saved result has not yet been created because it is a new page, please use --resetgetrequests [requests] or --resetpostrequests [requests] to create the file.") from e + + olddata = olddata.splitlines() + newdata = requestcontent.splitlines() + + changes = difflib.unified_diff(olddata, newdata) + + # change list holds the strings to print in an error message + changelist = [requesttype, " ", file_path, " did not match previous results. If you are adding changes to SynBioHub that change this page, please check that the page is correct and update the file using the command line argument --resetgetrequests [requests] and --resetpostrequests [requests].\nThe following is a diff of the new files compared to the old.\n"] + + # temp variable to detect if we need to print the beginning of the error + numofchanges = 0 + + for c in changes: + numofchanges += 1 + + # print the diff + changelist.append(c) + changelist.append("\n") + + changelist.append("\n Here is the last 50 lines of the synbiohub error log: \n") + changelist.append(get_end_of_error_log(50)) + + if numofchanges>0: + raise ValueError(''.join(changelist)) + def file_diff_download(requestcontent, request, requesttype, route_parameters, file_path): olddata = None @@ -207,8 +238,9 @@ def file_diff_download(requestcontent, request, requesttype, route_parameters, f changelist = [requesttype, " ", file_path, " did not match previous results. If you are adding changes to SynBioHub that change this page, please check that the page is correct and update the file using the command line argument --resetgetrequests [requests] and --resetpostrequests [requests].\nThe following is a diff of the new files compared to the old.\n"] raise ValueError(''.join(changelist)) -def file_diff(requestcontent, request, requesttype, route_parameters, file_path): +def file_diff_json(requestcontent, request, requesttype, route_parameters, file_path): olddata = None + try: with open (file_path, "r") as oldfile: olddata=oldfile.read() @@ -216,36 +248,23 @@ def file_diff(requestcontent, request, requesttype, route_parameters, file_path) raise Exception("\n[synbiohub test] Could not open previous result for the " + \ requesttype + " " + request + ". If the saved result has not yet been created because it is a new page, please use --resetgetrequests [requests] or --resetpostrequests [requests] to create the file.") from e - olddata = olddata.splitlines() - newdata = requestcontent.splitlines() + if json.dumps(requestcontent,sort_keys = True) != json.dumps(olddata, sort_keys = True): + changelist = [requesttype, " ", file_path, " did not match previous results. If you are adding changes to SynBioHub that change this page, please check that the page is correct and update the file using the command line argument --resetgetrequests [requests] and --resetpostrequests [requests].\n"] - changes = difflib.unified_diff(olddata, newdata) + changes = difflib.unified_diff(json.dumps(olddata), json.dumps(requestcontent)) + # temp variable to detect if we need to print the beginning of the error - # change list holds the strings to print in an error message - changelist = [requesttype, " ", file_path, " did not match previous results. If you are adding changes to SynBioHub that change this page, please check that the page is correct and update the file using the command line argument --resetgetrequests [requests] and --resetpostrequests [requests].\nThe following is a diff of the new files compared to the old.\n"] + for c in changes: + changelist.append(c) - # temp variable to detect if we need to print the beginning of the error - numofchanges = 0 - - for c in changes: - numofchanges += 1 - - # print the diff - changelist.append(c) changelist.append("\n") - changelist.append("\n Here is the last 50 lines of the synbiohub error log: \n") - changelist.append(get_end_of_error_log(50)) - - if numofchanges>0: raise ValueError(''.join(changelist)) - def login_with(data, headers = {'Accept':'text/plain'}): result = post_request("login", data, headers, [], files = None) test_state.save_authentication(result) - def compare_get_request(request, test_name = "", route_parameters = [], headers = {}, re_render_time = 0): """Complete a get request and error if it differs from previous results. page @@ -280,6 +299,24 @@ def compare_get_request_download(request, test_name = "", route_parameters = [], compare_request(get_request_download(request, headers, route_parameters, re_render_time), request, "get_file request", route_parameters, testpath) +def compare_get_request_json(request, test_name = "", route_parameters = [], headers = {}, re_render_time = 0): + """Complete a get_file request and error if it differs from previous results. + + request -- string, the name of the page being requested + route_parameters -- a ordered lists of the parameters for the endpoint + test_name -- a name to make the request unique from another test of this endpoint + headers -- a dictionary of headers to include in the request + re_render_time -- time to wait in milliseconds before rendering javascript again""" + + # remove any leading forward slashes for consistency + request = clip_request(request) + + testpath = request_file_path_download(request, "get_file_json", test_name) + test_state.add_get_request(request, testpath, test_name) + + compare_request(get_request_download(request, headers, route_parameters, re_render_time), request, "get_file_json", route_parameters, testpath) + + def compare_post_request(request, data, test_name = "", route_parameters = [], headers = {}, files = None): """Complete a post request and error if it differs from previous results.