Nupack error with subsequent pknot refold #786
Labels
priority: p3/standard
Enhancement with nominal value or bug with nominal impact
size: md
type: bug
Something isn't working
Expected Behavior
No error/crash
Current Behavior
Reproduction Steps
In puzzlemaker:
.((({{..((((.....)))).))).((((((...{{{....)))).........}}}..........}}.))...
AGCACGUUUCGAAAAAAUCGAUUGCACCCAGAACACGCAAAAUCUGAAAAAAAAAGCGAAACAAAAAUCGAGGUGC
In unit test:
Note that if the problem sequence is the first fold to happen when the engine is loaded, all is fine. This only occurs on subsequent folds. I'm guessing there's some nupack global not being reset properly or memory corruption or something.
Environment
No response
Other information
https://forum.eternagame.org/t/error-on-mutation-in-pseudoknot-puzzle/4697/7
The text was updated successfully, but these errors were encountered: