diff --git a/.devcontainer/devcontainer.json b/.devcontainer/devcontainer.json index ea27a584..4ecfbfe3 100644 --- a/.devcontainer/devcontainer.json +++ b/.devcontainer/devcontainer.json @@ -2,6 +2,7 @@ "name": "nfcore", "image": "nfcore/gitpod:latest", "remoteUser": "gitpod", + "runArgs": ["--privileged"], // Configure tool-specific properties. "customizations": { diff --git a/.editorconfig b/.editorconfig index b78de6e6..b6b31907 100644 --- a/.editorconfig +++ b/.editorconfig @@ -8,7 +8,7 @@ trim_trailing_whitespace = true indent_size = 4 indent_style = space -[*.{md,yml,yaml,html,css,scss,js,cff}] +[*.{md,yml,yaml,html,css,scss,js}] indent_size = 2 # These files are edited and tested upstream in nf-core/modules diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index d4b48eae..5e32dfd8 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -9,7 +9,9 @@ Please use the pre-filled template to save time. However, don't be put off by this template - other more general issues and suggestions are welcome! Contributions to the code are even more welcome ;) -> If you need help using or modifying nf-core/rnafusion then the best place to ask is on the nf-core Slack [#rnafusion](https://nfcore.slack.com/channels/rnafusion) channel ([join our Slack here](https://nf-co.re/join/slack)). +:::info +If you need help using or modifying nf-core/rnafusion then the best place to ask is on the nf-core Slack [#rnafusion](https://nfcore.slack.com/channels/rnafusion) channel ([join our Slack here](https://nf-co.re/join/slack)). +::: ## Contribution workflow @@ -116,4 +118,3 @@ To get started: Devcontainer specs: - [DevContainer config](.devcontainer/devcontainer.json) -- [Dockerfile](.devcontainer/Dockerfile) diff --git a/.github/ISSUE_TEMPLATE/bug_report.yml b/.github/ISSUE_TEMPLATE/bug_report.yml index 8ed5ffe6..7755ffb4 100644 --- a/.github/ISSUE_TEMPLATE/bug_report.yml +++ b/.github/ISSUE_TEMPLATE/bug_report.yml @@ -42,9 +42,9 @@ body: attributes: label: System information description: | - * Nextflow version _(eg. 22.10.1)_ + * Nextflow version _(eg. 23.04.0)_ * Hardware _(eg. HPC, Desktop, Cloud)_ * Executor _(eg. slurm, local, awsbatch)_ - * Container engine: _(e.g. Docker, Singularity, Conda, Podman, Shifter or Charliecloud)_ + * Container engine: _(e.g. Docker, Singularity, Conda, Podman, Shifter, Charliecloud, or Apptainer)_ * OS _(eg. CentOS Linux, macOS, Linux Mint)_ * Version of nf-core/rnafusion _(eg. 1.1, 1.5, 1.8.2)_ diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index 6f604f38..5cc076f3 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -15,7 +15,8 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/rnaf - [ ] This comment contains a description of changes (with reason). - [ ] If you've fixed a bug or added code that should be tested, add tests! -- [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/rnafusion/tree/master/.github/CONTRIBUTING.md)- [ ] If necessary, also make a PR on the nf-core/rnafusion _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. +- [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/rnafusion/tree/master/.github/CONTRIBUTING.md) +- [ ] If necessary, also make a PR on the nf-core/rnafusion _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. - [ ] Make sure your code lints (`nf-core lint`). - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). - [ ] Usage Documentation in `docs/usage.md` is updated. diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index caad7c58..d2c448d7 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -13,183 +13,34 @@ jobs: if: github.repository == 'nf-core/rnafusion' runs-on: ubuntu-latest steps: - - name: Launch build arriba workflow via tower - uses: nf-core/tower-action@v3 + - name: Launch build references workflow via tower + uses: seqeralabs/action-tower-launch@v2 with: workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} + revision: ${{ github.sha }} workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} parameters: | { + "hook_url": "${{ secrets.MEGATESTS_ALERTS_SLACK_HOOK_URL }}", "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", "cosmic_username": "${{ secrets.cosmic_username }}", "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "arriba": true, + "all": true, "build_references": true } profiles: test_full,aws_tower - - - name: Launch arriba workflow via tower - uses: nf-core/tower-action@v3 + - uses: actions/upload-artifact@v3 with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "arriba": true, - } - profiles: test_full,aws_tower - - - name: Launch build squid workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "squid": true, - "build_references": true - } - profiles: test_full,aws_tower - - - name: Launch squid workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "squid": true, - } - profiles: test_full,aws_tower - - - name: Launch build starfusion workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "starfusion": true, - "build_references": true - } - profiles: test_full,aws_tower - - - name: Launch starfusion workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "starfusion": true, - } - profiles: test_full,aws_tower - - - name: Launch build fusioncatcher workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "fusioncatcher": true, - "build_references": true - } - profiles: test_full,aws_tower - - - name: Launch fusioncatcher workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "fusioncatcher": true, - } - profiles: test_full,aws_tower - - - name: Launch build pizzly workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "pizzly": true, - "build_references": true - } - profiles: test_full,aws_tower - - - name: Launch pizzly workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "pizzly": true, - } - profiles: test_full,aws_tower + name: Tower debug log file + path: | + tower_action_*.log + tower_action_*.json - - name: Launch stringtie workflow via tower - uses: nf-core/tower-action@v3 + - name: Launch run workflow via tower + uses: seqeralabs/action-tower-launch@v2 with: workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} @@ -201,6 +52,6 @@ jobs: "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", "cosmic_username": "${{ secrets.cosmic_username }}", "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "stringtie": true, + "all": true, } profiles: test_full,aws_tower diff --git a/.github/workflows/awstest.yml b/.github/workflows/awstest.yml index 036579de..b72a293b 100644 --- a/.github/workflows/awstest.yml +++ b/.github/workflows/awstest.yml @@ -11,12 +11,13 @@ jobs: runs-on: ubuntu-latest steps: # Launch workflow using Tower CLI tool action - - name: Launch build arriba workflow via tower - uses: nf-core/tower-action@v3 + - name: Launch build references workflow via tower + uses: seqeralabs/action-tower-launch@v2 with: workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} + revision: ${{ github.sha }} workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} parameters: | { @@ -24,162 +25,20 @@ jobs: "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", "cosmic_username": "${{ secrets.cosmic_username }}", "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "arriba": true, + "all": true, "stub": true, "build_references": true } profiles: test,aws_tower - - - name: Launch arriba workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "arriba": true, - "stub": true - } - profiles: test,aws_tower - - - name: Launch build squid workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "squid": true, - "stub": true, - "build_references": true - } - profiles: test,aws_tower - - - name: Launch squid workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "squid": true, - "stub": true - } - profiles: test,aws_tower - - - name: Launch build starfusion workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "starfusion": true, - "build_references": true, - "stub": true - } - profiles: test,aws_tower - - - name: Launch starfusion workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "starfusion": true, - "stub": true - } - profiles: test,aws_tower - - - name: Launch build fusioncatcher workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "fusioncatcher": true, - "build_references": true, - "stub": true - } - profiles: test,aws_tower - - - name: Launch fusioncatcher workflow via tower - uses: nf-core/tower-action@v3 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "fusioncatcher": true, - "stub": true - } - profiles: test,aws_tower - - - name: Launch build pizzly workflow via tower - uses: nf-core/tower-action@v3 + - uses: actions/upload-artifact@v3 with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "pizzly": true, - "build_references": true, - "stub": true - } - profiles: test,aws_tower + name: Tower debug log file + path: | + tower_action_*.log + tower_action_*.json - - name: Launch pizzly workflow via tower - uses: nf-core/tower-action@v3 + - name: Launch arriba workflow via tower + uses: seqeralabs/action-tower-launch@v2 with: workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} @@ -191,25 +50,13 @@ jobs: "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", "cosmic_username": "${{ secrets.cosmic_username }}", "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "pizzly": true, + "all": true, "stub": true } profiles: test,aws_tower - - - name: Launch stringtie workflow via tower - uses: nf-core/tower-action@v3 + - uses: actions/upload-artifact@v3 with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/rnafusion/work-${{ github.sha }} - parameters: | - { - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/rnafusion/results-${{ github.sha }}/references", - "cosmic_username": "${{ secrets.cosmic_username }}", - "cosmic_passwd": "${{ secrets.cosmic_passwd }}", - "stringtie": true, - "stub": true - } - profiles: test,aws_tower + name: Tower debug log file + path: | + tower_action_*.log + tower_action_*.json diff --git a/.github/workflows/branch.yml b/.github/workflows/branch.yml index ccb7211b..3867817a 100644 --- a/.github/workflows/branch.yml +++ b/.github/workflows/branch.yml @@ -13,7 +13,7 @@ jobs: - name: Check PRs if: github.repository == 'nf-core/rnafusion' run: | - { [[ ${{github.event.pull_request.head.repo.full_name }} == nf-core/rnafusion ]] && [[ $GITHUB_HEAD_REF = "dev" ]]; } || [[ $GITHUB_HEAD_REF == "patch" ]] + { [[ ${{github.event.pull_request.head.repo.full_name }} == nf-core/rnafusion ]] && [[ $GITHUB_HEAD_REF == "dev" ]]; } || [[ $GITHUB_HEAD_REF == "patch" ]] # If the above check failed, post a comment on the PR explaining the failure # NOTE - this doesn't currently work if the PR is coming from a fork, due to limitations in GitHub actions secrets diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 30db85cf..6f960cad 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -24,8 +24,11 @@ jobs: strategy: matrix: NXF_VER: - - "22.10.1" + - "23.04.0" - "latest-everything" + trim_parameters: + - "--fastp_trim false" + - "--fastp_trim true" steps: - name: Check out pipeline code uses: actions/checkout@v3 @@ -35,72 +38,15 @@ jobs: with: version: "${{ matrix.NXF_VER }}" - - name: Dry test arriba build + - name: Dry test build run: | nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub --build_references \ - --outdir /home/runner/work/rnafusion/rnafusion/results --arriba \ + --outdir /home/runner/work/rnafusion/rnafusion/results --all \ --genomes_base /home/runner/work/rnafusion/rnafusion/results/references \ --cosmic_username ${{ secrets.COSMIC_USERNAME }} --cosmic_passwd ${{ secrets.COSMIC_PASSWD }} - - name: Dry test arriba + - name: Dry test run run: | nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub \ - --outdir /home/runner/work/rnafusion/rnafusion/results --arriba \ - --genomes_base /home/runner/work/rnafusion/rnafusion/results/references \ - --cosmic_username ${{ secrets.COSMIC_USERNAME }} --cosmic_passwd ${{ secrets.COSMIC_PASSWD }} - - - name: Dry test squid build - run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub --build_references \ - --outdir /home/runner/work/rnafusion/rnafusion/results --squid \ - --genomes_base /home/runner/work/rnafusion/rnafusion/results/references \ - --cosmic_username ${{ secrets.COSMIC_USERNAME }} --cosmic_passwd ${{ secrets.COSMIC_PASSWD }} - - - name: Dry test squid - run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub \ - --outdir /home/runner/work/rnafusion/rnafusion/results --squid \ - --genomes_base /home/runner/work/rnafusion/rnafusion/results/references \ - --cosmic_username ${{ secrets.COSMIC_USERNAME }} --cosmic_passwd ${{ secrets.COSMIC_PASSWD }} - - - name: Dry test pizzly build - run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub --build_references \ - --outdir /home/runner/work/rnafusion/rnafusion/results --pizzly \ - --genomes_base /home/runner/work/rnafusion/rnafusion/results/references \ - --cosmic_username ${{ secrets.COSMIC_USERNAME }} --cosmic_passwd ${{ secrets.COSMIC_PASSWD }} - - - name: Dry test pizzly - run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub \ - --outdir /home/runner/work/rnafusion/rnafusion/results --pizzly \ - --genomes_base /home/runner/work/rnafusion/rnafusion/results/references \ - --cosmic_username ${{ secrets.COSMIC_USERNAME }} --cosmic_passwd ${{ secrets.COSMIC_PASSWD }} - - - name: Dry test fusioncatcher build - run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub --build_references \ - --outdir /home/runner/work/rnafusion/rnafusion/results --fusioncatcher \ - --genomes_base /home/runner/work/rnafusion/rnafusion/results/references \ - --cosmic_username ${{ secrets.COSMIC_USERNAME }} --cosmic_passwd ${{ secrets.COSMIC_PASSWD }} - - - name: Dry test fusioncatcher - run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub \ - --outdir /home/runner/work/rnafusion/rnafusion/results --fusioncatcher \ - --genomes_base /home/runner/work/rnafusion/rnafusion/results/references \ - --cosmic_username ${{ secrets.COSMIC_USERNAME }} --cosmic_passwd ${{ secrets.COSMIC_PASSWD }} - - - name: Dry test starfusion build - run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub build_references \ - --outdir /home/runner/work/rnafusion/rnafusion/results --starfusion \ - --genomes_base /home/runner/work/rnafusion/rnafusion/results/references \ - --cosmic_username ${{ secrets.COSMIC_USERNAME }} --cosmic_passwd ${{ secrets.COSMIC_PASSWD }} - - - name: Dry test starfusion - run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub \ - --outdir /home/runner/work/rnafusion/rnafusion/results --starfusion \ - --genomes_base /home/runner/work/rnafusion/rnafusion/results/references \ - --cosmic_username ${{ secrets.COSMIC_USERNAME }} --cosmic_passwd ${{ secrets.COSMIC_PASSWD }} + --outdir /home/runner/work/rnafusion/rnafusion/results --all ${{ matrix.trim_parameters }} \ + --genomes_base /home/runner/work/rnafusion/rnafusion/results/references diff --git a/.github/workflows/clean-up.yml b/.github/workflows/clean-up.yml new file mode 100644 index 00000000..694e90ec --- /dev/null +++ b/.github/workflows/clean-up.yml @@ -0,0 +1,24 @@ +name: "Close user-tagged issues and PRs" +on: + schedule: + - cron: "0 0 * * 0" # Once a week + +jobs: + clean-up: + runs-on: ubuntu-latest + permissions: + issues: write + pull-requests: write + steps: + - uses: actions/stale@v7 + with: + stale-issue-message: "This issue has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor. Remove stale label or add a comment otherwise this issue will be closed in 20 days." + stale-pr-message: "This PR has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor. Remove stale label or add a comment if it is still useful." + close-issue-message: "This issue was closed because it has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor and then staled for 20 days with no activity." + days-before-stale: 30 + days-before-close: 20 + days-before-pr-close: -1 + any-of-labels: "awaiting-changes,awaiting-feedback" + exempt-issue-labels: "WIP" + exempt-pr-labels: "WIP" + repo-token: "${{ secrets.GITHUB_TOKEN }}" diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index 858d622e..b8bdd214 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -78,7 +78,7 @@ jobs: - uses: actions/setup-python@v4 with: - python-version: "3.7" + python-version: "3.11" architecture: "x64" - name: Install dependencies diff --git a/.github/workflows/release-announcments.yml b/.github/workflows/release-announcments.yml new file mode 100644 index 00000000..6ad33927 --- /dev/null +++ b/.github/workflows/release-announcments.yml @@ -0,0 +1,68 @@ +name: release-announcements +# Automatic release toot and tweet anouncements +on: + release: + types: [published] + workflow_dispatch: + +jobs: + toot: + runs-on: ubuntu-latest + steps: + - uses: rzr/fediverse-action@master + with: + access-token: ${{ secrets.MASTODON_ACCESS_TOKEN }} + host: "mstdn.science" # custom host if not "mastodon.social" (default) + # GitHub event payload + # https://docs.github.com/en/developers/webhooks-and-events/webhooks/webhook-events-and-payloads#release + message: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + + send-tweet: + runs-on: ubuntu-latest + + steps: + - uses: actions/setup-python@v4 + with: + python-version: "3.10" + - name: Install dependencies + run: pip install tweepy==4.14.0 + - name: Send tweet + shell: python + run: | + import os + import tweepy + + client = tweepy.Client( + access_token=os.getenv("TWITTER_ACCESS_TOKEN"), + access_token_secret=os.getenv("TWITTER_ACCESS_TOKEN_SECRET"), + consumer_key=os.getenv("TWITTER_CONSUMER_KEY"), + consumer_secret=os.getenv("TWITTER_CONSUMER_SECRET"), + ) + tweet = os.getenv("TWEET") + client.create_tweet(text=tweet) + env: + TWEET: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + TWITTER_CONSUMER_KEY: ${{ secrets.TWITTER_CONSUMER_KEY }} + TWITTER_CONSUMER_SECRET: ${{ secrets.TWITTER_CONSUMER_SECRET }} + TWITTER_ACCESS_TOKEN: ${{ secrets.TWITTER_ACCESS_TOKEN }} + TWITTER_ACCESS_TOKEN_SECRET: ${{ secrets.TWITTER_ACCESS_TOKEN_SECRET }} + + bsky-post: + runs-on: ubuntu-latest + steps: + - uses: zentered/bluesky-post-action@v0.0.2 + with: + post: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + env: + BSKY_IDENTIFIER: ${{ secrets.BSKY_IDENTIFIER }} + BSKY_PASSWORD: ${{ secrets.BSKY_PASSWORD }} + # diff --git a/.gitpod.yml b/.gitpod.yml index 85d95ecc..25488dcc 100644 --- a/.gitpod.yml +++ b/.gitpod.yml @@ -1,4 +1,9 @@ image: nfcore/gitpod:latest +tasks: + - name: Update Nextflow and setup pre-commit + command: | + pre-commit install --install-hooks + nextflow self-update vscode: extensions: # based on nf-core.nf-core-extensionpack diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml new file mode 100644 index 00000000..0c31cdb9 --- /dev/null +++ b/.pre-commit-config.yaml @@ -0,0 +1,5 @@ +repos: + - repo: https://github.com/pre-commit/mirrors-prettier + rev: "v2.7.1" + hooks: + - id: prettier diff --git a/CHANGELOG.md b/CHANGELOG.md index ff835124..5808266d 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,88 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## v2.3.0 = [2022/04/24] +## v3.0.1 - [2023-11-29] + +### Added + +### Changed + +- python3 explicit in vcf_collect [#452](https://github.com/nf-core/rnafusion/pull/452) + +### Fixed + +- software-version.yml and in general version track-keeping was incomplete [#451](https://github.com/nf-core/rnafusion/pull/451) + +### Removed + +## v3.0.0 - [2023-11-27] + +### Added + +- Add picard CollectInsertSizeMetrics to QC workflow [#408](https://github.com/nf-core/rnafusion/pull/408) +- Build CRAM index in the same directory as CRAM files for Arriba and STAR-Fusion [#427](https://github.com/nf-core/rnafusion/pull/427) + +### Changed + +- Replace PICARD_MARKDUPLICATES with GATK4_MARKDUPLICATES [#409](https://github.com/nf-core/rnafusion/pull/409) +- Removed `--fusioninspector_filter` and `--fusionreport_filter` in favor of `--tools_cutoff` (default = 1, no filters applied) [#389](https://github.com/nf-core/rnafusion/pull/389) +- Now publishing convert2bed output to convert2bed to keep the output file [#420](https://github.com/nf-core/rnafusion/pull/420) +- No more checks for existence of samplesheet, which made building references fail (building references uses a fake sample sheet if none is provided) [#420](https://github.com/nf-core/rnafusion/pull/420) +- `--annotate --examine_coding_effect` to collect more data from fusioninspector [#426](https://github.com/nf-core/rnafusion/pull/426) +- Update vcf creation to get positions/chromosomes and strands even when fusions are filtered out by fusioninspector, using the csv output from fusion-report [#443](https://github.com/nf-core/rnafusion/pull/443) +- `Arriba` updated to 2.4.0 [#429](https://github.com/nf-core/rnafusion/pull/429) +- Change megafusion into vcf_collect, taking into account e.g. the annotation and coding effects outputs from fusioninspector, HGNC ids, frame status... [#414](https://github.com/nf-core/rnafusion/pull/414) +- CI tests on `--all` instead of each tool separately, and include trimmed/not trimmed matrix tests [#430](https://github.com/nf-core/rnafusion/pull/430) +- AWS tests on `--all` instead of each tool separately, and include trimmed/not trimmed matrix tests [#433](https://github.com/nf-core/rnafusion/pull/433) +- Update `fusion-report` to 2.1.8, updated COSMIC database to fix 404 error, fix download of references via proxy and removing FusionGDB database [#445](https://github.com/nf-core/rnafusion/pull/445) +- Update documentation [#446](https://github.com/nf-core/rnafusion/pull/446) + +### Fixed + +- Fix channel i/o issue in StringTie workflow and add StringTie in github CI tests [#416](https://github.com/nf-core/rnafusion/pull/416) +- Update modules, and make sure MultiQC displays the QC results properly [#440](https://github.com/nf-core/rnafusion/pull/440) +- Add 'when' condition to run CollectInsertSizeMetrics only when STAR-fusion bam files are available [#444](https://github.com/nf-core/rnafusion/pull/444) + +### Removed + +- Remove `squid` and `pizzly` fusion detection tools [#406](https://github.com/nf-core/rnafusion/pull/406) +- Remove harsh trimming option `--trim` [#413](https://github.com/nf-core/rnafusion/pull/413) +- Remove qualimap rna_seq [#407](https://github.com/nf-core/rnafusion/pull/407) + +## v2.4.0 - [2023/09/22] + +### Added + +### Changed + +- Use institutional configs by default [#381](https://github.com/nf-core/rnafusion/pull/381) +- Remove redundant indexing in starfusion and qc workflows [#387](https://github.com/nf-core/rnafusion/pull/387) +- Output bai files in same directory as bam files [#387](https://github.com/nf-core/rnafusion/pull/387) +- Update and review documentation [#396](https://github.com/nf-core/rnafusion/pull/396) +- Update picard container for `PICARD_COLLECTRNASEQMETRICS` to 3.0.0 [#395](https://github.com/nf-core/rnafusion/pull/395) +- Renamed output files [#395](https://github.com/nf-core/rnafusion/pull/395) + - `Arriba` visualisation pdf from meta.id to meta.id_combined_fusions_arriba_visualisation + - cram file from output bam of `STAR_FOR_ARRIBA`: meta.id to meta.id_star_for_arriba + - cram file from output bam of `STAR_FOR_STARFUSION`: meta.id to meta.id.star_for_starfusion.Aligned.sortedByCoord.out + - `fusion-report` index.html file to meta.id_fusionreport_index.html + - meta.id.vcf output from `MEGAFUSION` to meta.id_fusion_data.vcf + - Update metro map [#428](https://github.com/nf-core/rnafusion/pull/428) + +### Fixed + +- Tail trimming for reverse reads [#379](https://github.com/nf-core/rnafusion/pull/379) +- Set html files as optional in fusionreport [#380](https://github.com/nf-core/rnafusion/pull/380) +- Provide gene count file by default when running STAR_FOR_STARFUSION [#385](https://github.com/nf-core/rnafusion/pull/385) +- Fix fusion-report issue with MACOXS directories [#386](https://github.com/nf-core/rnafusion/pull/386) +- The fusion lists is updated to contain two branches, one in case no fusions are detected and one for if fusions are detected, that will be used to feed to fusioninspector, megafusion, arriba visualisation [#388](https://github.com/nf-core/rnafusion/pull/388) +- Update fusionreport to 2.1.5p4 to fix 403 error in downloading databases [#403](https://github.com/nf-core/rnafusion/pull/403) + +### Removed + +- `samtools sort` and `samtools index` for `arriba` workflow were dispensable and were removed [#395](https://github.com/nf-core/rnafusion/pull/395) +- Removed trimmed fastqc report from multiqc [#394](https://github.com/nf-core/rnafusion/pull/394) + +## v2.3.0 - [2023/04/24] ### Added @@ -26,7 +107,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### Removed -## v2.2.0 - [2022/03/13] +## v2.2.0 - [2023/03/13] ### Added @@ -63,7 +144,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 - FUSIONINSPECTOR_DEV process as the option fusioninspector_limitSjdbInsertNsj is part of the main starfusion release -## [2.1.0] nfcore/rnafusion - 2022/07/12 +## v2.1.0 - [2022/07/12] ### Added @@ -97,7 +178,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### Removed -## [2.0.0] nfcore/rnafusion - 2022/05/19 +## v2.0.0 - [2022/05/19] Update to DSL2 and newer software/reference versions @@ -239,7 +320,7 @@ to - GRCh37 support. Subdirectory with params.genome are removed - Running with conda -## v1.3.0dev nfcore/rnafusion - 2020/07/15 +## v1.3.0 - [2020/07/15] - Using official STAR-Fusion container [#160](https://github.com/nf-core/rnafusion/issues/160) @@ -270,7 +351,7 @@ to --- -## [1.1.0] nfcore/rnafusion - 2020/02/10 +## v1.1.0 - [2020/02/10] - Fusion gene detection tools: - `Arriba v1.1.0` @@ -318,7 +399,7 @@ to --- -## [1.0.2] nfcore/rnafusion - 2019/05/13 +## v1.0.2 - [2019/05/13] ### Changed @@ -332,7 +413,7 @@ to --- -## [1.0.1] nfcore/rnafusion - 2019/04/06 +## v1.0.1 - [2019/04/06] ### Added @@ -360,7 +441,7 @@ to --- -## [1.0] nfcore/rnafusion - 2018/02/14 +## v1.0 - [2018/02/14] Version 1.0 marks the first production release of this pipeline under the nf-core flag. The pipeline includes additional help scripts to download references for fusion tools and Singularity images. diff --git a/CITATIONS.md b/CITATIONS.md index 1a3482ac..f058a245 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -10,39 +10,49 @@ ## Pipeline tools -- [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) +- [Arriba](https://github.com/suhrig/arriba) -- [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) + > Uhrig S, Ellermann J, Walther T, Burkhardt P, Fröhlich M, Hutter B, Toprak UH, Neumann O, Stenzinger A, Scholl C, Fröhling S, Brors B. Accurate and efficient detection of gene fusions from RNA sequencing data. Genome Research. 2021 Mar 31;448-460. doi: 10.1101/gr.257246.119. Epub 2021 Jan 13. PubMed PMID: 33441414. - > Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. +- [BEDOPS](https://bedops.readthedocs.io/en/latest/index.html) - convert2bed -- [Arriba](https://github.com/suhrig/arriba) + > Neph S, Scott Kuehn M, Reynolds AP, Haugen E, Thurman RE, Johnson AK, Rynes E, Maurano MT, Vierstra J, Thomas S, Sandstrom R, Humbert R, Stamatoyannopoulos JA. BEDOPS: high-performance genomic feature operations. Bioinformatics. 2012 May, 28 (14): 1919-1920. doi: 10.1093/bioinformatics/bts277, PubMed PMID: PMID: 22576172. - > Uhrig S, Ellermann J, Walther T, Burkhardt P, Fröhlich M, Hutter B, Toprak UH, Neumann O, Stenzinger A, Scholl C, Fröhling S, Brors B. Accurate and efficient detection of gene fusions from RNA sequencing data. - > Genome Research. 2021 Mar 31;448-460. doi: 10.1101/gr.257246.119. Epub 2021 Jan 13. PubMed PMID: 33441414; PubMed Central PMCID: PMC7919457. +- [FastP](https://academic.oup.com/bioinformatics/article/34/17/i884/5093234) + + > Shifu Chen, Yanqing Zhou, Yaru Chen, Jia Gu. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018 Sept 34:17 (i884–i890), doi: 10.1093/bioinformatics/bty560. PubMed PMID: 30423086. PubMed Central PMCID: PMC6129281 + +- [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) + + > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. - [FusionCatcher](https://github.com/ndaniel/fusioncatcher) > Nicorici D, Satalan M, Edgren H, Kangaspeska S, Murumagi A, Kallioniemi O, Virtanen S, Kilkku O. FusionCatcher – a tool for finding somatic fusion genes in paired-end RNA-sequencing data. BioRxiv, 2014 Nov. doi: 10.1101/011650. +- [FusionInspector](https://github.com/FusionInspector/FusionInspector) + + > Haas BJ, Dobin A, Ghandi M, Van Arsdale A, Tickle T, Robinson JT, Gillani R, Kasif S, Regev A. Targeted in silico characterization of fusion transcripts in tumor and normal tissues via FusionInspector. Cell Reports Methods. 2023 May 3:5, doi: 10.1016/j.crmeth.2023.100467, PMID: 37323575 + - [Fusion-report](https://github.com/matq007/fusion-report) > Proks M, Genomic Profiling of a Comprehensive Nation-wide Collection of Childhood Solid Tumors, Master Thesis, Supervisors: Grøntved L, Díaz de Ståhl T, Nistér M, Ewels P, Garcia MU, Juhos S, University of Southern Denmark, 2019, unpublished. -- [Kallisto](https://pachterlab.github.io/kallisto/) +- [GATK4](https://gatk.broadinstitute.org/hc/en-us) - > Bray NL, Pimentel H, Melsted P, Pachter L. Near-optimal probabilistic RNA-seq quantification. Nature Biotechnology 2016 Apr. 34, 525–527. doi:10.1038/nbt.3519. PMID: 27043002. + > Van der Auwera GA. Somatic variation discovery with GATK4. Proceedings of the American Association for Cancer Research Annual Meeting 2017. 2017 Apr 1-5. Cancer Res 2017;77(13 Suppl) doi:10.1158/1538-7445.AM2017-3590 -- [Pizzly](https://github.com/pmelsted/pizzly) - Melsted P, Hateley S, Joseph IC, Pimentel H, Bray N, Pachter L. Fusion detection and quantification by pseudoalignment. BioRxiv, 2017 Jul. doi: 10.1101/166322. +- [MegaFusion](https://github.com/J35P312/MegaFusion) -- [SAMtools](https://pubmed.ncbi.nlm.nih.gov/19505943/) +- [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) - > Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R; 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009 Aug 15;25(16):2078-9. doi: 10.1093/bioinformatics/btp352. Epub 2009 Jun 8. PubMed PMID: 19505943; PubMed Central PMCID: PMC2723002. + > Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. -- [Squid](https://github.com/Kingsford-Group/squid) +- [picard-tools](http://broadinstitute.github.io/picard) - > Ma C, Shao M, Kingsford C. SQUID: transcriptomic structural variation detection from RNA-seq. Genome Biol 2028 Apr. 19, 52. doi: 10.1186/s13059-018-1421-5. PubMed PMID: 29650026. PubMed Central PMCID: PMC5896115. +- [SAMtools](https://pubmed.ncbi.nlm.nih.gov/19505943/) + + > Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R; 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009 Aug 15;25(16):2078-9. doi: 10.1093/bioinformatics/btp352. Epub 2009 Jun 8. PubMed PMID: 19505943; PubMed Central PMCID: PMC2723002. - [STAR](https://pubmed.ncbi.nlm.nih.gov/23104886/) @@ -71,5 +81,8 @@ - [Docker](https://dl.acm.org/doi/10.5555/2600239.2600241) + > Merkel, D. (2014). Docker: lightweight linux containers for consistent development and deployment. Linux Journal, 2014(239), 2. doi: 10.5555/2600239.2600241. + - [Singularity](https://pubmed.ncbi.nlm.nih.gov/28494014/) + > Kurtzer GM, Sochat V, Bauer MW. Singularity: Scientific containers for mobility of compute. PLoS One. 2017 May 11;12(5):e0177459. doi: 10.1371/journal.pone.0177459. eCollection 2017. PubMed PMID: 28494014; PubMed Central PMCID: PMC5426675. diff --git a/CODE_OF_CONDUCT.md b/CODE_OF_CONDUCT.md index f4fd052f..c089ec78 100644 --- a/CODE_OF_CONDUCT.md +++ b/CODE_OF_CONDUCT.md @@ -1,18 +1,20 @@ -# Code of Conduct at nf-core (v1.0) +# Code of Conduct at nf-core (v1.4) ## Our Pledge -In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core, pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of: +In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of: - Age +- Ability - Body size +- Caste - Familial status - Gender identity and expression - Geographical location - Level of experience - Nationality and national origins - Native language -- Physical and neurological ability +- Neurodiversity - Race or ethnicity - Religion - Sexual identity and orientation @@ -22,80 +24,133 @@ Please note that the list above is alphabetised and is therefore not ranked in a ## Preamble -> Note: This Code of Conduct (CoC) has been drafted by the nf-core Safety Officer and been edited after input from members of the nf-core team and others. "We", in this document, refers to the Safety Officer and members of the nf-core core team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will amended periodically to keep it up-to-date, and in case of any dispute, the most current version will apply. +:::note +This Code of Conduct (CoC) has been drafted by Renuka Kudva, Cris Tuñí, and Michael Heuer, with input from the nf-core Core Team and Susanna Marquez from the nf-core community. "We", in this document, refers to the Safety Officers and members of the nf-core Core Team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will be amended periodically to keep it up-to-date. In case of any dispute, the most current version will apply. +::: -An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about). Our current safety officer is Renuka Kudva. +An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about). + +Our Safety Officers are Saba Nafees, Cris Tuñí, and Michael Heuer. nf-core is a young and growing community that welcomes contributions from anyone with a shared vision for [Open Science Policies](https://www.fosteropenscience.eu/taxonomy/term/8). Open science policies encompass inclusive behaviours and we strive to build and maintain a safe and inclusive environment for all individuals. -We have therefore adopted this code of conduct (CoC), which we require all members of our community and attendees in nf-core events to adhere to in all our workspaces at all times. Workspaces include but are not limited to Slack, meetings on Zoom, Jitsi, YouTube live etc. +We have therefore adopted this CoC, which we require all members of our community and attendees of nf-core events to adhere to in all our workspaces at all times. Workspaces include, but are not limited to, Slack, meetings on Zoom, gather.town, YouTube live etc. -Our CoC will be strictly enforced and the nf-core team reserve the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities. +Our CoC will be strictly enforced and the nf-core team reserves the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities. -We ask all members of our community to help maintain a supportive and productive workspace and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC. +We ask all members of our community to help maintain supportive and productive workspaces and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC. -Questions, concerns or ideas on what we can include? Contact safety [at] nf-co [dot] re +Questions, concerns, or ideas on what we can include? Contact members of the Safety Team on Slack or email safety [at] nf-co [dot] re. ## Our Responsibilities -The safety officer is responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour. +Members of the Safety Team (the Safety Officers) are responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour. -The safety officer in consultation with the nf-core core team have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this Code of Conduct, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful. +The Safety Team, in consultation with the nf-core core team, have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this CoC, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful. -Members of the core team or the safety officer who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and be subject to the same actions as others in violation of the CoC. +Members of the core team or the Safety Team who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and will be subject to the same actions as others in violation of the CoC. -## When are where does this Code of Conduct apply? +## When and where does this Code of Conduct apply? -Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events. This includes but is not limited to the following listed alphabetically and therefore in no order of preference: +Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events, such as hackathons, workshops, bytesize, and collaborative workspaces on gather.town. These guidelines include, but are not limited to, the following (listed alphabetically and therefore in no order of preference): - Communicating with an official project email address. - Communicating with community members within the nf-core Slack channel. - Participating in hackathons organised by nf-core (both online and in-person events). -- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence. -- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, Jitsi, YouTube live etc. +- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence, and on the nf-core gather.town workspace. +- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, gather.town, Jitsi, YouTube live etc. - Representing nf-core on social media. This includes both official and personal accounts. ## nf-core cares 😊 -nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include but are not limited to the following (listed in alphabetical order): +nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include, but are not limited to, the following (listed in alphabetical order): - Ask for consent before sharing another community member’s personal information (including photographs) on social media. - Be respectful of differing viewpoints and experiences. We are all here to learn from one another and a difference in opinion can present a good learning opportunity. -- Celebrate your accomplishments at events! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !) +- Celebrate your accomplishments! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !) - Demonstrate empathy towards other community members. (We don’t all have the same amount of time to dedicate to nf-core. If tasks are pending, don’t hesitate to gently remind members of your team. If you are leading a task, ask for help if you feel overwhelmed.) - Engage with and enquire after others. (This is especially important given the geographically remote nature of the nf-core community, so let’s do this the best we can) - Focus on what is best for the team and the community. (When in doubt, ask) -- Graciously accept constructive criticism, yet be unafraid to question, deliberate, and learn. +- Accept feedback, yet be unafraid to question, deliberate, and learn. - Introduce yourself to members of the community. (We’ve all been outsiders and we know that talking to strangers can be hard for some, but remember we’re interested in getting to know you and your visions for open science!) -- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communications to be kind.**) +- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communication to be kind.**) - Take breaks when you feel like you need them. -- Using welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack.) +- Use welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack) ## nf-core frowns on 😕 -The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this code of conduct. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces. +The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this CoC. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces: - Deliberate intimidation, stalking or following and sustained disruption of communication among participants of the community. This includes hijacking shared screens through actions such as using the annotate tool in conferencing software such as Zoom. - “Doxing” i.e. posting (or threatening to post) another person’s personal identifying information online. - Spamming or trolling of individuals on social media. -- Use of sexual or discriminatory imagery, comments, or jokes and unwelcome sexual attention. -- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion or work experience. +- Use of sexual or discriminatory imagery, comments, jokes, or unwelcome sexual attention. +- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion, or work experience. ### Online Trolling -The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the added issue of online trolling. This is unacceptable, reports of such behaviour will be taken very seriously, and perpetrators will be excluded from activities immediately. +The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the risk of online trolling. This is unacceptable — reports of such behaviour will be taken very seriously and perpetrators will be excluded from activities immediately. -All community members are required to ask members of the group they are working within for explicit consent prior to taking screenshots of individuals during video calls. +All community members are **required** to ask members of the group they are working with for explicit consent prior to taking screenshots of individuals during video calls. -## Procedures for Reporting CoC violations +## Procedures for reporting CoC violations If someone makes you feel uncomfortable through their behaviours or actions, report it as soon as possible. -You can reach out to members of the [nf-core core team](https://nf-co.re/about) and they will forward your concerns to the safety officer(s). +You can reach out to members of the Safety Team (Saba Nafees, Cris Tuñí, and Michael Heuer) on Slack. Alternatively, contact a member of the nf-core core team [nf-core core team](https://nf-co.re/about), and they will forward your concerns to the Safety Team. + +Issues directly concerning members of the Core Team or the Safety Team will be dealt with by other members of the core team and the safety manager — possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson and details will be shared in due course. + +All reports will be handled with the utmost discretion and confidentiality. + +You can also report any CoC violations to safety [at] nf-co [dot] re. In your email report, please do your best to include: + +- Your contact information. +- Identifying information (e.g. names, nicknames, pseudonyms) of the participant who has violated the Code of Conduct. +- The behaviour that was in violation and the circumstances surrounding the incident. +- The approximate time of the behaviour (if different than the time the report was made). +- Other people involved in the incident, if applicable. +- If you believe the incident is ongoing. +- If there is a publicly available record (e.g. mailing list record, a screenshot). +- Any additional information. + +After you file a report, one or more members of our Safety Team will contact you to follow up on your report. + +## Who will read and handle reports + +All reports will be read and handled by the members of the Safety Team at nf-core. + +If members of the Safety Team are deemed to have a conflict of interest with a report, they will be required to recuse themselves as per our Code of Conduct and will not have access to any follow-ups. + +To keep this first report confidential from any of the Safety Team members, please submit your first report by direct messaging on Slack/direct email to any of the nf-core members you are comfortable disclosing the information to, and be explicit about which member(s) you do not consent to sharing the information with. + +## Reviewing reports + +After receiving the report, members of the Safety Team will review the incident report to determine whether immediate action is required, for example, whether there is immediate threat to participants’ safety. + +The Safety Team, in consultation with members of the nf-core core team, will assess the information to determine whether the report constitutes a Code of Conduct violation, for them to decide on a course of action. + +In the case of insufficient information, one or more members of the Safety Team may contact the reporter, the reportee, or any other attendees to obtain more information. -Issues directly concerning members of the core team will be dealt with by other members of the core team and the safety manager, and possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson, and details will be shared in due course. +Once additional information is gathered, the Safety Team will collectively review and decide on the best course of action to take, if any. The Safety Team reserves the right to not act on a report. -All reports will be handled with utmost discretion and confidentially. +## Confidentiality + +All reports, and any additional information included, are only shared with the team of safety officers (and possibly members of the core team, in case the safety officer is in violation of the CoC). We will respect confidentiality requests for the purpose of protecting victims of abuse. + +We will not name harassment victims, beyond discussions between the safety officer and members of the nf-core team, without the explicit consent of the individuals involved. + +## Enforcement + +Actions taken by the nf-core’s Safety Team may include, but are not limited to: + +- Asking anyone to stop a behaviour. +- Asking anyone to leave the event and online spaces either temporarily, for the remainder of the event, or permanently. +- Removing access to the gather.town and Slack, either temporarily or permanently. +- Communicating to all participants to reinforce our expectations for conduct and remind what is unacceptable behaviour; this may be public for practical reasons. +- Communicating to all participants that an incident has taken place and how we will act or have acted — this may be for the purpose of letting event participants know we are aware of and dealing with the incident. +- Banning anyone from participating in nf-core-managed spaces, future events, and activities, either temporarily or permanently. +- No action. ## Attribution and Acknowledgements @@ -106,6 +161,22 @@ All reports will be handled with utmost discretion and confidentially. ## Changelog -### v1.0 - March 12th, 2021 +### v1.4 - February 8th, 2022 + +- Included a new member of the Safety Team. Corrected a typographical error in the text. + +### v1.3 - December 10th, 2021 + +- Added a statement that the CoC applies to nf-core gather.town workspaces. Corrected typographical errors in the text. + +### v1.2 - November 12th, 2021 + +- Removed information specific to reporting CoC violations at the Hackathon in October 2021. + +### v1.1 - October 14th, 2021 + +- Updated with names of new Safety Officers and specific information for the hackathon in October 2021. + +### v1.0 - March 15th, 2021 - Complete rewrite from original [Contributor Covenant](http://contributor-covenant.org/) CoC. diff --git a/README.md b/README.md index d5ccda0f..463d1e3f 100644 --- a/README.md +++ b/README.md @@ -1,37 +1,21 @@ # ![nf-core/rnafusion](docs/images/nf-core-rnafusion_logo_light.png#gh-light-mode-only) ![nf-core/rnafusion](docs/images/nf-core-rnafusion_logo_dark.png#gh-dark-mode-only) -[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/rnafusion/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.2565517-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.2565517) +[![GitHub Actions CI Status](https://github.com/nf-core/rnafusion/workflows/nf-core%20CI/badge.svg)](https://github.com/nf-core/rnafusion/actions?query=workflow%3A%22nf-core+CI%22) +[![GitHub Actions Linting Status](https://github.com/nf-core/rnafusion/workflows/nf-core%20linting/badge.svg)](https://github.com/nf-core/rnafusion/actions?query=workflow%3A%22nf-core+linting%22)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/rnafusion/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.3946477-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.3946477) -[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A522.10.1-23aa62.svg)](https://www.nextflow.io/) +[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/) [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/) [![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/) [![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/) [![Launch on Nextflow Tower](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Nextflow%20Tower-%234256e7)](https://tower.nf/launch?pipeline=https://github.com/nf-core/rnafusion) -[![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23rnafusion-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/rnafusion)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core) +[![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23rnafusion-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/rnafusion)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core) ## Introduction -**nf-core/rnafusion** is a bioinformatics best-practice analysis pipeline for RNA sequencing analysis pipeline with curated list of tools for detecting and visualizing fusion genes. +**nf-core/rnafusion** is a bioinformatics best-practice analysis pipeline for RNA sequencing consisting of several tools designed for detecting and visualizing fusion genes. Results from up to 5 fusion callers tools are created, and are also aggregated, most notably in a pdf visualiation document, a vcf data collection file, and html and tsv reports. -The pipeline is built using [Nextflow](https://www.nextflow.io), a workflow tool to run tasks across multiple compute infrastructures in a very portable manner. It uses Docker/Singularity containers making installation trivial and results highly reproducible. The [Nextflow DSL2](https://www.nextflow.io/docs/latest/dsl2.html) implementation of this pipeline uses one container per process which makes it much easier to maintain and update software dependencies. Where possible, these processes have been submitted to and installed from [nf-core/modules](https://github.com/nf-core/modules) in order to make them available to all nf-core pipelines, and to everyone within the Nextflow community! - -> **IMPORTANT: conda is not supported currently.** Run with singularity or docker. - -> GRCh38 is the only supported reference - -| Tool | Version | -| --------------------------------------------------------- | :------: | -| [Arriba](https://github.com/suhrig/arriba) | `2.3.0` | -| [FusionCatcher](https://github.com/ndaniel/fusioncatcher) | `1.33` | -| [Pizzly](https://github.com/pmelsted/pizzly) | `0.37.3` | -| [Squid](https://github.com/Kingsford-Group/squid) | `1.5` | -| [STAR-Fusion](https://github.com/STAR-Fusion/STAR-Fusion) | `1.10.1` | -| [StringTie](https://github.com/gpertea/stringtie) | `2.2.1` | - -> Single-end reads are to be use as last-resort. Paired-end reads are recommended. FusionCatcher cannot be used with single-end reads shorter than 130 bp. - -On release, automated continuous integration tests run the pipeline on a full-sized dataset on the AWS cloud infrastructure. This ensures that the pipeline runs on AWS, has sensible resource allocation defaults set to run on real-world datasets, and permits the persistent storage of results to benchmark between pipeline releases and other analysis sources.The results obtained from the full-sized test can be viewed on the [nf-core website](https://nf-co.re/rnafusion/results). +On release, automated continuous integration tests run the pipeline on a full-sized dataset on the AWS cloud infrastructure. This ensures that the pipeline runs on AWS, has sensible resource allocation defaults set to run on real-world datasets, and permits the persistent storage of results to benchmark between pipeline releases and other analysis sources. The results obtained from the full-sized test can be viewed on the [nf-core website](https://nf-co.re/rnafusion/results). In rnafusion the full-sized test includes reference building and fusion detection. The test dataset is taken from [here](https://github.com/nf-core/test-datasets/tree/rnafusion/testdata/human). @@ -39,92 +23,93 @@ In rnafusion the full-sized test includes reference building and fusion detectio ![nf-core/rnafusion metro map](docs/images/nf-core-rnafusion_metro_map.png) -#### Build references +### Build references -`--build_references` triggers a parallel workflow to build all references +`--build_references` triggers a parallel workflow to build references, which is a prerequisite to running the pipeline: 1. Download ensembl fasta and gtf files -2. Create STAR index -3. Download arriba references -4. Download fusioncatcher references -5. Download pizzly references (kallisto index) -6. Download and build STAR-fusion references -7. Download fusion-report DBs +2. Create [STAR](https://github.com/alexdobin/STAR) index +3. Download [Arriba](https://github.com/suhrig/arriba) references +4. Download [FusionCatcher](https://github.com/ndaniel/fusioncatcher) references +5. Download and build [STAR-Fusion](https://github.com/STAR-Fusion/STAR-Fusion) references +6. Download [Fusion-report](https://github.com/Clinical-Genomics/fusion-report) DBs #### Main workflow 1. Input samplesheet check -2. Concatenate fastq files per sample -3. Read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/)) -4. Arriba subworkflow +2. Concatenate fastq files per sample ([cat](http://www.linfo.org/cat.html)) +3. Reads quality control ([FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/)) +4. Optional trimming with [fastp](https://github.com/OpenGene/fastp) +5. Arriba subworkflow - [STAR](https://github.com/alexdobin/STAR) alignment - - [Samtool](https://github.com/samtools/samtools) sort - - [Samtool](https://github.com/samtools/samtools) index - [Arriba](https://github.com/suhrig/arriba) fusion detection -5. Pizzly subworkflow - - [Kallisto](https://pachterlab.github.io/kallisto/) quantification - - [Pizzly](https://github.com/pmelsted/pizzly) fusion detection -6. Squid subworkflow - - [STAR](https://github.com/alexdobin/STAR) alignment - - [Samtools view](http://www.htslib.org/): convert sam output from STAR to bam - - [Samtools sort](http://www.htslib.org/): bam output from STAR - - [SQUID](https://github.com/Kingsford-Group/squid) fusion detection - - [SQUID](https://github.com/Kingsford-Group/squid) annotate -7. STAR-fusion subworkflow +6. STAR-fusion subworkflow - [STAR](https://github.com/alexdobin/STAR) alignment - [STAR-Fusion](https://github.com/STAR-Fusion/STAR-Fusion) fusion detection -8. Fusioncatcher subworkflow +7. Fusioncatcher subworkflow - [FusionCatcher](https://github.com/ndaniel/fusioncatcher) fusion detection -9. Fusion-report subworkflow - - Merge all fusions detected by the different tools - - [Fusion-report](https://github.com/matq007/fusion-report) -10. FusionInspector subworkflow +8. StringTie subworkflow + - [StringTie](https://ccb.jhu.edu/software/stringtie/) +9. Fusion-report + - Merge all fusions detected by the selected tools with [Fusion-report](https://github.com/Clinical-Genomics/fusion-report) +10. Post-processing and analysis of data - [FusionInspector](https://github.com/FusionInspector/FusionInspector) - [Arriba](https://github.com/suhrig/arriba) visualisation -11. Stringtie subworkflow - - [StringTie](https://ccb.jhu.edu/software/stringtie/index.shtml) -12. Present QC for raw reads ([`MultiQC`](http://multiqc.info/)) -13. QC for mapped reads ([`QualiMap: BAM QC`](https://kokonech.github.io/qualimap/HG00096.chr20_bamqc/qualimapReport.html)) -14. Index mapped reads ([samtools index](http://www.htslib.org/)) -15. Collect metrics ([`picard CollectRnaSeqMetrics`](https://gatk.broadinstitute.org/hc/en-us/articles/360037057492-CollectRnaSeqMetrics-Picard-) and ([`picard MarkDuplicates`](https://gatk.broadinstitute.org/hc/en-us/articles/360037052812-MarkDuplicates-Picard-)) - -## Quick Start - -1. Install [`Nextflow`](https://www.nextflow.io/docs/latest/getstarted.html#installation) (`>=22.10.1`) - -2. Install any of [`Docker`](https://docs.docker.com/engine/installation/), [`Singularity`](https://www.sylabs.io/guides/3.0/user-guide/) (you can follow [this tutorial](https://singularity-tutorial.github.io/01-installation/)), [`Podman`](https://podman.io/), [`Shifter`](https://nersc.gitlab.io/development/shifter/how-to-use/) or [`Charliecloud`](https://hpc.github.io/charliecloud/) for full pipeline reproducibility _(you can use [`Conda`](https://conda.io/miniconda.html) both to install Nextflow itself and also to manage software within pipelines. Please only use it within pipelines as a last resort; see [docs](https://nf-co.re/usage/configuration#basic-configuration-profiles))_. + - Collect metrics ([`picard CollectRnaSeqMetrics`](https://gatk.broadinstitute.org/hc/en-us/articles/360037057492-CollectRnaSeqMetrics-Picard-), [`picard CollectInsertSizeMetrics`](https://gatk.broadinstitute.org/hc/en-us/articles/360037055772-CollectInsertSizeMetrics-Picard-) and ([`picard MarkDuplicates`](https://gatk.broadinstitute.org/hc/en-us/articles/360037052812-MarkDuplicates-Picard-)) +11. Present QC for raw reads ([`MultiQC`](http://multiqc.info/)) +12. Compress bam files to cram with [samtools view](http://www.htslib.org/) -3. Download the pipeline and test it on a minimal dataset with a single command: +## Usage - ```bash - nextflow run nf-core/rnafusion -profile test,YOURPROFILE --outdir -stub --all --build_references +:::note +If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how +to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) +with `-profile test` before running the workflow on actual data. +::: - nextflow run nf-core/rnafusion -profile test,YOURPROFILE --outdir -stub --all +As the reference building is computationally heavy (> 24h on HPC), it is recommended to test the pipeline with the `-stub` parameter (creation of empty files): - ``` +First, build the references: - Note that some form of configuration will be needed so that Nextflow knows how to fetch the required software. This is usually done in the form of a config profile (`YOURPROFILE` in the example command above). You can chain multiple config profiles in a comma-separated string. - - > - The pipeline comes with config profiles called `docker`, `singularity`, `podman`, `shifter`, `charliecloud` and `conda` which instruct the pipeline to use the named tool for software management. For example, `-profile test,docker`. - > - Please check [nf-core/configs](https://github.com/nf-core/configs#documentation) to see if a custom config file to run nf-core pipelines already exists for your Institute. If so, you can simply use `-profile ` in your command. This will enable either `docker` or `singularity` and set the appropriate execution settings for your local compute environment. - > - If you are using `singularity`, please use the [`nf-core download`](https://nf-co.re/tools/#downloading-pipelines-for-offline-use) command to download images first, before running the pipeline. Setting the [`NXF_SINGULARITY_CACHEDIR` or `singularity.cacheDir`](https://www.nextflow.io/docs/latest/singularity.html?#singularity-docker-hub) Nextflow options enables you to store and re-use the images from a central location for future pipeline runs. - > - If you are using `conda`, it is highly recommended to use the [`NXF_CONDA_CACHEDIR` or `conda.cacheDir`](https://www.nextflow.io/docs/latest/conda.html) settings to store the environments in a central location for future pipeline runs. - -4. Start running your own analysis! - -```console -nextflow run nf-core/rnafusion --input samplesheet.csv --outdir --genome GRCh38 --all -profile +```bash +nextflow run nf-core/rnafusion \ + -profile \ + -profile test \ + --outdir \ + --build_references \ + -stub ``` +Then perform the analysis: + ```bash -nextflow run nf-core/rnafusion --input samplesheet.csv --outdir --genome GRCh37 -profile +nextflow run nf-core/rnafusion \ + -profile \ + -profile test \ + --outdir \ + -stub ``` -> Note that paths need to be absolute and that runs with conda are not supported. +:::warning +Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those +provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; +see [docs](https://nf-co.re/usage/configuration#custom-configuration-files). +::: + +> **Notes:** +> +> - Conda is not currently supported; run with singularity or docker. +> - Paths need to be absolute. +> - GRCh38 is the only supported reference. +> - Single-end reads are to be used as last-resort. Paired-end reads are recommended. FusionCatcher cannot be used with single-end reads shorter than 130 bp. + +For more details and further functionality, please refer to the [usage documentation](https://nf-co.re/rnafusion/usage) and the [parameter documentation](https://nf-co.re/rnafusion/parameters). -## Documentation +## Pipeline output -The nf-core/rnafusion pipeline comes with documentation about the pipeline [usage](https://nf-co.re/rnafusion/usage), [parameters](https://nf-co.re/rnafusion/parameters) and [output](https://nf-co.re/rnafusion/output). +To see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/rnafusion/results) tab on the nf-core website pipeline page. +For more details about the output files and reports, please refer to the +[output documentation](https://nf-co.re/rnafusion/output). ## Credits diff --git a/assets/methods_description_template.yml b/assets/methods_description_template.yml index 8efa2896..80452425 100644 --- a/assets/methods_description_template.yml +++ b/assets/methods_description_template.yml @@ -5,13 +5,17 @@ section_href: "https://github.com/nf-core/rnafusion" plot_type: "html" data: |

Methods

-

Data was processed using nf-core/rnafusion v${workflow.manifest.version} ${doi_text} of the nf-core collection of workflows (Ewels et al., 2020).

+

Data was processed using nf-core/rnafusion v${workflow.manifest.version} ${doi_text} of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v${workflow.nextflow.version} (Di Tommaso et al., 2017) with the following command:

${workflow.commandLine}
+

${tool_citations}

References

    -
  • Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. https://doi.org/10.1038/nbt.3820
    • -
  • Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. https://doi.org/10.1038/s41587-020-0439-x
    • +
  • Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
    • +
  • Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
    • +
  • Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
    • +
  • da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192
    • + ${tool_bibliography}
Notes:
diff --git a/assets/multiqc_config.yaml b/assets/multiqc_config.yaml deleted file mode 100644 index ce53881a..00000000 --- a/assets/multiqc_config.yaml +++ /dev/null @@ -1,11 +0,0 @@ -report_comment: > - This report has been generated by the nf-core/rnafusion - analysis pipeline. For information about how to interpret these results, please see the - documentation. -report_section_order: - software_versions: - order: -1000 - nf-core-rnafusion-summary: - order: -1001 - -export_plots: true diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index 5c8a20b2..dd83ce70 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -1,13 +1,37 @@ report_comment: > - This report has been generated by the nf-core/rnafusion + This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the - documentation. + documentation. + report_section_order: - "nf-core-rnafusion-methods-description": + nf-core-rnafusion-methods-description: order: -1000 software_versions: order: -1001 - "nf-core-rnafusion-summary": + nf-core-rnafusion-summary: order: -1002 export_plots: true + +# Run only these modules +run_modules: + - custom_content + - fastqc + - fastp + - star + - samtools + - picard + - arriba + +module_order: + - fastp + - fastqc: + name: "FastQC (raw)" + info: "This section of the report shows FastQC results before adapter trimming." + path_filters: + - "*.zip" + - fastqc: + name: "FastQC (trimmed)" + info: "This section of the report shows FastQC results after adapter trimming." + path_filters: + - "*_trimmed*.zip" diff --git a/assets/nf-core-rnafusion_logo_light.png b/assets/nf-core-rnafusion_logo_light.png index 55f38541..5609a199 100644 Binary files a/assets/nf-core-rnafusion_logo_light.png and b/assets/nf-core-rnafusion_logo_light.png differ diff --git a/assets/samplesheet.csv b/assets/samplesheet.csv deleted file mode 100644 index 4f9acc40..00000000 --- a/assets/samplesheet.csv +++ /dev/null @@ -1,2 +0,0 @@ -sample,fastq_1,fastq_2,strandedness -test_rnafusion,https://github.com/nf-core/test-datasets/raw/d6cd12c9a69c148ef986d156d110f741df482b04/testdata/human/reads_1.fq.gz,https://github.com/nf-core/test-datasets/raw/d6cd12c9a69c148ef986d156d110f741df482b04/testdata/human/reads_2.fq.gz,forward diff --git a/assets/samplesheet_valid.csv b/assets/samplesheet_valid.csv deleted file mode 100644 index 4ac8f7b1..00000000 --- a/assets/samplesheet_valid.csv +++ /dev/null @@ -1,2 +0,0 @@ -sample,fastq_1,fastq_2,strandedness -test,https://github.com/nf-core/test-datasets/raw/rnafusion/testdata/human/reads_1.fq.gz,https://github.com/nf-core/test-datasets/raw/rnafusion/testdata/human/reads_2.fq.gz,forward diff --git a/assets/slackreport.json b/assets/slackreport.json index 043d02f2..1b3cba01 100644 --- a/assets/slackreport.json +++ b/assets/slackreport.json @@ -3,7 +3,7 @@ { "fallback": "Plain-text summary of the attachment.", "color": "<% if (success) { %>good<% } else { %>danger<%} %>", - "author_name": "sanger-tol/readmapping v${version} - ${runName}", + "author_name": "nf-core/rnafusion v${version} - ${runName}", "author_icon": "https://www.nextflow.io/docs/latest/_static/favicon.ico", "text": "<% if (success) { %>Pipeline completed successfully!<% } else { %>Pipeline completed with errors<% } %>", "fields": [ diff --git a/bin/check_samplesheet.py b/bin/check_samplesheet.py index da160e68..57cf8e6b 100755 --- a/bin/check_samplesheet.py +++ b/bin/check_samplesheet.py @@ -166,9 +166,6 @@ def sniff_format(handle): peek = read_head(handle) handle.seek(0) sniffer = csv.Sniffer() - if not sniffer.has_header(peek): - logger.critical("The given sample sheet does not appear to contain a header.") - sys.exit(1) dialect = sniffer.sniff(peek) return dialect diff --git a/bin/get_rrna_transcripts.py b/bin/get_rrna_transcripts.py index 46812caf..670d5f06 100755 --- a/bin/get_rrna_transcripts.py +++ b/bin/get_rrna_transcripts.py @@ -8,7 +8,6 @@ def get_rrna_intervals(file_in, file_out): """ - Get the commented out header Get lines containing ``#`` or ``gene_type rRNA`` or ```` or ``gene_type rRNA_pseudogene`` or ``gene_type MT_rRNA`` Create output file diff --git a/bin/megafusion.py b/bin/megafusion.py deleted file mode 100755 index 6f27b296..00000000 --- a/bin/megafusion.py +++ /dev/null @@ -1,208 +0,0 @@ -#!/usr/bin/env python - -import argparse -import logging -import sys -from pathlib import Path -import pandas as pd -import ast - -logger = logging.getLogger() - -FUSIONINSPECTOR_MAP = { - "fusion": {"column": 0, "delimiter": "\t", "element": 0}, - "chromosomeA": {"column": 7, "delimiter": ":", "element": 0}, - "chromosomeB": {"column": 10, "delimiter": ":", "element": 0}, - "posA": {"column": 7, "delimiter": ":", "element": 1}, - "posB": {"column": 10, "delimiter": ":", "element": 1}, - "strand1": {"column": 7, "delimiter": ":", "element": 2}, - "strand2": {"column": 10, "delimiter": ":", "element": 2}, - "geneA": {"column": 0, "delimiter": "--", "element": 0}, - "geneB": {"column": 0, "delimiter": "--", "element": 1}, - "split_reads": {"column": 1, "delimiter": "\t", "element": 0}, - "discordant_pairs": {"column": 2, "delimiter": "\t", "element": 0}, - "ffpm": {"column": 25, "delimiter": "\t", "element": 0}, -} - - -def parse_args(argv=None): - """Define and immediately parse command line arguments.""" - parser = argparse.ArgumentParser( - description="Validate and transform a tabular samplesheet.", - epilog="Example: python check_samplesheet.py samplesheet.csv samplesheet.valid.csv", - ) - parser.add_argument( - "--fusioninspector", - metavar="FUSIONINSPECTOR", - type=Path, - help="FusionInspector output in TSV format.", - ) - parser.add_argument( - "--fusionreport", - metavar="FUSIONREPORT", - type=Path, - help="Fusionreport output in TSV format.", - ) - parser.add_argument("--sample", metavar="SAMPLE", type=Path, help="Sample name.", default="Sample") - parser.add_argument( - "--out", - metavar="OUT", - type=Path, - help="Output path.", - ) - return parser.parse_args(argv) - - -def header_def(sample): - return '##fileformat=VCFv4.1\n\ -##ALT=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##INFO=\n\ -##FORMAT=\n\ -##FORMAT=\n\ -##FORMAT=\n\ -##FORMAT=\n\ -#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO\tFORMAT\t{}'.format( - sample - ) - - -def read_fusioninspector(fusioninspector_file, col_num, delimiter, element): - with open(fusioninspector_file) as fusioninspector: - return [line.split()[col_num].split(delimiter)[element] for line in fusioninspector if not line.startswith("#")] - - -def build_fusioninspector_dataframe(file, map): - new_dict = {} - for key in FUSIONINSPECTOR_MAP: - new_dict[key] = read_fusioninspector( - file, - map[key]["column"], - map[key]["delimiter"], - map[key]["element"], - ) - return pd.DataFrame.from_dict(new_dict).set_index("fusion") - - -def read_build_fusionreport(fusionreport_file): - with open(fusionreport_file) as f: - from_html = [line.split('rows": [')[1] for line in f if 'name="fusion_list' in line] - expression = from_html[0].split('], "tool')[0] - fusion_report = pd.DataFrame.from_dict(ast.literal_eval(expression)).set_index("fusion") - if not "arriba" in fusion_report.columns: - fusion_report["arriba"] = "" - if not "fusioncatcher" in fusion_report.columns: - fusion_report["fusioncatcher"] = "" - if not "pizzly" in fusion_report.columns: - fusion_report["pizzly"] = "" - if not "squid" in fusion_report.columns: - fusion_report["squid"] = "" - if not "starfusion" in fusion_report.columns: - fusion_report["starfusion"] = "" - return fusion_report - - -def column_manipulation(df): - df["ALT"] = "" - df = df.reset_index() - df["FORMAT"] = "GT:DV:RV:FFPM" - df["ID"] = "." - df["QUAL"] = "." - df["FILTER"] = "PASS" - df["REF"] = "N" - - for index, row in df.iterrows(): - # ALT - if not row["strand1"] in ["+", "-"] or not row["strand2"] in ["+", "-"]: - df.loc[index, "ALT"] = "N[{}:{}[".format(df["chromosomeB"], row["posB"]) - elif row["strand1"] == "-" and row["strand2"] == "-": - df.loc[index, "ALT"] = "[{}:{}[N".format(row["chromosomeB"], row["posB"]) - elif row["strand1"] == "+" and row["strand2"] == "-": - df.loc[index, "ALT"] = "N]{}:{}]".format(row["chromosomeB"], row["posB"]) - elif row["strand1"] == "-" and row["strand2"] == "+": - df.loc[index, "ALT"] = "N]{}:{}]".format(row["chromosomeB"], row["posB"]) - else: - df.loc[index, "ALT"] = "N[{}:{}[".format(row["chromosomeB"], row["posB"]) - # INFO - df.loc[index, "INFO"] = ( - "SVTYPE=BND;CHRA={};CHRB={};GENEA={};GENEB={};ORIENTATION={},{};FOUND_DB={};" - "ARRIBA={};FUSIONCATCHER={};PIZZLY={};SQUID={};STARFUSION={};TOOL_HITS={};SCORE={}".format( - row["chromosomeA"], - row["chromosomeB"], - row["geneA"], - row["geneB"], - row["strand1"], - row["strand2"], - row["found_db"], - row["arriba"], - row["fusioncatcher"], - row["pizzly"], - row["squid"], - row["starfusion"], - row["tools_hits"], - row["score"], - ) - ) - # FORMAT - df.loc[index, "Sample"] = "./1:{}:{}:{}".format(row["split_reads"], row["discordant_pairs"], row["ffpm"]) - return df - - -def write_vcf(df_to_print, header, out_file): - df_to_print[ - [ - "chromosomeA", - "posA", - "ID", - "REF", - "ALT", - "QUAL", - "FILTER", - "INFO", - "FORMAT", - "Sample", - ] - ].to_csv( - path_or_buf=out_file, - sep="\t", - header=None, - index=False, - ) - - with open(out_file, "r+") as f: - content = f.read() - f.seek(0, 0) - f.write(header.rstrip("\r\n") + "\n" + content) - - -def megafusion(fusioninspector_in_file, fusionreport_in_file, sample, out): - """Convert fusion information from FusionInspector and fusion-report into a vcf file. Adapted from https://github.com/J35P312/MegaFusion""" - merged_df = build_fusioninspector_dataframe(fusioninspector_in_file, FUSIONINSPECTOR_MAP).join( - read_build_fusionreport(fusionreport_in_file), how="left" - ) - write_vcf(column_manipulation(merged_df), header_def(sample), out) - - -def main(argv=None): - """Coordinate argument parsing and program execution.""" - args = parse_args(argv) - if not args.fusioninspector.is_file() or not args.fusionreport.is_file(): - logger.error(f"The given input file {args.fusioninspector} or {args.fusionreport} was not found!") - sys.exit(2) - megafusion(args.fusioninspector, args.fusionreport, args.sample, args.out) - - -if __name__ == "__main__": - sys.exit(main()) diff --git a/bin/vcf_collect.py b/bin/vcf_collect.py new file mode 100755 index 00000000..a8ab85f4 --- /dev/null +++ b/bin/vcf_collect.py @@ -0,0 +1,505 @@ +#!/usr/bin/env python3 + +import argparse +import logging +import sys +from pathlib import Path +import pandas as pd +import ast +import numpy as np +import csv + +logger = logging.getLogger() + + +def vcf_collect( + fusioninspector_in_file: str, + fusionreport_in_file: str, + gtf: str, + fusionreport_csv: str, + hgnc: str, + sample: str, + out_file, +) -> None: + """ + Process FusionInspector and FusionReport data, + merge with GTF from FusionInspector and HGNC database, + and write a VCF file. + + Args: + fusioninspector_in_file (str): Path to FusionInspector input file. + fusionreport_in_file (str): Path to Fusion-report input file. + sample (str): Sample name for the header. + hgnc (str): Path to HGNC file. + gtf (str): Path to output GTF file from FusionInspector in TSV format. + fusionreport_csv (str): Path to Fusion-report CSV output file. + out (str): Output VCF file path. + + Adapted from: https://github.com/J35P312/MegaFusion + """ + merged_df = ( + build_fusioninspector_dataframe(fusioninspector_in_file) + .join(read_build_fusionreport(fusionreport_in_file), how="outer", on="FUSION") + .reset_index() + ) + hgnc_df = build_hgnc_dataframe(hgnc) + + df_symbol = merged_df[merged_df["Left_ensembl_gene_id"].isna()] + df_not_symbol = merged_df[merged_df["Left_ensembl_gene_id"].notna()] + + df_not_symbol = hgnc_df.merge( + df_not_symbol, how="right", left_on="ensembl_gene_id", right_on="Left_ensembl_gene_id" + ) + df_symbol = hgnc_df.merge(df_symbol, how="right", left_on="symbol", right_on="GeneA") + df = pd.concat([df_not_symbol, df_symbol]) + df = df.rename(columns={"hgnc_id": "Left_hgnc_id"}) + + df_symbol = df[df["Right_ensembl_gene_id"].isna()] + df_not_symbol = df[df["Right_ensembl_gene_id"].notna()] + + df_not_symbol = hgnc_df.merge( + df_not_symbol, how="right", left_on="ensembl_gene_id", right_on="Right_ensembl_gene_id" + ) + df_symbol = hgnc_df.merge(df_symbol, how="right", left_on="symbol", right_on="GeneB") + df = pd.concat([df_not_symbol, df_symbol]) + df = df.rename(columns={"hgnc_id": "Right_hgnc_id"}) + + gtf_df = build_gtf_dataframe(gtf) + all_df = df.merge(gtf_df, how="left", left_on="CDS_LEFT_ID", right_on="Transcript_id") + all_df[["PosA", "orig_start", "orig_end"]] = all_df[["PosA", "orig_start", "orig_end"]].fillna(0).astype(int) + + all_df = all_df[ + ((all_df["PosA"] >= all_df["orig_start"]) & (all_df["PosA"] <= all_df["orig_end"])) + | ((all_df["orig_start"] == 0) & (all_df["orig_end"] == 0)) + ] + + all_df.replace("", np.nan, inplace=True) + all_df = all_df.drop_duplicates() + + all_df[["exon_number", "transcript_version"]] = all_df[["exon_number", "transcript_version"]].replace(0, np.nan) + # Fill non-empty values within each group for 'exon_number' and 'transcript_version' + all_df["exon_number"] = all_df.groupby("PosA")["exon_number"].transform( + lambda x: x.fillna(method="ffill").fillna(method="bfill") + ) + all_df["transcript_version"] = all_df.groupby("PosA")["transcript_version"].transform( + lambda x: x.fillna(method="ffill").fillna(method="bfill") + ) + + all_df = all_df.rename(columns={"transcript_version": "Left_transcript_version"}) + all_df = all_df.rename(columns={"exon_number": "Left_exon_number"}) + all_df = all_df[ + [ + "FUSION", + "GeneA", + "GeneB", + "PosA", + "PosB", + "ChromosomeA", + "ChromosomeB", + "TOOLS_HITS", + "SCORE", + "FOUND_DB", + "FOUND_IN", + "JunctionReadCount", + "SpanningFragCount", + "FFPM", + "PROT_FUSION_TYPE", + "CDS_LEFT_ID", + "CDS_RIGHT_ID", + "Left_transcript_version", + "Left_exon_number", + "Left_hgnc_id", + "Right_hgnc_id", + "Strand1", + "Strand2", + "annots", + ] + ].drop_duplicates() + all_df = all_df.merge(gtf_df, how="left", left_on="CDS_RIGHT_ID", right_on="Transcript_id") + all_df[["PosB", "orig_start", "orig_end"]] = all_df[["PosB", "orig_start", "orig_end"]].fillna(0) + all_df[["PosB", "orig_start", "orig_end"]] = all_df[["PosB", "orig_start", "orig_end"]].astype(int) + all_df = all_df[ + ((all_df["PosB"] >= all_df["orig_start"]) & (all_df["PosB"] <= all_df["orig_end"])) + | ((all_df["orig_start"] == 0) & (all_df["orig_end"] == 0)) + ] + + all_df[["PosA", "PosB"]] = all_df[["PosA", "PosB"]].replace(0, np.nan) + all_df = all_df.replace("", np.nan) + + all_df[["exon_number", "transcript_version"]] = all_df[["exon_number", "transcript_version"]].replace(0, np.nan) + # Fill non-empty values within each group for 'exon_number' and 'transcript_version' + all_df["exon_number"] = all_df.groupby("PosB")["exon_number"].transform( + lambda x: x.fillna(method="ffill").fillna(method="bfill") + ) + all_df["transcript_version"] = all_df.groupby("PosB")["transcript_version"].transform( + lambda x: x.fillna(method="ffill").fillna(method="bfill") + ) + + all_df = all_df.rename(columns={"transcript_version": "Right_transcript_version"}) + all_df = all_df.rename(columns={"exon_number": "Right_exon_number"}) + + all_df = all_df[ + [ + "FUSION", + "GeneA", + "GeneB", + "PosA", + "PosB", + "ChromosomeA", + "ChromosomeB", + "TOOLS_HITS", + "SCORE", + "FOUND_DB", + "FOUND_IN", + "JunctionReadCount", + "SpanningFragCount", + "FFPM", + "PROT_FUSION_TYPE", + "CDS_LEFT_ID", + "CDS_RIGHT_ID", + "Left_transcript_version", + "Left_exon_number", + "Left_hgnc_id", + "Right_transcript_version", + "Right_exon_number", + "Right_hgnc_id", + "Strand1", + "Strand2", + "annots", + ] + ].drop_duplicates() + all_df = all_df.rename(columns={"FUSION": "Fusion"}) + all_df = all_df.set_index("Fusion") + + all_df = all_df.combine_first(read_fusionreport_csv(fusionreport_csv)) + + return write_vcf(column_manipulation(all_df), header_def(sample), out_file) + + +def parse_args(argv=None): + """Define and immediately parse command line arguments.""" + parser = argparse.ArgumentParser( + description="Validate and transform a tabular samplesheet.", + epilog="Example: python check_samplesheet.py samplesheet.csv samplesheet.valid.csv", + ) + parser.add_argument( + "--fusioninspector", + metavar="FUSIONINSPECTOR", + type=Path, + help="FusionInspector output in TSV format.", + ) + parser.add_argument( + "--fusionreport", + metavar="FUSIONREPORT", + type=Path, + help="Fusionreport output in index/html format.", + ) + parser.add_argument( + "--fusionreport_csv", + metavar="FUSIONREPORT_CSV", + type=Path, + help="Fusionreport output in CSV format.", + ) + parser.add_argument( + "--fusioninspector_gtf", + metavar="GTF", + type=Path, + help="FusionInspector GTF output.", + ) + parser.add_argument( + "--hgnc", + metavar="HGNC", + type=Path, + help="HGNC database.", + ) + parser.add_argument("--sample", metavar="SAMPLE", type=Path, help="Sample name.", default="Sample") + parser.add_argument( + "--out", + metavar="OUT", + type=Path, + help="VCF output path.", + ) + return parser.parse_args(argv) + + +def header_def(sample: str) -> str: + """ + Define the header of the VCF file + """ + return '##fileformat=VCFv4.1\n\ +##ALT=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##INFO=\n\ +##FORMAT=\n\ +##FORMAT=\n\ +##FORMAT=\n\ +##FORMAT=\n\ +#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO\tFORMAT\t{}'.format( + sample + ) + + +def convert_to_list(annots_str: str) -> list: + try: + return ast.literal_eval(annots_str) + except (SyntaxError, ValueError): + return np.nan + + +def build_fusioninspector_dataframe(file: str) -> pd.DataFrame: + """ + Read FusionInspector output from a CSV file, preprocess the data, and set 'FUSION' as the index. + """ + df = pd.read_csv(file, sep="\t") + df = df.rename(columns={"#FusionName": "FUSION"}) + df[["ChromosomeA", "PosA", "Strand1"]] = df["LeftBreakpoint"].str.split(":", expand=True) + df[["ChromosomeB", "PosB", "Strand2"]] = df["RightBreakpoint"].str.split(":", expand=True) + df[["LeftGeneName", "Left_ensembl_gene_id"]] = df["LeftGene"].str.split("^", expand=True) + df[["RightGeneName", "Right_ensembl_gene_id"]] = df["RightGene"].str.split("^", expand=True) + df["annots"] = ( + df["annots"] + .apply(convert_to_list) + .apply(lambda x: ",".join(map(str, x)) if isinstance(x, list) else str(x) if pd.notna(x) else "") + ) + return df.set_index(["FUSION"]) + + +def replace_value_with_column_name(row: pd.Series, value_to_replace: str, column_name: str) -> str: + """ + Replace a specific value in a row with the corresponding column name. + """ + new_values = "" + for col_name, value in row.items(): + if col_name == column_name: + if value == value_to_replace: + new_values = col_name + else: + new_values = "" + return new_values + + +def concatenate_columns(row: pd.Series) -> str: + """ + Concatenate non-empty values in a row into a single string separated by commas. + """ + non_empty_values = [str(value) for value in row if value != ""] + return ",".join(non_empty_values) + + +def read_build_fusionreport(fusionreport_file: str) -> pd.DataFrame: + """ + Read and preprocess fusion-report data from a file, including handling missing tool columns, + getting the columns with each tool and create a new FOUND_IN column with all the tool hits. + Convert the list of databases in FOUND_DB into a joined string with a comma separator. + Make all column headers uppercase. + """ + with open(fusionreport_file) as f: + from_html = [line.split('rows": [')[1] for line in f if 'name="fusion_list' in line] + expression = from_html[0].split('], "tool')[0] + fusion_report = pd.DataFrame.from_dict(ast.literal_eval(expression)) + if not "arriba" in fusion_report.columns: + fusion_report["arriba"] = "" + if not "fusioncatcher" in fusion_report.columns: + fusion_report["fusioncatcher"] = "" + if not "starfusion" in fusion_report.columns: + fusion_report["starfusion"] = "" + fusion_report["arriba"] = fusion_report[["arriba"]].apply( + replace_value_with_column_name, args=("true", "arriba"), axis=1 + ) + fusion_report["fusioncatcher"] = fusion_report[["fusioncatcher"]].apply( + replace_value_with_column_name, args=("true", "fusioncatcher"), axis=1 + ) + fusion_report["starfusion"] = fusion_report[["starfusion"]].apply( + replace_value_with_column_name, args=("true", "starfusion"), axis=1 + ) + fusion_report["FOUND_IN"] = fusion_report[["arriba", "starfusion", "fusioncatcher"]].apply( + concatenate_columns, axis=1 + ) + fusion_report.columns = fusion_report.columns.str.upper() + fusion_report["FOUND_DB"] = fusion_report["FOUND_DB"].apply(lambda x: ",".join(x)) + fusion_report[["GeneA", "GeneB"]] = fusion_report["FUSION"].str.split("--", expand=True) + + return fusion_report[["FUSION", "GeneA", "GeneB", "TOOLS_HITS", "SCORE", "FOUND_DB", "FOUND_IN"]].set_index( + ["FUSION"] + ) + + +def read_fusionreport_csv(file: str) -> pd.DataFrame: + df = pd.read_csv(file) + df[["starfusion", "arriba", "fusioncatcher"]] = df[["starfusion", "arriba", "fusioncatcher"]].astype("str") + columns_to_iterate = ["starfusion", "arriba", "fusioncatcher"] + for index, row in df.iterrows(): + for column in columns_to_iterate: + cell_value = row[column] + + if "#" in cell_value: + df.at[index, column] = df.at[index, column].split(",")[0] + df.at[index, column] = df.at[index, column].replace("position: ", "") + df.at[index, "A"] = df.at[index, column].split("#")[0] + df.at[index, "B"] = df.at[index, column].split("#")[1] + df.at[index, "ChromosomeA"] = df.at[index, "A"].split(":")[0] + df.at[index, "PosA"] = df.at[index, "A"].split(":")[1] + if "+" in df.at[index, "A"] or "-" in df.at[index, "A"]: + df.at[index, "StrandA"] = df.at[index, "A"].split(":")[2] + else: + df.at[index, "StrandA"] = "" + + df.at[index, "ChromosomeB"] = df.at[index, "B"].split(":")[0] + df.at[index, "PosB"] = df.at[index, "B"].split(":")[1] + if "+" in df.at[index, "B"] or "-" in df.at[index, "B"]: + df.at[index, "StrandB"] = df.at[index, "B"].split(":")[2] + else: + df.at[index, "StrandB"] = "" + + break + df[["GeneA", "GeneB"]] = df["Fusion"].str.split("--", expand=True) + df = df.set_index("Fusion") + df.to_csv("tmp.csv") + return df[["GeneA", "GeneB", "ChromosomeA", "PosA", "StrandA", "ChromosomeB", "PosB", "StrandB"]] + + +def column_manipulation(df: pd.DataFrame) -> pd.DataFrame: + """ + Manipulate and prepare DataFrame for VCF file creation. + """ + df["ALT"] = "" + df = df.reset_index() + df["FORMAT"] = "GT:DV:RV:FFPM" + df["ID"] = "." + df["QUAL"] = "." + df["FILTER"] = "PASS" + df["REF"] = "N" + df["INFO"] = "" + df["Sample"] = "" + df["Strand1"] = df["Strand1"].astype(str) + df["JunctionReadCount"] = df["JunctionReadCount"].fillna(0).astype(int).astype(str) + df["SpanningFragCount"] = df["SpanningFragCount"].fillna(0).astype(int).astype(str) + df["FFPM"] = df["FFPM"].fillna(0).astype(float).astype(str) + df["ChromosomeA"] = df["ChromosomeA"].fillna(0).astype(str) + df["ChromosomeB"] = df["ChromosomeB"].fillna(0).astype(str) + df["Left_hgnc_id"] = df["Left_hgnc_id"].fillna(0).astype(int).astype(str) + df["Right_hgnc_id"] = df["Right_hgnc_id"].fillna(0).astype(int).astype(str) + df["Left_exon_number"] = df["Left_exon_number"].fillna(0).astype(int).astype(str) + df["Right_exon_number"] = df["Right_exon_number"].fillna(0).astype(int).astype(str) + df["Left_transcript_version"] = df["Left_transcript_version"].fillna(0).astype(int).astype(str) + df["Right_transcript_version"] = df["Right_transcript_version"].fillna(0).astype(int).astype(str) + df["PosA"] = df["PosA"].fillna(0).astype(int).astype(str) + df["PosB"] = df["PosB"].fillna(0).astype(int).astype(str) + df["PROT_FUSION_TYPE"] = df["PROT_FUSION_TYPE"].replace(".", "nan") + df["CDS_LEFT_ID"] = df["CDS_LEFT_ID"].replace(".", "nan") + df["CDS_RIGHT_ID"] = df["CDS_RIGHT_ID"].replace(".", "nan") + + for index, row in df.iterrows(): + if row["Strand1"] == "-" and row["Strand2"] == "-": + df.loc[index, "ALT"] = f'[{row["ChromosomeB"]}:{row["PosB"]}[N' + elif row["Strand1"] == "+" and row["Strand2"] == "-": + df.loc[index, "ALT"] = f'N]{row["ChromosomeB"]}:{row["PosB"]}]' + elif row["Strand1"] == "-" and row["Strand2"] == "+": + df.loc[index, "ALT"] = f'N]{row["ChromosomeB"]}:{row["PosB"]}]' + else: + df.loc[index, "ALT"] = f'N[{row["ChromosomeB"]}:{row["PosB"]}[' + + df.loc[index, "INFO"] = ( + f"SVTYPE=BND;CHRA={row['ChromosomeA']};CHRB={row['ChromosomeB']};GENEA={row['GeneA']};GENEB={row['GeneB']};" + f"POSA={row['PosA']};POSB={row['PosB']};ORIENTATION={row['Strand1']},{row['Strand2']};FOUND_DB={row['FOUND_DB']};" + f"FOUND_IN={row['FOUND_IN']};TOOL_HITS={row['TOOLS_HITS']};SCORE={row['SCORE']};FRAME_STATUS={row['PROT_FUSION_TYPE']};" + f"TRANSCRIPT_ID_A={row['CDS_LEFT_ID']};TRANSCRIPT_ID_B={row['CDS_RIGHT_ID']};" + f"TRANSCRIPT_VERSION_A={row['Left_transcript_version']};TRANSCRIPT_VERSION_B={row['Right_transcript_version']};" + f"HGNC_ID_A={row['Left_hgnc_id']};HGNC_ID_B={row['Right_hgnc_id']};" + f"EXON_NUMBER_A={row['Left_exon_number']};EXON_NUMBER_B={row['Right_exon_number']};" + f"ANNOTATIONS={row['annots']}" + ) + df.loc[index, "Sample"] = f"./1:{row['JunctionReadCount']}:{row['SpanningFragCount']}:{row['FFPM']}" + + return df + + +def write_vcf(df_to_print: pd.DataFrame, header: str, out_file: str) -> None: + """ + Write a VCF file with a specified DataFrame, header, and output file path. + """ + df_to_print[ + [ + "ChromosomeA", + "PosA", + "ID", + "REF", + "ALT", + "QUAL", + "FILTER", + "INFO", + "FORMAT", + "Sample", + ] + ].to_csv(path_or_buf=out_file, sep="\t", header=None, index=False, quoting=csv.QUOTE_NONE) + + with open(out_file, "r+") as f: + content = f.read() + f.seek(0, 0) + f.write(header.rstrip("\r\n") + "\n" + content) + + +def build_hgnc_dataframe(file: str) -> pd.DataFrame: + """ + Build a DataFrame from HGNC input file, extracting 'hgnc_id' and 'ensembl_gene_id' columns. + """ + df = pd.read_csv(file, sep="\t", low_memory=False) + df["hgnc_id"] = df["hgnc_id"].str.replace("HGNC:", "") + return df[["hgnc_id", "ensembl_gene_id", "symbol"]].dropna() + + +def build_gtf_dataframe(file: str) -> pd.DataFrame: + """ + Build a DataFrame from GTF file converted in TSV, extracting relevant columns. + """ + df = pd.read_csv(file, sep="\t") + df[["fusion_dump", "Transcript_id"]] = df["transcript_id"].str.split("^", expand=True) + df[["orig_chromosome", "orig_start", "orig_end", "orig_dir"]] = df["orig_coord_info"].str.split(",", expand=True) + return df[["Transcript_id", "transcript_version", "exon_number", "orig_start", "orig_end"]] + + +def main(argv=None): + """Coordinate argument parsing and program execution.""" + args = parse_args(argv) + if ( + not args.fusioninspector.is_file() + or not args.fusionreport.is_file() + or not args.fusioninspector_gtf + or not args.fusionreport_csv + or not args.hgnc + ): + logger.error(f"The given input file {args.fusioninspector} or {args.fusionreport} was not found!") + sys.exit(2) + vcf_collect( + args.fusioninspector, + args.fusionreport, + args.fusioninspector_gtf, + args.fusionreport_csv, + args.hgnc, + args.sample, + args.out, + ) + + +if __name__ == "__main__": + sys.exit(main()) diff --git a/conf/base.config b/conf/base.config index 09f68194..165a5e88 100644 --- a/conf/base.config +++ b/conf/base.config @@ -15,7 +15,7 @@ process { time = { check_max( 4.h * task.attempt, 'time' ) } shell = ['/bin/bash', '-euo', 'pipefail'] - errorStrategy = { task.exitStatus in [140,143,137,104,134,139] ? 'retry' : 'finish' } + errorStrategy = { task.exitStatus in ((130..145) + 104) ? 'retry' : 'finish' } maxRetries = 1 maxErrors = '-1' diff --git a/conf/genomes.config b/conf/genomes.config index e7a01b6d..c1385ebe 100644 --- a/conf/genomes.config +++ b/conf/genomes.config @@ -18,7 +18,6 @@ params { transcript = "${params.genomes_base}/ensembl/Homo_sapiens.${params.genome}.${params.ensembl_version}.cdna.all.fa.gz" refflat = "${params.genomes_base}/ensembl/Homo_sapiens.${params.genome}.${params.ensembl_version}.chr.gtf.refflat" rrna_intervals= "${params.genomes_base}/ensembl/Homo_sapiens.${params.genome}.${params.ensembl_version}.interval_list" - } } } diff --git a/conf/modules.config b/conf/modules.config index 7b8f2787..e4ae2bb8 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -36,7 +36,8 @@ process { } withName: ARRIBA_VISUALISATION { - ext.when = { !params.fusioninspector_only && (params.starfusion || params.all) } + ext.when = { !params.fusioninspector_only && (params.starfusion || params.all) } + ext.prefix = { "${meta.id}_combined_fusions_arriba_visualisation" } publishDir = [ path: { "${params.outdir}/arriba_visualisation" }, mode: params.publish_dir_mode, @@ -61,18 +62,24 @@ process { } withName: FASTP { - ext.args = params.trim_tail ? "--trim_tail1 ${params.trim_tail}" : '' + ext.args = params.trim_tail ? "--trim_tail1 ${params.trim_tail} --trim_tail2 ${params.trim_tail} " : '' } withName: FASTQC { ext.args = '--quiet' ext.when = { !params.skip_qc } + publishDir = [ + path: { "${params.outdir}/fastqc" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename } + ] } - withName: FASTQC_FOR_TRIM { + withName: FASTQC_FOR_FASTP { ext.args = '--quiet' + ext.prefix = { "${meta.id}_trimmed" } publishDir = [ - path: { "${params.outdir}/fastqc_for_trim" }, + path: { "${params.outdir}/fastqc_for_fastp" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] @@ -93,13 +100,12 @@ process { withName: FUSIONINSPECTOR { ext.when = { !params.skip_vis } ext.args = { params.fusioninspector_limitSjdbInsertNsj != 1000000 ? "--STAR_xtra_params \"--limitSjdbInsertNsj ${params.fusioninspector_limitSjdbInsertNsj}\"" : '' } - + ext.args2 = '--annotate --examine_coding_effect' } withName: FUSIONREPORT { ext.when = { !params.skip_vis } ext.args = "--export csv" - ext.args2 = { params.fusionreport_filter ? "--tool-cutoff 2" : "--tool-cutoff 1"} publishDir = [ path: { "${params.outdir}/fusionreport/${meta.id}" }, mode: params.publish_dir_mode, @@ -132,22 +138,22 @@ process { ] } - withName: KALLISTO_INDEX { - ext.args = '-k 31' + withName: HGNC_DOWNLOAD { publishDir = [ - path: { "${params.genomes_base}/pizzly" }, + path: { "${params.genomes_base}/hgnc" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } - withName: MEGAFUSION { - ext.when = {!params.fusioninspector_only} - } - - withName: MULTIQC { ext.when = { !params.skip_qc } + ext.args = params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' + publishDir = [ + path: { "${params.outdir}/multiqc" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename } + ] } withName: PICARD_COLLECTRNASEQMETRICS { @@ -155,62 +161,34 @@ process { } - withName: PICARD_MARKDUPLICATES { + withName: GATK4_MARKDUPLICATES { ext.when = { !params.skip_qc && !params.fusioninspector_only && (params.starfusion || params.all) } - } - - withName: PIZZLY { - ext.args = "-k 31 --align-score 2 --insert-size 400 --cache index.cache.txt" publishDir = [ - path: { "${params.outdir}/pizzly" }, + path: { "${params.outdir}/picard" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } - withName: QUALIMAP_RNASEQ { - ext.when = { !params.skip_qc && !params.fusioninspector_only && (params.starfusion || params.all)} - } - - withName: REFORMAT { - ext.args = "forcetrimright=75" - ext.args2 = "forcetrimleft=75" - } - - withName: SAMPLESHEET_CHECK { - publishDir = [ - path: { "${params.outdir}/pipeline_info" }, - mode: params.publish_dir_mode, - saveAs: { filename -> filename.equals('versions.yml') ? null : filename } - ] - } - - withName: SAMTOOLS_INDEX_FOR_ARRIBA { - publishDir = [ - path: { "${params.outdir}/samtools_index_for_arriba" }, - mode: params.publish_dir_mode, - saveAs: { filename -> filename.equals('versions.yml') ? null : filename } - ] - } - - withName: SAMTOOLS_INDEX_FOR_QC { - ext.when = { !params.skip_qc && !params.fusioninspector_only && (params.starfusion || params.all)} + withName: PICARD_COLLECTINSERTSIZEMETRICS { + ext.when = { !params.skip_qc && !params.fusioninspector_only && (params.starfusion || params.all) } + ext.prefix = { "${meta.id}_collectinsertsize"} publishDir = [ - path: { "${params.outdir}/samtools_index_for_qc" }, + path: { "${params.outdir}/picard" }, mode: params.publish_dir_mode, - saveAs: { filename -> filename.equals('versions.yml') ? null : filename } + saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] } - withName: SAMTOOLS_INDEX_FOR_STARFUSION { + withName: SAMPLESHEET_CHECK { publishDir = [ - path: { "${params.outdir}/samtools_index_for_starfusion" }, + path: { "${params.outdir}/pipeline_info" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: SAMTOOLS_FAIDX { + withName: SAMTOOLS_FAIDX { publishDir = [ path: { "${params.genomes_base}/ensembl" }, mode: params.publish_dir_mode, @@ -218,19 +196,19 @@ process { ] } - withName: SAMTOOLS_SORT_FOR_ARRIBA { - ext.prefix = { "${meta.id}_sorted" } + withName: SAMTOOLS_INDEX_FOR_ARRIBA { + ext.prefix = { "${meta.id}_star_for_arriba_sorted" } publishDir = [ - path: { "${params.outdir}/samtools_sort_for_arriba" }, + path: { "${params.outdir}/cram_arriba" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: SAMTOOLS_SORT_FOR_SQUID_CHIMERIC { - ext.prefix = { "${meta.id}_chimeric_sorted" } + withName: SAMTOOLS_SORT_FOR_ARRIBA { + ext.prefix = { "${meta.id}_star_for_arriba_sorted" } publishDir = [ - path: { "${params.outdir}/samtools_sort_for_squid_chimeric" }, + path: { "${params.outdir}/cram_arriba" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] @@ -238,6 +216,7 @@ process { withName: SAMTOOLS_VIEW_FOR_ARRIBA { ext.args = { "--output-fmt cram" } + ext.prefix = { "${meta.id}_star_for_arriba_sorted" } publishDir = [ path: { "${params.outdir}/cram_arriba" }, mode: params.publish_dir_mode, @@ -245,30 +224,18 @@ process { ] } - withName: SAMTOOLS_VIEW_FOR_SQUID_CHIMERIC { - ext.prefix = { "${meta.id}_chimeric" } - ext.args = { "--output-fmt bam" } - publishDir = [ - path: { "${params.outdir}/samtools_view_for_squid_chimeric" }, - mode: params.publish_dir_mode, - saveAs: { filename -> filename.equals('versions.yml') ? null : filename } - ] - } - - withName: SAMTOOLS_VIEW_FOR_SQUID_CRAM { - ext.args = { "--output-fmt cram" } + withName: SAMTOOLS_INDEX_FOR_STARFUSION { publishDir = [ - path: { "${params.outdir}/cram_squid" }, + path: { "${params.outdir}/star_for_starfusion" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: SAMTOOLS_VIEW_FOR_SQUID_CRAM_CHIMERIC { - ext.args = { "--output-fmt cram" } - ext.prefix = { "${meta.id}_chimeric" } + withName: SAMTOOLS_INDEX_FOR_STARFUSION_CRAM { + ext.prefix = { "${meta.id}.star_for_starfusion.Aligned.sortedByCoord.out" } publishDir = [ - path: { "${params.outdir}/cram_squid" }, + path: { "${params.outdir}/cram_starfusion" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] @@ -276,6 +243,7 @@ process { withName: SAMTOOLS_VIEW_FOR_STARFUSION { ext.args = { "--output-fmt cram" } + ext.prefix = { "${meta.id}.star_for_starfusion.Aligned.sortedByCoord.out" } publishDir = [ path: { "${params.outdir}/cram_starfusion" }, mode: params.publish_dir_mode, @@ -307,23 +275,6 @@ process { --chimMultimapNmax 50' } - withName: STAR_FOR_SQUID { - publishDir = [ - path: { "${params.outdir}/star_for_squid" }, - mode: params.publish_dir_mode, - saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, - ] - ext.args = '--twopassMode Basic \ - --chimOutType SeparateSAMold \ - --chimSegmentMin 20 \ - --chimJunctionOverhangMin 12 \ - --alignSJDBoverhangMin 10 \ - --outReadsUnmapped Fastx \ - --outSAMstrandField intronMotif \ - --outSAMtype BAM SortedByCoordinate \ - --readFilesCommand zcat' - } - withName: STAR_FOR_STARFUSION { publishDir = [ path: { "${params.outdir}/star_for_starfusion" }, @@ -352,7 +303,8 @@ process { --alignInsertionFlush Right \ --alignSplicedMateMapLminOverLmate 0 \ --alignSplicedMateMapLmin 30 \ - --chimOutType Junctions' + --chimOutType Junctions \ + --quantMode GeneCounts' } withName: STAR_GENOMEGENERATE { @@ -396,4 +348,8 @@ process { saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } + + withName: VCF_COLLECT { + ext.when = {!params.fusioninspector_only} + } } diff --git a/containers/arriba/Dockerfile b/containers/arriba/Dockerfile deleted file mode 100644 index ea36d90f..00000000 --- a/containers/arriba/Dockerfile +++ /dev/null @@ -1,14 +0,0 @@ -FROM nfcore/base:1.9 - -LABEL authors="Martin Proks" \ - description="Docker image containing all requirements for nfcore/rnafusion pipeline" - -# Install the conda environment -COPY environment.yml / -RUN conda env create -f /environment.yml && conda clean -a - -# Add conda installation dir to PATH (instead of doing 'conda activate') -ENV PATH /opt/conda/envs/nf-core-rnafusion-arriba_1.2.0/bin:$PATH - -# Dump the details of the installed packages to a file for posterity -RUN conda env export --name nf-core-rnafusion-arriba_1.2.0 > nf-core-rnafusion-arriba_1.2.0.yml diff --git a/containers/arriba/environment.yml b/containers/arriba/environment.yml deleted file mode 100644 index 20a1024e..00000000 --- a/containers/arriba/environment.yml +++ /dev/null @@ -1,14 +0,0 @@ -name: nf-core-rnafusion-arriba_1.2.0 -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::arriba=1.2.0 - - bioconda::bioconductor-genomicalignments - - bioconda::bioconductor-genomicranges - - bioconda::samtools=1.9 - - bioconda::star=2.7.1a - - conda-forge::openssl=1.0 - - conda-forge::r-circlize - - conda-forge::readline=6.2 diff --git a/containers/ericscript/Dockerfile b/containers/ericscript/Dockerfile deleted file mode 100644 index 70b87c48..00000000 --- a/containers/ericscript/Dockerfile +++ /dev/null @@ -1,17 +0,0 @@ -FROM nfcore/base:1.9 - -LABEL authors="Martin Proks" \ - description="Docker image containing all requirements for nfcore/rnafusion pipeline" - -# Install the conda environment -COPY environment.yml / -RUN conda env create -f /environment.yml && conda clean -a - -# Add conda installation dir to PATH (instead of doing 'conda activate') -ENV PATH /opt/conda/envs/nf-core-rnafusion-ericscript_0.5.5/bin:$PATH - -# Ignore database check (https://github.com/nf-core/rnafusion/issues/119) -RUN echo 1 > /opt/conda/envs/nf-core-rnafusion-ericscript_0.5.5/share/ericscript-0.5.5-4/lib/data/_resources/.flag.dbexists - -# Dump the details of the installed packages to a file for posterity -RUN conda env export --name nf-core-rnafusion-ericscript_0.5.5 > nf-core-rnafusion-ericscript_0.5.5.yml diff --git a/containers/ericscript/environment.yml b/containers/ericscript/environment.yml deleted file mode 100644 index 1e76273c..00000000 --- a/containers/ericscript/environment.yml +++ /dev/null @@ -1,8 +0,0 @@ -name: nf-core-rnafusion-ericscript_0.5.5 -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::ericscript=0.5.5 - - conda-forge::ncurses=6.1 diff --git a/containers/fusioncatcher/Dockerfile b/containers/fusioncatcher/Dockerfile deleted file mode 100644 index 77efaf57..00000000 --- a/containers/fusioncatcher/Dockerfile +++ /dev/null @@ -1,49 +0,0 @@ -FROM ubuntu:18.04 - -LABEL Description="This image is used to run FusionCatcher" Version="1.33" - -RUN apt-get -y clean \ - && apt-get -y update \ - && apt-get -y install \ - automake \ - build-essential \ - bzip2 \ - cmake \ - curl \ - g++ \ - gawk \ - gcc \ - gzip \ - libc6-dev \ - libncurses5-dev \ - libtbb2 \ - libtbb-dev \ - make \ - parallel \ - pigz \ - python \ - python-dev \ - python-biopython \ - python-numpy \ - python-openpyxl \ - python-xlrd \ - tar \ - unzip \ - wget \ - zip \ - zlib1g \ - zlib1g-dev \ - zlibc \ - default-jdk \ - && apt-get -y clean - -WORKDIR /opt - -###################### -## INSTALLATION -###################### - -RUN wget --no-check-certificate http://sf.net/projects/fusioncatcher/files/bootstrap.py -O bootstrap.py \ - && python bootstrap.py -t -y -i /opt/fusioncatcher/v1.33/ - -ENV PATH /opt/fusioncatcher/v1.33/bin:$PATH diff --git a/containers/pizzly/Dockerfile b/containers/pizzly/Dockerfile deleted file mode 100644 index 0056bf9b..00000000 --- a/containers/pizzly/Dockerfile +++ /dev/null @@ -1,14 +0,0 @@ -FROM nfcore/base:1.9 - -LABEL authors="Martin Proks" \ - description="Docker image containing all requirements for nfcore/rnafusion pipeline" - -# Install the conda environment -COPY environment.yml / -RUN conda env create -f /environment.yml && conda clean -a - -# Add conda installation dir to PATH (instead of doing 'conda activate') -ENV PATH /opt/conda/envs/nf-core-rnafusion-pizzly_0.37.3/bin:$PATH - -# Dump the details of the installed packages to a file for posterity -RUN conda env export --name nf-core-rnafusion-pizzly_0.37.3 > nf-core-rnafusion-pizzly_0.37.3.yml diff --git a/containers/pizzly/environment.yml b/containers/pizzly/environment.yml deleted file mode 100644 index 79974871..00000000 --- a/containers/pizzly/environment.yml +++ /dev/null @@ -1,9 +0,0 @@ -name: nf-core-rnafusion-pizzly_0.37.3 -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::kallisto=0.44.0 - - bioconda::pizzly=0.37.3 - - conda-forge::pigz=2.3.4 diff --git a/containers/squid/Dockerfile b/containers/squid/Dockerfile deleted file mode 100644 index 20d390ee..00000000 --- a/containers/squid/Dockerfile +++ /dev/null @@ -1,19 +0,0 @@ -FROM nfcore/base:1.9 - -LABEL authors="Martin Proks" \ - description="Docker image containing all requirements for nfcore/rnafusion pipeline" - -# Install the conda environment -COPY environment.yml / -RUN conda env create -f /environment.yml && conda clean -a - -# Add conda installation dir to PATH (instead of doing 'conda activate') -ENV PATH /opt/conda/envs/nf-core-rnafusion-squid_1.5-star2.7.1a/bin:$PATH - -RUN cd /opt/conda/envs/nf-core-rnafusion-squid_1.5-star2.7.1a/bin \ - && wget https://raw.githubusercontent.com/Kingsford-Group/squid/f45c9025d41cffd982ecbbdd52844e5a4f074de9/utils/AnnotateSQUIDOutput.py \ - && chmod +x /opt/conda/envs/nf-core-rnafusion-squid_1.5-star2.7.1a/bin/AnnotateSQUIDOutput.py \ - && ln -s /opt/conda/envs/nf-core-rnafusion-squid_1.5-star2.7.1a/bin/python3 /bin/python - -# Dump the details of the installed packages to a file for posterity -RUN conda env export --name nf-core-rnafusion-squid_1.5-star2.7.1a > nf-core-rnafusion-squid_1.5-star2.7.1a.yml diff --git a/containers/squid/environment.yml b/containers/squid/environment.yml deleted file mode 100644 index 7385b163..00000000 --- a/containers/squid/environment.yml +++ /dev/null @@ -1,11 +0,0 @@ -name: nf-core-rnafusion-squid_1.5-star2.7.1a -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::samtools=1.9 - - bioconda::squid=1.5 - - bioconda::star=2.7.1a - - conda-forge::numpy=1.18.1 - - conda-forge::python=3.7.6 diff --git a/docs/images/nf-core-rnafusion_metro_map.png b/docs/images/nf-core-rnafusion_metro_map.png index 314b61a2..76b6bc3f 100644 Binary files a/docs/images/nf-core-rnafusion_metro_map.png and b/docs/images/nf-core-rnafusion_metro_map.png differ diff --git a/docs/images/nf-core-rnafusion_metro_map.svg b/docs/images/nf-core-rnafusion_metro_map.svg index 38eb709b..1cd7980f 100644 --- a/docs/images/nf-core-rnafusion_metro_map.svg +++ b/docs/images/nf-core-rnafusion_metro_map.svg @@ -26,13 +26,13 @@ inkscape:pagecheckerboard="0" inkscape:document-units="mm" showgrid="true" - inkscape:zoom="1.1491182" - inkscape:cx="311.10813" - inkscape:cy="413.79557" - inkscape:window-width="1440" - inkscape:window-height="847" - inkscape:window-x="0" - inkscape:window-y="25" + inkscape:zoom="0.79542318" + inkscape:cx="538.70696" + inkscape:cy="330.01301" + inkscape:window-width="1366" + inkscape:window-height="1051" + inkscape:window-x="696" + inkscape:window-y="83" inkscape:window-maximized="0" inkscape:current-layer="layer1" inkscape:snap-grids="false"> @@ -64,7 +64,7 @@ style="font-size:32px;line-height:1.25;stroke-width:2.10014px" /> + transform="translate(-23.347973,0.557051)"> + - - - - - - align Arriba - SQUID + x="104.54099" + y="48.143513">StringTie pizzly + x="136.53439" + y="65.475723">Arriba - align kallisto + x="81.461792" + y="65.99041">align hardtrimming - fastpfastptrimming FusionCatcher align - - - - - - + sodipodi:nodetypes="ccc" /> STAR-Fusion FastQC Qualimap - MultiQC FusionInspector + x="220.19096" + y="96.223259">FusionInspector fusion-report + x="196.76082" + y="64.750114">fusion-report PicardPicard:CollectRnaSeqMetrics- CollectRnaSeqMetrics+- CollectWgsMetricsPicardCollectWgsMetrics - SQUIDannotate + id="tspan23187">- CollectInsertSizeMetrics - - - - + style="fill:none;stroke:#000000;stroke-width:2.42956;stroke-linecap:butt;stroke-linejoin:miter;stroke-miterlimit:4;stroke-dasharray:none;stroke-opacity:1" + d="m 261.03273,71.013135 h -7.93593 c -3.94345,0 -7.79288,2.347188 -10.58131,4.962803 l -2.64532,2.481411" + id="path1232-7-2-7-3-7" + sodipodi:nodetypes="cssc" /> + + transform="translate(-10.236147,12.330532)"> qc Workflows: - - StringTie - + transform="translate(-9.762502,12.377831)"> - + sodipodi:nodetypes="ccc" /> squid - pizzly - stringtie - + y="147.22173">stringtie ArribaArribavisualisation + VCFcollect + + diff --git a/docs/output.md b/docs/output.md index b7afedf1..dede2c87 100644 --- a/docs/output.md +++ b/docs/output.md @@ -11,30 +11,29 @@ The directories listed below will be created in the results directory after the The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes data using the following steps: - [Download and build references](#references) - Build references needed to run the rest of the pipeline -- [STAR](#star) - Alignment for arriba, squid and STAR-fusion -- [Cat](#cat) - Concatenated fastq files per sample ID +- [STAR](#star) - Alignment for arriba, and STAR-fusion +- [Cat](#cat) - Concatenate fastq files per sample ID - [Arriba](#arriba) - Arriba fusion detection -- [Pizzly](#pizzly) - Pizzly fusion detection -- [Squid](#squid) - Squid fusion detection - [STAR-fusion](#starfusion) - STAR-fusion fusion detection - [StringTie](#stringtie) - StringTie assembly - [FusionCatcher](#fusioncatcher) - Fusion catcher fusion detection - [Samtools](#samtools) - SAM/BAM file manipulation -- [Fusion-report](#fusion-report) - Summary of the findings of each tool and comparison to COSMIC, Mitelman and FusionGBD databases -- [FusionInspector](#fusionInspector) - IGV-based visualisation tool for fusions filtered by fusion-report +- [Fusion-report](#fusion-report) - Summary of the findings of each tool and comparison to COSMIC, Mitelman, FusionGBD and FusionGDB2 databases +- [FusionInspector](#fusionInspector) - Supervised analysis of fusion predictions from fusion-report, recover and re-score evidence for such predictions - [Arriba visualisation](#arriba-visualisation) - Arriba visualisation report for FusionInspector fusions -- [Qualimap](#qualimap) - Quality control of alignment -- [Picard](#picard) - Collect metrics +- [Picard](#picard) - Collect QC metrics - [FastQC](#fastqc) - Raw read quality control -- [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline +- [MultiQC](#multiqc) - Aggregate reports describing QC results from the whole pipeline - [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution -### Download and build references +## Download and build references
-Output files +Output reference files and folder structure + +### References directory structure -- `genomes_base/` +- `references/` - `arriba` - `blacklist_hg38_GRCh38_v2.1.0.tsv.gz` - `protein_domains_hg38_GRCh38_v2.1.0.gff3` @@ -53,8 +52,6 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d - `fusiongdb.db` - `fusiongdb2.db` - `mitelman.db` - - `pizzly` - - `kallisto` - file containing the kallisto index - `star` - dir with STAR index - `starfusion` - files and dirs used to build the index @@ -64,236 +61,247 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d
-### STAR - -STAR is used to align to genome reference +## Main pipeline workflow + +> If no argument is specified here, the tool was used with default parameters. + +### Directory structure + +```text +{outdir} +├── arriba +├── arriba_visualisation +├── cram_arriba +├── cram_starfusion +├── fastp +├── fastqc +├── fusioncatcher +├── fusioninspector +├── fusionreport +├── kallisto_quant +├── megafusion +├── multiqc +├── picard +├── pipeline_info +├── samtools_sort_for_arriba +├── star_for_arriba +├── star_for_starfusion +├── starfusion +└── work +.nextflow.log +``` -STAR is run 3 times: +If no parameters are specified, the default is applied. -For arriba with the parameters: +### Arriba -```bash ---readFilesCommand zcat \ ---outSAMtype BAM Unsorted \ ---outSAMunmapped Within \ ---outBAMcompression 0 \ ---outFilterMultimapNmax 50 \ ---peOverlapNbasesMin 10 \ ---alignSplicedMateMapLminOverLmate 0.5 \ ---alignSJstitchMismatchNmax 5 -1 5 5 \ ---chimSegmentMin 10 \ ---chimOutType WithinBAM HardClip \ ---chimJunctionOverhangMin 10 \ ---chimScoreDropMax 30 \ ---chimScoreJunctionNonGTAG 0 \ ---chimScoreSeparation 1 \ ---chimSegmentReadGapMax 3 \ ---chimMultimapNmax 50 -``` +[Arriba](https://arriba.readthedocs.io/en/latest/) is used for i) detect gene fusions and ii) create a PDF report for the fusions found (visualisation): -For squid with the parameters: +#### Detection -```bash ---twopassMode Basic \ ---chimOutType SeparateSAMold \ ---chimSegmentMin 20 \ ---chimJunctionOverhangMin 12 \ ---alignSJDBoverhangMin 10 \ ---outReadsUnmapped Fastx \ ---outSAMstrandField intronMotif \ ---outSAMtype BAM SortedByCoordinate \ ---readFilesCommand zcat -``` +
+Output files -For STAR-fusion with the parameters: +- `arriba/` + - `.arriba.fusions.tsv` - contains the identified fusions + - `.arriba.fusions.discarded.tsv` -```bash ---twopassMode Basic \ ---outReadsUnmapped None \ ---readFilesCommand zcat \ ---outSAMstrandField intronMotif \ ---outSAMunmapped Within \ ---chimSegmentMin 12 \ ---chimJunctionOverhangMin 8 \ ---chimOutJunctionFormat 1 \ ---alignSJDBoverhangMin 10 \ ---alignMatesGapMax 100000 \ ---alignIntronMax 100000 \ ---alignSJstitchMismatchNmax 5 -1 5 5 \ ---chimMultimapScoreRange 3 \ ---chimScoreJunctionNonGTAG -4 \ ---chimMultimapNmax 20 \ ---chimNonchimScoreDropMin 10 \ ---peOverlapNbasesMin 12 \ ---peOverlapMMp 0.1 \ ---alignInsertionFlush Right \ ---alignSplicedMateMapLminOverLmate 0 \ ---alignSplicedMateMapLmin 30 \ ---chimOutType Junctions -``` +
-> STAR_FOR_STARFUSION uses `${params.ensembl_ref}/Homo_sapiens.GRCh38.${params.ensembl_version}.chr.gtf` whereas STAR_FOR_ARRIBA and STAR_FOR_SQUID use `${params.ensembl_ref}/Homo_sapiens.GRCh38.${params.ensembl_version}.gtf` +#### Visualisation
Output files -- `star_for_` -_ **Common** -_ `.Log.final.out` -_ `.Log.progress.out` -_ `.SJ.out.tab` -_ **For arriba:** -_ `.Aligned.out.bam` -_ **For squid:** -_ `.Aligned.sortedByCoord.out.bam` -_ `.Chimeric.out.sam` -_ `.unmapped_1.fastq.gz` -_ `.unmapped_2.fastq.gz` -_ **For starfusion:** -_ `.Aligned.sortedByCoord.out.bam` -_ `.Chimeric.out.junction` +- `arriba_visualisation/` + - `_combined_fusions_arriba_visualisation.pdf` +
-### Cat +The visualisation displays the fusions that fusioninspector outputs. That means that fusions from all callers are aggregated (by fusion-report) and then analyzed through fusioninspector (Note: Fusioninspecor contains a filtering step!). -Cat is used to concatenate fastq files belonging to the same sample. +### Cat
Output files -- `cat` - - `_1.merged.fastq.gz` - - `_2.merged.fastq.gz` +- `cat/` + - `_1.merged.fastq.gz` + - `_2.merged.fastq.gz`
-### Arriba +If multiple libraries or runs have been provided for the same sample in the input samplesheet (e.g. to increase sequencing depth) then these will be merged at the very beginning of the pipeline in order to have consistent sample naming throughout the pipeline. Please refer to the [usage](https://nf-co.re/rnafusion/usage#samplesheet-input) documentation to see how to specify these samples in the input samplesheet. -Arriba is used for i) detect fusion and ii) output a PDF report for the fusions found (visualisation): +### Fastp -#### Detection +If `--trim_fastp` is selected, [fastp](https://github.com/OpenGene/fastp) will filter low quality reads as well as bases at the 5' and 3' ends, trim adapters (automatically detected, but input with parameter `--adapter_fasta` is possible). 3' trimming is also possible via parameter `--trim_tail`.
Output files -- `arriba` - - `.arriba.fusions.tsv` - contains the identified fusions - - `.arriba.fusions.discarded.tsv` +- `fastp/` + - `_1.fastp.fastq.gz` + - `_2.fastp.fastq.gz` + - `.fastp.html` + - `.fastp.json` + - `.fastp.log`
-#### Visualisation +### FastQC
Output files -- `arriba_visualisation` - - `.pdf` +- `fastqc/` + - `*_fastqc.html`: FastQC report containing quality metrics. + - `*_fastqc.zip`: Zip archive containing the FastQC report, tab-delimited data file and plot images.
-### Pizzly +[FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/). -The first step of the pizzly workflow is to run `kallisto quant`: +![MultiQC - FastQC sequence counts plot](images/mqc_fastqc_counts.png) -#### Kallisto +![MultiQC - FastQC mean quality scores plot](images/mqc_fastqc_quality.png) + +![MultiQC - FastQC adapter content plot](images/mqc_fastqc_adapter.png) + +:::note +The FastQC plots displayed in the MultiQC report shows _untrimmed_ reads. They may contain adapter sequence and potentially regions with low quality. +::: + +### FusionCatcher
Output files -- `kallisto` - - `.kallisto_quant.fusions.txt` +- `fusioncatcher` + - `.fusioncatcher.fusion-genes.txt` + - `.fusioncatcher.summary.txt` + - `.fusioncatcher.log`
-Pizzly refines kallisto output. - -#### Pizzly +[FusionCatcher](https://github.com/ndaniel/fusioncatcher) searches for novel/known somatic fusion genes translocations, and chimeras in RNA-seq data. Possibility to use parameter `--fusioncatcher_limitSjdbInsertNsj` to modify limitSjdbInsertNsj. -Pizzly uses the following arguments: - -```bash --k 31 \ ---align-score 2 \ ---insert-size 400 \ ---cache index.cache.txt -``` +### FusionInspector
Output files -- `pizzly` - - `.pizzly.txt` - contains the identified fusions - - `.pizzly.unfiltered.json` +- `fusioninspector` + - `.fusion_inspector_web.html` - visualisation report described in details [here](https://github.com/FusionInspector/FusionInspector/wiki/FusionInspector-Visualizations) + - `FusionInspector.log` + - `.FusionInspector.fusions.abridged.tsv`
-### Squid +[FusionInspector](https://github.com/FusionInspector/FusionInspector/tree/master) performs a validation of fusion transcript predictions. Possibility to use `--fusioninspector_limitSjdbInsertNsj` to set limitSjdbInsertNsj to anything other than the default 1000000. + +### Fusion-report -Squid is run in two steps: i) fusion detection and ii) fusion annotation but the output is in a common `squid` directory. +Please note that fusion-report is executed from fork https://github.com/Clinical-Genomics/fusion-report
Output files -- `squid` - - `.squid.fusions_sv.txt` - contains the identified fusions - - `.squid.fusions.annotated.txt`- contains the identified fusions annotatedvi +- `fusionreport` + - + - `.fusionreport.tsv` + - `.fusionreport_filtered.tsv` + - `_fusionreport_index.html` - general report for all filtered fusions + - `.fusions.csv` - index in csv format + - `_.html` - specific report for each filtered fusion
-### STAR-fusion +[Fusion-report](https://github.com/matq007/fusion-report) is a tool for parsing outputs from fusion detection tools. +The score is explained here: . Summary: + +The weights for databases are as follows: + +- COSMIC (50) +- MITELMAN (50) +- FusionGDB2 (0) + +The final formula for calculating score is: + +$$ +score = 0.5 * \sum_{tool}^{tools} f(fusion, tool)*w(tool) + 0.5 * \sum_{db}^{dbs} g(fusion, db)*w(db) +$$ + +All tools have the same weight. + +### Kallisto
Output files -- `starfusion` - - `.starfusion.fusion_predictions.tsv` - contains the identified fusions - - `.starfusion.abridged.tsv` - - `- contains the identified fusions.starfusion.abridged.coding_effect.tsv` +- `kallisto` + - `.kallisto_quant.fusions.txt`
-### StringTie +Quantifying abundances of transcripts from bulk and single-cell RNA-Seq data, or more generally of target sequences using high-throughput sequencing reads. + +### Vcf_collect
Output files -- `stringtie//stringtie.merged.gtf` - merged gtf from annotation and stringtie output gtfs +- `vcf_collect` + - `_fusion_data.vcf` - contains the fusions in vcf format with collected statistics. + +Vcf-collect takes as input the results of fusion-report and fusioninspector. That means fusions from all tools are aggregated. Fusioninspector applies a filter so it is possible some fusions detected by a caller are not filtered out by fusioninspector. In those cases, vcf-collect will display the fusions, but a lot of data will be missing as fusioninspector performs the analysis for each fusion. +
-### FusionCatcher +[Megafusion](https://github.com/J35P312/MegaFusion) converts RNA fusion files to SV VCF and collects statistics and metrics in a VCF file. + +### MultiQC
Output files -- `fusioncatcher` -_ `.fusioncatcher.fusion-genes.txt` -_ `.fusioncatcher.summary.txt` \* `.fusioncatcher.log` +- `multiqc/` + - `multiqc_report.html`: a standalone HTML file that can be viewed in your web browser. + - `multiqc_data/`: directory containing parsed statistics from the different tools used in the pipeline. + - `multiqc_plots/`: directory containing static images from the report in various formats. +
-### Samtools +[MultiQC](http://multiqc.info) is a visualization tool that generates a single HTML report summarising all samples in your project. Most of the pipeline QC results are visualised in the report and further statistics are available in the report data directory. -#### Samtools view +Results generated by MultiQC collate pipeline QC from supported tools e.g. FastQC. The pipeline has special steps which also allow the software versions to be reported in the MultiQC output for future traceability. For more information about how to use MultiQC reports, see . -Samtools view is used to convert the chimeric SAM output from STAR_FOR_SQUID to BAM +### Picard
Output files -- `samtools_view_for_squid` - - `_chimeric.bam` - sorted BAM file +Picard CollectRnaMetrics and picard MarkDuplicates share the same output directory. + +- `picard` + - `.MarkDuplicates.metrics.txt` - metrics from MarkDuplicates + - `_rna_metrics.txt` - metrics from CollectRnaMetrics + - `_insert_size_metrics.txt.txt` - metrics from CollectInsertSizeMetrics + - `.bam` - BAM file with marked duplicates
+### Samtools + #### Samtools sort -Samtools sort is used to sort BAM files from STAR_FOR_STARFUSION (for arriba visualisation) and the chimeric BAM from STAR_FOR_SQUID +Samtools sort is used to sort BAM files from STAR_FOR_STARFUSION (for arriba visualisation)
Output files -- `samtools_sort_for_` - - `(_chimeric)_sorted.bam` - sorted BAM file +- `samtools_sort_for_` + - `(_chimeric)_sorted.bam` - sorted BAM file
@@ -305,103 +313,111 @@ Samtools index is used to index BAM files from STAR_FOR_ARRIBA (for arriba visua Output files - `samtools_for_` - - `.(Aligned.sortedByCoord).out.bam.bai` - + - `.(Aligned.sortedByCoord).out.bam.bai` - -### Fusion-report - -
-Output files - -- `fusionreport` - - - - `.fusionreport.tsv` - - `.fusionreport_filtered.tsv` - - `index.html` - general report for all filtered fusions - - `.html` - specific report for each filtered fusion +### STAR -
+STAR is used to align to genome reference -The score is explained [on the original fusion-report github page](https://matq007.github.io/fusion-report/#/score). +STAR is run for 3 tools: -### FusionInspector +For `arriba` with the parameters: -
-Output files +```bash +--readFilesCommand zcat \ +--outSAMtype BAM Unsorted \ +--outSAMunmapped Within \ +--outBAMcompression 0 \ +--outFilterMultimapNmax 50 \ +--peOverlapNbasesMin 10 \ +--alignSplicedMateMapLminOverLmate 0.5 \ +--alignSJstitchMismatchNmax 5 -1 5 5 \ +--chimSegmentMin 10 \ +--chimOutType WithinBAM HardClip \ +--chimJunctionOverhangMin 10 \ +--chimScoreDropMax 30 \ +--chimScoreJunctionNonGTAG 0 \ +--chimScoreSeparation 1 \ +--chimSegmentReadGapMax 3 \ +--chimMultimapNmax 50 +``` -- `fusioninspector` - - `.fusion_inspector_web.html` - visualisation report described in details [here](https://github.com/FusionInspector/FusionInspector/wiki/FusionInspector-Visualizations) - - `FusionInspector.log` - - `.FusionInspector.fusions.abridged.tsv` +For `STAR-fusion` with the parameters: -
+```bash +--twopassMode Basic \ +--outReadsUnmapped None \ +--readFilesCommand zcat \ +--outSAMstrandField intronMotif \ +--outSAMunmapped Within \ +--chimSegmentMin 12 \ +--chimJunctionOverhangMin 8 \ +--chimOutJunctionFormat 1 \ +--alignSJDBoverhangMin 10 \ +--alignMatesGapMax 100000 \ +--alignIntronMax 100000 \ +--alignSJstitchMismatchNmax 5 -1 5 5 \ +--chimMultimapScoreRange 3 \ +--chimScoreJunctionNonGTAG -4 \ +--chimMultimapNmax 20 \ +--chimNonchimScoreDropMin 10 \ +--peOverlapNbasesMin 12 \ +--peOverlapMMp 0.1 \ +--alignInsertionFlush Right \ +--alignSplicedMateMapLminOverLmate 0 \ +--alignSplicedMateMapLmin 30 \ +--chimOutType Junctions \ +--quantMode GeneCounts +``` -### Qualimap +> STAR_FOR_STARFUSION uses `${params.ensembl}/Homo_sapiens.GRCh38.${params.ensembl_version}.chr.gtf` whereas STAR_FOR_ARRIBA uses `${params.ensembl_ref}/Homo_sapiens.GRCh38.${params.ensembl_version}.gtf`
Output files -- `qualimap` - - `qualimapReport.html` - HTML report - - `rnaseq_qc_results.txt` - TXT results - - `css` - dir for html style - - `images_qualimapReport`- dir for html images - - `raw_data_qualimapReport` - dir for html raw data +**Common** -
+- `star_for_` +- `.Log.final.out` +- `.Log.progress.out` +- `.SJ.out.tab` -### Picard +**For arriba:** -Picard CollectRnaMetrics and picard MarkDuplicates share the same outpur directory. +- `.Aligned.out.bam` -
-Output files + **For starfusion:** -- `picard` - - `.MarkDuplicates.metrics.txt` - metrics from CollectRnaMetrics - - `_rna_metrics.txt` - metrics from MarkDuplicates - - `.bam` - BAM file with marked duplicates +- `.Aligned.sortedByCoord.out.bam` +- `.Chimeric.out.junction` +- `.ReadsPerGene.out.tab`
-### FastQC +The STAR index is generated with `--sjdbOverhang ${params.read_length - 1}`, params.read_length default is 100. + +### STAR-fusion
Output files -- `fastqc/` - - `*_fastqc.html`: FastQC report containing quality metrics. - - `*_fastqc.zip`: Zip archive containing the FastQC report, tab-delimited data file and plot images. +- `starfusion` + - `.starfusion.fusion_predictions.tsv` - contains the identified fusions + - `.starfusion.abridged.tsv` - contains the identified fusions abridged + - `starfusion.abridged.coding_effect.tsv`
-[FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/). - -![MultiQC - FastQC sequence counts plot](images/mqc_fastqc_counts.png) - -![MultiQC - FastQC mean quality scores plot](images/mqc_fastqc_quality.png) - -![MultiQC - FastQC adapter content plot](images/mqc_fastqc_adapter.png) - -> **NB:** The FastQC plots displayed in the MultiQC report shows _untrimmed_ reads. They may contain adapter sequence and potentially regions with low quality. - -### MultiQC +### StringTie
Output files -- `multiqc/` - - `multiqc_report.html`: a standalone HTML file that can be viewed in your web browser. - - `multiqc_data/`: directory containing parsed statistics from the different tools used in the pipeline. - - `multiqc_plots/`: directory containing static images from the report in various formats. - +- `stringtie//stringtie.merged.gtf` - merged gtf from annotation and stringtie output gtfs
-[MultiQC](http://multiqc.info) is a visualization tool that generates a single HTML report summarising all samples in your project. Most of the pipeline QC results are visualised in the report and further statistics are available in the report data directory. - -Results generated by MultiQC collate pipeline QC from supported tools e.g. FastQC. The pipeline has special steps which also allow the software versions to be reported in the MultiQC output for future traceability. For more information about how to use MultiQC reports, see . - ### Pipeline information
@@ -411,6 +427,7 @@ Results generated by MultiQC collate pipeline QC from supported tools e.g. FastQ - Reports generated by Nextflow: `execution_report.html`, `execution_timeline.html`, `execution_trace.txt` and `pipeline_dag.dot`/`pipeline_dag.svg`. - Reports generated by the pipeline: `pipeline_report.html`, `pipeline_report.txt` and `software_versions.yml`. The `pipeline_report*` files will only be present if the `--email` / `--email_on_fail` parameter's are used when running the pipeline. - Reformatted samplesheet files used as input to the pipeline: `samplesheet.valid.csv`. + - Parameters used by the pipeline run: `params.json`.
diff --git a/docs/usage.md b/docs/usage.md index 5eb23ccd..b3625332 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -4,31 +4,27 @@ > _Documentation of pipeline parameters is generated automatically from the pipeline schema and can no longer be found in markdown files._ -## Introduction +## Pipeline summary The pipeline is divided into two parts: 1. Download and build references - specified with `--build_references` parameter - required only once before running the pipeline - - **Important**: rerun with each new release + - **Important**: has to be run with each new release 2. Detecting fusions - - Supported tools: `Arriba`, `FusionCatcher`, `pizzly`, `SQUID`, `STAR-Fusion` and `StringTie` - - QC: `Fastqc` and `MultiQC` - - Fusion visualization: `Arriba` (only fusion detected with Arriba), `fusion-report` and `FusionInspector` + - Supported tools: `Arriba`, `FusionCatcher`, `STAR-Fusion`, and `StringTie` + - QC: `Fastqc`, `MultiQC`, and `Picard CollectInsertSize`, `Picard CollectWgsMetrics`, `Picard Markduplicates` + - Fusions visualization: `Arriba`, `fusion-report`, `FusionInspector`, and `vcf_collect` -### 1. Download and build references +## Download and build references The rnafusion pipeline needs references for the fusion detection tools, so downloading these is a **requirement**. -Whilst it is possible to download and build each reference manually, it is advised to download references with the rnafusion pipeline. -First register for a free account at COSMIC at [https://cancer.sanger.ac.uk/cosmic/register](https://cancer.sanger.ac.uk/cosmic/register) using your university email. The account is **only activated upon** clicking the link in the registration email. - -Download the references as shown below including your COSMIC credentials. - -> Note that this step takes about 24 hours to complete on HPC. - -> Do not provide a samplesheet via the `input` parameter, otherwise the pipeline will run the analysis directly after downloading the references (except if that is what you want). +> **IMPORTANT** +> +> - Note that this step takes about 24 hours to complete on HPC. +> - Do not provide a samplesheet via the `input` parameter, otherwise the pipeline will run the analysis directly after downloading the references (except if that is what you want). ```bash nextflow run nf-core/rnafusion \ @@ -48,7 +44,15 @@ nextflow run nf-core/rnafusion \ --outdir ``` -#### Using QIAGEN download insead of SANGER (non-academic usage) for the COSMIC database +### Downloading the cosmic database with SANGER or QUIAGEN + +#### For academic users + +First register for a free account at COSMIC at [https://cancer.sanger.ac.uk/cosmic/register](https://cancer.sanger.ac.uk/cosmic/register) using a university email. The account is **only activated upon** clicking the link in the registration email. + +#### For non-academic users + +Use credentials from QIAGEN and add `--qiagen` ```bash nextflow run nf-core/rnafusion \ @@ -58,23 +62,13 @@ nextflow run nf-core/rnafusion \ --outdir --qiagen ``` -#### References directory tree +#### STAR-Fusion references downloaded vs built -```text -references/ -|-- arriba -|-- ensembl -|-- fusion_report_db -|-- fusioncatcher -| `-- human_v102 -|-- pizzly -|-- star -`-- starfusion -``` +By default STAR-Fusion references are **built**. You can also download them from [CTAT](https://github.com/NCIP/Trinity_CTAT/wiki) by using the flag `--starfusion_build FALSE` for both reference building and fusion detection. This allows more flexibility for different organisms but **be aware that STAR-Fusion reference download is not recommended as not fully tested!** #### Issues with building references -If process `FUSIONREPORT_DOWNLOAD` times out, it could be due to network restriction (e.g. if trying to run on HPC). As this process is lightweight in compute, storage and time, running on local machines with the following options might solve the issue: +If process `FUSIONREPORT_DOWNLOAD` times out, it could be due to network restriction (for example if trying to run on HPC). As this process is lightweight in cpu, memory and time, running on local machines with the following options might solve the issue: ```bash nextflow run nf-core/rnafusion \ @@ -85,7 +79,7 @@ nextflow run nf-core/rnafusion \ --outdir ``` -Adjustments for compute requirements can be done by feeding a custom configuration with `-c /PATH/TO/CUSTOM/CONFIG`. +Adjustments for cpu and memory requirements can be done by feeding a custom configuration with `-c /PATH/TO/CUSTOM/CONFIG`. Where the custom configuration could look like (adaptation to local machine necessary): ```text @@ -100,17 +94,40 @@ process { The four `fusion-report` files: `cosmic.db`, `fusiongdb.db`, `fusiongdb2.db`, `mitelman.db` should then be copied into the HPC `/references/fusion_report_db`. -#### Non-human references +#### Note about fusioncatcher references -Non-human references, not supported by default, can be built manually and fed to rnafusion using the parameter `--_ref`. +The references are only built based on ensembl version 102. It is not possible currently to use any other version/source. -#### STAR-Fusion references downloaded vs built +## Running the pipeline -By default STAR-Fusion references are **built**. You can also download them from [CTAT](https://github.com/NCIP/Trinity_CTAT/wiki) by using the flag `--starfusion_build FALSE` for both reference building and fusion detection. This allows more flexibility for different organisms but **be aware that STAR-Fusion reference download is not recommended as not fully tested!** +### Samplesheet input + +You will need to create a samplesheet with information about the samples you would like to analyse before running the pipeline. The pipeline will detect whether a sample is single- or paired-end from the samplesheet - the `fastq_2` column is empty for single-end. The samplesheet has to be a comma-separated file (.csv) but can have as many columns as you desire. There is a strict requirement for the first 4 columns to match those defined in the table below with the header row included. +A final samplesheet file consisting of both single- and paired-end data may look something like the one below. This is for 6 samples, where `TREATMENT_REP3` has been sequenced twice. + +```console +sample,fastq_1,fastq_2,strandedness +CONTROL_REP1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz,forward +CONTROL_REP2,AEG588A2_S2_L002_R1_001.fastq.gz,AEG588A2_S2_L002_R2_001.fastq.gz,forward +CONTROL_REP3,AEG588A3_S3_L002_R1_001.fastq.gz,AEG588A3_S3_L002_R2_001.fastq.gz,forward +TREATMENT_REP1,AEG588A4_S4_L003_R1_001.fastq.gz,,forward +TREATMENT_REP2,AEG588A5_S5_L003_R1_001.fastq.gz,,forward +TREATMENT_REP3,AEG588A6_S6_L003_R1_001.fastq.gz,,forward +TREATMENT_REP3,AEG588A6_S6_L004_R1_001.fastq.gz,,forward +``` + +As you can see above for multiple runs of the same sample, the `sample` name has to be the same when you have re-sequenced the same sample more than once e.g. to increase sequencing depth. The pipeline will concatenate the raw reads before performing any downstream analysis. + +| Column | Description | +| -------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `sample` | Custom sample name. This entry will be identical for multiple sequencing libraries/runs from the same sample. Spaces in sample names are automatically converted to underscores (`_`). | +| `fastq_1` | Full path to FastQ file for Illumina short reads 1. File has to be gzipped and have the extension ".fastq.gz" or ".fq.gz". | +| `fastq_2` | Full path to FastQ file for Illumina short reads 2. File has to be gzipped and have the extension ".fastq.gz" or ".fq.gz". | +| `strandedness` | Strandedness: forward or reverse. | -### 2. Detecting fusions +### Starting commands -This step can either be run using all fusion detection tools or specifying individual tools. Visualisation tools will be run on all fusions detected. To run all tools (`arriba`, `fusioncatcher`, `pizzly`, `squid`, `starfusion`, `stringtie`) use the `--all` parameter: +The pipeline can either be run using all fusion detection tools or specifying individual tools. Visualisation tools will be run on all fusions detected. To run all tools (`arriba`, `fusioncatcher`, `starfusion`, `stringtie`) use the `--all` parameter: ```bash nextflow run nf-core/rnafusion \ @@ -120,11 +137,7 @@ nextflow run nf-core/rnafusion \ --outdir ``` -> **IMPORTANT: Either `--all` or `--`** is necessary to run detection tools - -`--genomes_base` should be the path to the directory containing the folder `references/` that was built in step 1 `build_references`. - -Alternatively, to run only a specific detection tool use: `--tool`: +To run only a specific detection tool use: `--tool`: ```bash nextflow run nf-core/rnafusion \ @@ -134,26 +147,53 @@ nextflow run nf-core/rnafusion \ --outdir ``` -#### Trimming +> **IMPORTANT: Either `--all` or `--`** is necessary to run detection tools -There are 2 options to trim +`--genomes_base` should be the path to the directory containing the folder `references/` that was built with `--build_references`. -1. fastp - In this case all tools use the trimmed reads. Quality and adapter trimming by default. In addition, tail trimming and adapter_fastq specification are possible. Example usage: +Note that the pipeline will create the following files in your working directory: ```bash -nextflow run nf-core/rnafusion \ --- -- ... \ ---input \ ---genomes_base \ ---outdir \ ---fastp_trim \ ---trim_tail (optional) \ ---adapter_fastq (optional) +work # Directory containing the nextflow working files + # Finished results in specified location (defined with --outdir) +.nextflow_log # Log file from Nextflow +# Other nextflow hidden files, eg. history of pipeline runs and old logs. ``` -2. hard trimming - In this case, only reads fed to fusioncatcher are trimmed. This is a harsh workaround in case of high read-through. The recommended trimming is thus the fastp_trim one. The trimming is done at 75 bp from the tails. Example usage: +If you wish to repeatedly use the same parameters for multiple runs, rather than specifying each flag in the command, you can specify these in a params file. + +Pipeline settings can be provided in a `yaml` or `json` file via `-params-file `. + +:::warning +Do not use `-c ` to specify parameters as this will result in errors. Custom config files specified with `-c` must only be used for [tuning process resource specifications](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources), other infrastructural tweaks (such as output directories), or module arguments (args). +::: + +The above pipeline run specified with a params file in yaml format: + +```bash +nextflow run nf-core/rnafusion -profile docker -params-file params.yaml +``` + +with `params.yaml` containing: + +```yaml +input: './samplesheet.csv' +outdir: './results/' +<...> +``` + +You can also generate such `YAML`/`JSON` files via [nf-core/launch](https://nf-co.re/launch). + +:::warning +Conda is not currently supported. +Supported genome is currently only GRCh38. +::: + +### Options + +#### Trimming + +When the flag `--fastp_trim` is used, `fastp` is used to provide all tools with trimmed reads. Quality and adapter trimming by default. In addition, tail trimming and adapter_fastq specification are possible. Example usage: ```bash nextflow run nf-core/rnafusion \ @@ -161,7 +201,9 @@ nextflow run nf-core/rnafusion \ --input \ --genomes_base \ --outdir \ ---trim +--fastp_trim \ +--trim_tail (optional) \ +--adapter_fastq (optional) ``` #### Filter fusions detected by 2 or more tools @@ -172,12 +214,10 @@ nextflow run nf-core/rnafusion \ --input \ --genomes_base \ --outdir - --fusioninspector_filter - --fusionreport_filter + --tools_cutoff ``` -`--fusioninspector_filter` feed only fusions detected by 2 or more tools to fusioninspector for closer analysis (false by default). -`--fusionreport_filter` displays only fusions detected by 2 or more tools in fusionreport html index (true by default). +`--tools_cutoff INT` will discard fusions detected by less than INT tools both for display in fusionreport html index and to consider in fusioninspector. Default = 1, no filtering. #### Adding custom fusions to consider as well as the detected set: whitelist @@ -199,7 +239,7 @@ GENE3--GENE4 #### Running FusionInspector only -FusionInspector can be run standalone with: +FusionInspector can be run as a standalone with: ```bash nextflow run nf-core/rnafusion \ @@ -227,7 +267,7 @@ nextflow run nf-core/rnafusion \ --outdir ``` -This will skip all QC-related processes. +This will skip all QC-related processes (picard metrics collection) #### Skipping visualisation @@ -246,65 +286,30 @@ This will skip all visualisation processes, including `fusion-report`, `FusionIn It is possible to give the output of each tool manually using the argument: `--_fusions PATH/TO/FUSION/FILE`: this feature need more testing, don't hesitate to open an issue if you encounter problems. -## Samplesheet input - -You will need to create a samplesheet with information about the samples you would like to analyse before running the pipeline. Use the `--input` parameter to specify its location. The pipeline will detect whether a sample is single- or paired-end from the samplesheet - the `fastq_2` column is empty for single-end. The samplesheet has to be a comma-separated file (.csv) but can have as many columns as you desire. There is a strict requirement for the first 4 columns to match those defined in the table below with the header row included. -A final samplesheet file consisting of both single- and paired-end data may look something like the one below. This is for 6 samples, where `TREATMENT_REP3` has been sequenced twice. +#### Set different `--limitSjdbInsertNsj` parameter -```console -sample,fastq_1,fastq_2,strandedness -CONTROL_REP1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz,forward -CONTROL_REP2,AEG588A2_S2_L002_R1_001.fastq.gz,AEG588A2_S2_L002_R2_001.fastq.gz,forward -CONTROL_REP3,AEG588A3_S3_L002_R1_001.fastq.gz,AEG588A3_S3_L002_R2_001.fastq.gz,forward -TREATMENT_REP1,AEG588A4_S4_L003_R1_001.fastq.gz,,forward -TREATMENT_REP2,AEG588A5_S5_L003_R1_001.fastq.gz,,forward -TREATMENT_REP3,AEG588A6_S6_L003_R1_001.fastq.gz,,forward -TREATMENT_REP3,AEG588A6_S6_L004_R1_001.fastq.gz,,forward -``` +There are two parameters to increase the `--limitSjdbInsertNsj` parameter if necessary: -| Column | Description | -| -------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `sample` | Custom sample name. This entry will be identical for multiple sequencing libraries/runs from the same sample. Spaces in sample names are automatically converted to underscores (`_`). | -| `fastq_1` | Full path to FastQ file for Illumina short reads 1. File has to be gzipped and have the extension ".fastq.gz" or ".fq.gz". | -| `fastq_2` | Full path to FastQ file for Illumina short reads 2. File has to be gzipped and have the extension ".fastq.gz" or ".fq.gz". | -| `strandedness` | Strandedness: forward or reverse. | +- `--fusioncatcher_limitSjdbInsertNsj`, default: 2000000 +- `--fusioninspector_limitSjdbInsertNsj`, default: 1000000 -An [example samplesheet](../assets/samplesheet.csv) has been provided with the pipeline. +Use the parameter `--cram` to compress the BAM files to CRAM for specific tools. Options: arriba, starfusion. Leave no space between options: -As you can see above for multiple runs of the same sample, the `sample` name has to be the same when you have re-sequenced the same sample more than once e.g. to increase sequencing depth. The pipeline will concatenate the raw reads before performing any downstream analysis. Below is an example for the same sample sequenced across 3 lanes: +- `--cram arriba,starfusion`, default: [] +- `--cram arriba` -```bash -sample,fastq_1,fastq_2,strandedness -CONTROL_REP1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz,forward -CONTROL_REP1,AEG588A1_S1_L003_R1_001.fastq.gz,AEG588A1_S1_L003_R2_001.fastq.gz,forward -CONTROL_REP1,AEG588A1_S1_L004_R1_001.fastq.gz,AEG588A1_S1_L004_R2_001.fastq.gz,forward -``` +### Troubleshooting -## Running the pipeline +#### GstrandBit issues -The typical command for running the pipeline is as follows. +The issue below sometimes occurs: -```bash -nextflow run nf-core/rnafusion --input samplesheet.csv --outdir --genome GRCh38 -profile docker ``` - -This will launch the pipeline with the `docker` configuration profile. See below for more information about profiles. - -Note that the pipeline will create the following files in your working directory: - -```bash -work # Directory containing the nextflow working files - # Finished results in specified location (defined with --outdir) -.nextflow_log # Log file from Nextflow -# Other nextflow hidden files, eg. history of pipeline runs and old logs. +EXITING because of FATAL ERROR: cannot insert sequence on the fly because of strand GstrandBit problem +SOLUTION: please contact STAR author at https://groups.google.com/forum/#!forum/rna-star ``` -#### Set different `--limitSjdbInsertNsj` parameter - -There are two parameters to increase the `--limitSjdbInsertNsj` parameter if necessary: - -- `--fusioncatcher_limitSjdbInsertNsj`, default: 2000000 -- `--fusioninspector_limitSjdbInsertNsj`, default: 1000000 +As the error message suggests, it is a STAR-related error and your best luck in solving it will be the forum. ### Updating the pipeline @@ -314,13 +319,6 @@ When you run the above command, Nextflow automatically pulls the pipeline code f nextflow pull nf-core/rnafusion ``` -#### Compress to CRAM file - -Use the parameter `--cram` to compress the BAM files to CRAM for specific tools. Options: arriba, squid, starfusion. Leave no space between options: - -- `--cram arriba,squid,starfusion`, default: [] -- `--cram arriba` - ### Reproducibility It is a good idea to specify a pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you'll be running the same version of the pipeline, even if there have been changes to the code since. @@ -329,17 +327,27 @@ First, go to the [nf-core/rnafusion releases page](https://github.com/nf-core/rn This version number will be logged in reports when you run the pipeline, so that you'll know what you used when you look back in the future. For example, at the bottom of the MultiQC reports. +To further assist in reproducbility, you can use share and re-use [parameter files](#running-the-pipeline) to repeat pipeline runs with the same settings without having to write out a command with every single parameter. + +:::tip +If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles. +::: + ## Core Nextflow arguments -> **NB:** These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen). +:::note +These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen). +::: ### `-profile` Use this parameter to choose a configuration profile. Profiles can give configuration presets for different compute environments. -Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Shifter, Charliecloud, Conda) - see below. +Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Shifter, Charliecloud, Apptainer, Conda) - see below. -> We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported. +:::info +We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported. +::: The pipeline also dynamically loads configurations from [https://github.com/nf-core/configs](https://github.com/nf-core/configs) when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to see if your system is available in these configs please see the [nf-core/configs documentation](https://github.com/nf-core/configs#documentation). @@ -361,8 +369,10 @@ If `-profile` is not specified, the pipeline will run locally and expect all sof - A generic configuration profile to be used with [Shifter](https://nersc.gitlab.io/development/shifter/how-to-use/) - `charliecloud` - A generic configuration profile to be used with [Charliecloud](https://hpc.github.io/charliecloud/) +- `apptainer` + - A generic configuration profile to be used with [Apptainer](https://apptainer.org/) - `conda` - - A generic configuration profile to be used with [Conda](https://conda.io/docs/). Please only use Conda as a last resort i.e. when it's not possible to run the pipeline with Docker, Singularity, Podman, Shifter or Charliecloud. + - A generic configuration profile to be used with [Conda](https://conda.io/docs/). Please only use Conda as a last resort i.e. when it's not possible to run the pipeline with Docker, Singularity, Podman, Shifter, Charliecloud, or Apptainer. - `test` - A profile with a complete configuration for automated testing - Includes links to test data so needs no other parameters @@ -385,138 +395,19 @@ Specify the path to a specific config file (this is a core Nextflow command). Se Whilst the default requirements set within the pipeline will hopefully work for most people and with most input data, you may find that you want to customise the compute resources that the pipeline requests. Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the steps in the pipeline, if the job exits with any of the error codes specified [here](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/conf/base.config#L18) it will automatically be resubmitted with higher requests (2 x original, then 3 x original). If it still fails after the third attempt then the pipeline execution is stopped. -For example, if the nf-core/rnaseq pipeline is failing after multiple re-submissions of the `STAR_ALIGN` process due to an exit code of `137` this would indicate that there is an out of memory issue: - -```console -[62/149eb0] NOTE: Process `NFCORE_RNASEQ:RNASEQ:ALIGN_STAR:STAR_ALIGN (WT_REP1)` terminated with an error exit status (137) -- Execution is retried (1) -Error executing process > 'NFCORE_RNASEQ:RNASEQ:ALIGN_STAR:STAR_ALIGN (WT_REP1)' - -Caused by: - Process `NFCORE_RNASEQ:RNASEQ:ALIGN_STAR:STAR_ALIGN (WT_REP1)` terminated with an error exit status (137) - -Command executed: - STAR \ - --genomeDir star \ - --readFilesIn WT_REP1_trimmed.fq.gz \ - --runThreadN 2 \ - --outFileNamePrefix WT_REP1. \ - - -Command exit status: - 137 - -Command output: - (empty) - -Command error: - .command.sh: line 9: 30 Killed STAR --genomeDir star --readFilesIn WT_REP1_trimmed.fq.gz --runThreadN 2 --outFileNamePrefix WT_REP1. -Work dir: - /home/pipelinetest/work/9d/172ca5881234073e8d76f2a19c88fb - -Tip: you can replicate the issue by changing to the process work dir and entering the command `bash .command.run` -``` - -#### For beginners - -A first step to bypass this error, you could try to increase the amount of CPUs, memory, and time for the whole pipeline. Therefor you can try to increase the resource for the parameters `--max_cpus`, `--max_memory`, and `--max_time`. Based on the error above, you have to increase the amount of memory. Therefore you can go to the [parameter documentation of rnaseq](https://nf-co.re/rnaseq/3.9/parameters) and scroll down to the `show hidden parameter` button to get the default value for `--max_memory`. In this case 128GB, you than can try to run your pipeline again with `--max_memory 200GB -resume` to skip all process, that were already calculated. If you can not increase the resource of the complete pipeline, you can try to adapt the resource for a single process as mentioned below. - -#### Advanced option on process level - -To bypass this error you would need to find exactly which resources are set by the `STAR_ALIGN` process. The quickest way is to search for `process STAR_ALIGN` in the [nf-core/rnaseq Github repo](https://github.com/nf-core/rnaseq/search?q=process+STAR_ALIGN). -We have standardised the structure of Nextflow DSL2 pipelines such that all module files will be present in the `modules/` directory and so, based on the search results, the file we want is `modules/nf-core/star/align/main.nf`. -If you click on the link to that file you will notice that there is a `label` directive at the top of the module that is set to [`label process_high`](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/modules/nf-core/software/star/align/main.nf#L9). -The [Nextflow `label`](https://www.nextflow.io/docs/latest/process.html#label) directive allows us to organise workflow processes in separate groups which can be referenced in a configuration file to select and configure subset of processes having similar computing requirements. -The default values for the `process_high` label are set in the pipeline's [`base.config`](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/conf/base.config#L33-L37) which in this case is defined as 72GB. -Providing you haven't set any other standard nf-core parameters to **cap** the [maximum resources](https://nf-co.re/usage/configuration#max-resources) used by the pipeline then we can try and bypass the `STAR_ALIGN` process failure by creating a custom config file that sets at least 72GB of memory, in this case increased to 100GB. -The custom config below can then be provided to the pipeline via the [`-c`](#-c) parameter as highlighted in previous sections. - -```nextflow -process { - withName: 'NFCORE_RNASEQ:RNASEQ:ALIGN_STAR:STAR_ALIGN' { - memory = 100.GB - } -} -``` - -> **NB:** We specify the full process name i.e. `NFCORE_RNASEQ:RNASEQ:ALIGN_STAR:STAR_ALIGN` in the config file because this takes priority over the short name (`STAR_ALIGN`) and allows existing configuration using the full process name to be correctly overridden. - -If you get a warning suggesting that the process selector isn't recognised check that the process name has been specified correctly. - -### Tool-specific options - -For the ultimate flexibility, we have implemented and are using Nextflow DSL2 modules in a way where it is possible for both developers and users to change tool-specific command-line arguments (e.g. providing an additional command-line argument to the `STAR_ALIGN` process) as well as publishing options (e.g. saving files produced by the `STAR_ALIGN` process that aren't saved by default by the pipeline). In the majority of instances, as a user you won't have to change the default options set by the pipeline developer(s), however, there may be edge cases where creating a simple custom config file can improve the behaviour of the pipeline if for example it is failing due to a weird error that requires setting a tool-specific parameter to deal with smaller / larger genomes. - -The command-line arguments passed to STAR in the `STAR_ALIGN` module are a combination of: - -- Mandatory arguments or those that need to be evaluated within the scope of the module, as supplied in the [`script`](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/modules/nf-core/software/star/align/main.nf#L49-L55) section of the module file. - -- An [`options.args`](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/modules/nf-core/software/star/align/main.nf#L56) string of non-mandatory parameters that is set to be empty by default in the module but can be overwritten when including the module in the sub-workflow / workflow context via the `addParams` Nextflow option. - -The nf-core/rnaseq pipeline has a sub-workflow (see [terminology](https://github.com/nf-core/modules#terminology)) specifically to align reads with STAR and to sort, index and generate some basic stats on the resulting BAM files using SAMtools. At the top of this file we import the `STAR_ALIGN` module via the Nextflow [`include`](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/subworkflows/nf-core/align_star.nf#L10) keyword and by default the options passed to the module via the `addParams` option are set as an empty Groovy map [here](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/subworkflows/nf-core/align_star.nf#L5); this in turn means `options.args` will be set to empty by default in the module file too. This is an intentional design choice and allows us to implement well-written sub-workflows composed of a chain of tools that by default run with the bare minimum parameter set for any given tool in order to make it much easier to share across pipelines and to provide the flexibility for users and developers to customise any non-mandatory arguments. - -When including the sub-workflow above in the main pipeline workflow we use the same `include` statement, however, we now have the ability to overwrite options for each of the tools in the sub-workflow including the [`align_options`](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/workflows/rnaseq.nf#L225) variable that will be used specifically to overwrite the optional arguments passed to the `STAR_ALIGN` module. In this case, the options to be provided to `STAR_ALIGN` have been assigned sensible defaults by the developer(s) in the pipeline's [`modules.config`](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/conf/modules.config#L70-L74) and can be accessed and customised in the [workflow context](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/workflows/rnaseq.nf#L201-L204) too before eventually passing them to the sub-workflow as a Groovy map called `star_align_options`. These options will then be propagated from `workflow -> sub-workflow -> module`. - -As mentioned at the beginning of this section it may also be necessary for users to overwrite the options passed to modules to be able to customise specific aspects of the way in which a particular tool is executed by the pipeline. Given that all of the default module options are stored in the pipeline's `modules.config` as a [`params` variable](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/conf/modules.config#L24-L25) it is also possible to overwrite any of these options via a custom config file. - -Say for example we want to append an additional, non-mandatory parameter (i.e. `--outFilterMismatchNmax 16`) to the arguments passed to the `STAR_ALIGN` module. Firstly, we need to copy across the default `args` specified in the [`modules.config`](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/conf/modules.config#L71) and create a custom config file that is a composite of the default `args` as well as the additional options you would like to provide. This is very important because Nextflow will overwrite the default value of `args` that you provide via the custom config. - -As you will see in the example below, we have: - -- appended `--outFilterMismatchNmax 16` to the default `args` used by the module. -- changed the default `publishDir` value to where the files will eventually be published in the main results directory. -- appended `'bam':''` to the default value of `publish_files` so that the BAM files generated by the process will also be saved in the top-level results directory for the module. Note: `'out':'log'` means any file/directory ending in `out` will now be saved in a separate directory called `my_star_directory/log/`. - -```nextflow -params { - modules { - 'star_align' { - args = "--quantMode omeSAM --twopassMode Basic --outSAMtype BAM Unsorted --readFilesCommand zcat --runRNGseed 0 --outFilterMultimapNmax 20 --alignSJDBoverhangMin 1 --outSAMattributes NH HI AS NM MD --quantomeBan Singleend --outFilterMismatchNmax 16" - publishDir = "my_star_directory" - publish_files = ['out':'log', 'tab':'log', 'bam':''] - } - } -} -``` - -### Updating containers (advanced users) - -The [Nextflow DSL2](https://www.nextflow.io/docs/latest/dsl2.html) implementation of this pipeline uses one container per process which makes it much easier to maintain and update software dependencies. If for some reason you need to use a different version of a particular tool with the pipeline then you just need to identify the `process` name and override the Nextflow `container` definition for that process using the `withName` declaration. For example, in the [nf-core/viralrecon](https://nf-co.re/viralrecon) pipeline a tool called [Pangolin](https://github.com/cov-lineages/pangolin) has been used during the COVID-19 pandemic to assign lineages to SARS-CoV-2 genome sequenced samples. Given that the lineage assignments change quite frequently it doesn't make sense to re-release the nf-core/viralrecon everytime a new version of Pangolin has been released. However, you can override the default container used by the pipeline by creating a custom config file and passing it as a command-line argument via `-c custom.config`. - -1. Check the default version used by the pipeline in the module file for [Pangolin](https://github.com/nf-core/viralrecon/blob/a85d5969f9025409e3618d6c280ef15ce417df65/modules/nf-core/software/pangolin/main.nf#L14-L19) -2. Find the latest version of the Biocontainer available on [Quay.io](https://quay.io/repository/biocontainers/pangolin?tag=latest&tab=tags) -3. Create the custom config accordingly: - - - For Docker: +To change the resource requests, please see the [max resources](https://nf-co.re/docs/usage/configuration#max-resources) and [tuning workflow resources](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources) section of the nf-core website. - ```nextflow - process { - withName: PANGOLIN { - container = 'quay.io/biocontainers/pangolin:3.0.5--pyhdfd78af_0' - } - } - ``` +### Custom Containers - - For Singularity: +In some cases you may wish to change which container or conda environment a step of the pipeline uses for a particular tool. By default nf-core pipelines use containers and software from the [biocontainers](https://biocontainers.pro/) or [bioconda](https://bioconda.github.io/) projects. However in some cases the pipeline specified version maybe out of date. - ```nextflow - process { - withName: PANGOLIN { - container = 'https://depot.galaxyproject.org/singularity/pangolin:3.0.5--pyhdfd78af_0' - } - } - ``` +To use a different container from the default container or conda environment specified in a pipeline, please see the [updating tool versions](https://nf-co.re/docs/usage/configuration#updating-tool-versions) section of the nf-core website. - - For Conda: +### Custom Tool Arguments - ```nextflow - process { - withName: PANGOLIN { - conda = 'bioconda::pangolin=3.0.5' - } - } - ``` +A pipeline might not always support every possible argument or option of a particular tool used in pipeline. Fortunately, nf-core pipelines provide some freedom to users to insert additional parameters that the pipeline does not include by default. -> **NB:** If you wish to periodically update individual tool-specific results (e.g. Pangolin) generated by the pipeline then you must ensure to keep the `work/` directory otherwise the `-resume` ability of the pipeline will be compromised and it will restart from scratch. +To learn how to provide additional arguments to a particular tool of the pipeline, please see the [customising tool arguments](https://nf-co.re/docs/usage/configuration#customising-tool-arguments) section of the nf-core website. ### nf-core/configs diff --git a/lib/NfcoreSchema.groovy b/lib/NfcoreSchema.groovy deleted file mode 100755 index 33cd4f6e..00000000 --- a/lib/NfcoreSchema.groovy +++ /dev/null @@ -1,528 +0,0 @@ -// -// This file holds several functions used to perform JSON parameter validation, help and summary rendering for the nf-core pipeline template. -// - -import org.everit.json.schema.Schema -import org.everit.json.schema.loader.SchemaLoader -import org.everit.json.schema.ValidationException -import org.json.JSONObject -import org.json.JSONTokener -import org.json.JSONArray -import groovy.json.JsonSlurper -import groovy.json.JsonBuilder - -class NfcoreSchema { - - // - // Resolve Schema path relative to main workflow directory - // - public static String getSchemaPath(workflow, schema_filename='nextflow_schema.json') { - return "${workflow.projectDir}/${schema_filename}" - } - - // - // Function to loop over all parameters defined in schema and check - // whether the given parameters adhere to the specifications - // - /* groovylint-disable-next-line UnusedPrivateMethodParameter */ - public static void validateParameters(workflow, params, log, schema_filename='nextflow_schema.json') { - def has_error = false - //~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~// - // Check for nextflow core params and unexpected params - def json = new File(getSchemaPath(workflow, schema_filename=schema_filename)).text - def Map schemaParams = (Map) new JsonSlurper().parseText(json).get('definitions') - def nf_params = [ - // Options for base `nextflow` command - 'bg', - 'c', - 'C', - 'config', - 'd', - 'D', - 'dockerize', - 'h', - 'log', - 'q', - 'quiet', - 'syslog', - 'v', - - // Options for `nextflow run` command - 'ansi', - 'ansi-log', - 'bg', - 'bucket-dir', - 'c', - 'cache', - 'config', - 'dsl2', - 'dump-channels', - 'dump-hashes', - 'E', - 'entry', - 'latest', - 'lib', - 'main-script', - 'N', - 'name', - 'offline', - 'params-file', - 'pi', - 'plugins', - 'poll-interval', - 'pool-size', - 'profile', - 'ps', - 'qs', - 'queue-size', - 'r', - 'resume', - 'revision', - 'stdin', - 'stub', - 'stub-run', - 'test', - 'w', - 'with-charliecloud', - 'with-conda', - 'with-dag', - 'with-docker', - 'with-mpi', - 'with-notification', - 'with-podman', - 'with-report', - 'with-singularity', - 'with-timeline', - 'with-tower', - 'with-trace', - 'with-weblog', - 'without-docker', - 'without-podman', - 'work-dir' - ] - def unexpectedParams = [] - - // Collect expected parameters from the schema - def expectedParams = [] - def enums = [:] - for (group in schemaParams) { - for (p in group.value['properties']) { - expectedParams.push(p.key) - if (group.value['properties'][p.key].containsKey('enum')) { - enums[p.key] = group.value['properties'][p.key]['enum'] - } - } - } - - for (specifiedParam in params.keySet()) { - // nextflow params - if (nf_params.contains(specifiedParam)) { - log.error "ERROR: You used a core Nextflow option with two hyphens: '--${specifiedParam}'. Please resubmit with '-${specifiedParam}'" - has_error = true - } - // unexpected params - def params_ignore = params.schema_ignore_params.split(',') + 'schema_ignore_params' - def expectedParamsLowerCase = expectedParams.collect{ it.replace("-", "").toLowerCase() } - def specifiedParamLowerCase = specifiedParam.replace("-", "").toLowerCase() - def isCamelCaseBug = (specifiedParam.contains("-") && !expectedParams.contains(specifiedParam) && expectedParamsLowerCase.contains(specifiedParamLowerCase)) - if (!expectedParams.contains(specifiedParam) && !params_ignore.contains(specifiedParam) && !isCamelCaseBug) { - // Temporarily remove camelCase/camel-case params #1035 - def unexpectedParamsLowerCase = unexpectedParams.collect{ it.replace("-", "").toLowerCase()} - if (!unexpectedParamsLowerCase.contains(specifiedParamLowerCase)){ - unexpectedParams.push(specifiedParam) - } - } - } - - //~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~// - // Validate parameters against the schema - InputStream input_stream = new File(getSchemaPath(workflow, schema_filename=schema_filename)).newInputStream() - JSONObject raw_schema = new JSONObject(new JSONTokener(input_stream)) - - // Remove anything that's in params.schema_ignore_params - raw_schema = removeIgnoredParams(raw_schema, params) - - Schema schema = SchemaLoader.load(raw_schema) - - // Clean the parameters - def cleanedParams = cleanParameters(params) - - // Convert to JSONObject - def jsonParams = new JsonBuilder(cleanedParams) - JSONObject params_json = new JSONObject(jsonParams.toString()) - - // Validate - try { - schema.validate(params_json) - } catch (ValidationException e) { - println '' - log.error 'ERROR: Validation of pipeline parameters failed!' - JSONObject exceptionJSON = e.toJSON() - printExceptions(exceptionJSON, params_json, log, enums) - println '' - has_error = true - } - - // Check for unexpected parameters - if (unexpectedParams.size() > 0) { - Map colors = NfcoreTemplate.logColours(params.monochrome_logs) - println '' - def warn_msg = 'Found unexpected parameters:' - for (unexpectedParam in unexpectedParams) { - warn_msg = warn_msg + "\n* --${unexpectedParam}: ${params[unexpectedParam].toString()}" - } - log.warn warn_msg - log.info "- ${colors.dim}Ignore this warning: params.schema_ignore_params = \"${unexpectedParams.join(',')}\" ${colors.reset}" - println '' - } - - if (has_error) { - System.exit(1) - } - } - - // - // Beautify parameters for --help - // - public static String paramsHelp(workflow, params, command, schema_filename='nextflow_schema.json') { - Map colors = NfcoreTemplate.logColours(params.monochrome_logs) - Integer num_hidden = 0 - String output = '' - output += 'Typical pipeline command:\n\n' - output += " ${colors.cyan}${command}${colors.reset}\n\n" - Map params_map = paramsLoad(getSchemaPath(workflow, schema_filename=schema_filename)) - Integer max_chars = paramsMaxChars(params_map) + 1 - Integer desc_indent = max_chars + 14 - Integer dec_linewidth = 160 - desc_indent - for (group in params_map.keySet()) { - Integer num_params = 0 - String group_output = colors.underlined + colors.bold + group + colors.reset + '\n' - def group_params = params_map.get(group) // This gets the parameters of that particular group - for (param in group_params.keySet()) { - if (group_params.get(param).hidden && !params.show_hidden_params) { - num_hidden += 1 - continue; - } - def type = '[' + group_params.get(param).type + ']' - def description = group_params.get(param).description - def defaultValue = group_params.get(param).default != null ? " [default: " + group_params.get(param).default.toString() + "]" : '' - def description_default = description + colors.dim + defaultValue + colors.reset - // Wrap long description texts - // Loosely based on https://dzone.com/articles/groovy-plain-text-word-wrap - if (description_default.length() > dec_linewidth){ - List olines = [] - String oline = "" // " " * indent - description_default.split(" ").each() { wrd -> - if ((oline.size() + wrd.size()) <= dec_linewidth) { - oline += wrd + " " - } else { - olines += oline - oline = wrd + " " - } - } - olines += oline - description_default = olines.join("\n" + " " * desc_indent) - } - group_output += " --" + param.padRight(max_chars) + colors.dim + type.padRight(10) + colors.reset + description_default + '\n' - num_params += 1 - } - group_output += '\n' - if (num_params > 0){ - output += group_output - } - } - if (num_hidden > 0){ - output += colors.dim + "!! Hiding $num_hidden params, use --show_hidden_params to show them !!\n" + colors.reset - } - output += NfcoreTemplate.dashedLine(params.monochrome_logs) - return output - } - - // - // Groovy Map summarising parameters/workflow options used by the pipeline - // - public static LinkedHashMap paramsSummaryMap(workflow, params, schema_filename='nextflow_schema.json') { - // Get a selection of core Nextflow workflow options - def Map workflow_summary = [:] - if (workflow.revision) { - workflow_summary['revision'] = workflow.revision - } - workflow_summary['runName'] = workflow.runName - if (workflow.containerEngine) { - workflow_summary['containerEngine'] = workflow.containerEngine - } - if (workflow.container) { - workflow_summary['container'] = workflow.container - } - workflow_summary['launchDir'] = workflow.launchDir - workflow_summary['workDir'] = workflow.workDir - workflow_summary['projectDir'] = workflow.projectDir - workflow_summary['userName'] = workflow.userName - workflow_summary['profile'] = workflow.profile - workflow_summary['configFiles'] = workflow.configFiles.join(', ') - - // Get pipeline parameters defined in JSON Schema - def Map params_summary = [:] - def params_map = paramsLoad(getSchemaPath(workflow, schema_filename=schema_filename)) - for (group in params_map.keySet()) { - def sub_params = new LinkedHashMap() - def group_params = params_map.get(group) // This gets the parameters of that particular group - for (param in group_params.keySet()) { - if (params.containsKey(param)) { - def params_value = params.get(param) - def schema_value = group_params.get(param).default - def param_type = group_params.get(param).type - if (schema_value != null) { - if (param_type == 'string') { - if (schema_value.contains('$projectDir') || schema_value.contains('${projectDir}')) { - def sub_string = schema_value.replace('\$projectDir', '') - sub_string = sub_string.replace('\${projectDir}', '') - if (params_value.contains(sub_string)) { - schema_value = params_value - } - } - if (schema_value.contains('$params.outdir') || schema_value.contains('${params.outdir}')) { - def sub_string = schema_value.replace('\$params.outdir', '') - sub_string = sub_string.replace('\${params.outdir}', '') - if ("${params.outdir}${sub_string}" == params_value) { - schema_value = params_value - } - } - } - } - - // We have a default in the schema, and this isn't it - if (schema_value != null && params_value != schema_value) { - sub_params.put(param, params_value) - } - // No default in the schema, and this isn't empty - else if (schema_value == null && params_value != "" && params_value != null && params_value != false) { - sub_params.put(param, params_value) - } - } - } - params_summary.put(group, sub_params) - } - return [ 'Core Nextflow options' : workflow_summary ] << params_summary - } - - // - // Beautify parameters for summary and return as string - // - public static String paramsSummaryLog(workflow, params) { - Map colors = NfcoreTemplate.logColours(params.monochrome_logs) - String output = '' - def params_map = paramsSummaryMap(workflow, params) - def max_chars = paramsMaxChars(params_map) - for (group in params_map.keySet()) { - def group_params = params_map.get(group) // This gets the parameters of that particular group - if (group_params) { - output += colors.bold + group + colors.reset + '\n' - for (param in group_params.keySet()) { - output += " " + colors.blue + param.padRight(max_chars) + ": " + colors.green + group_params.get(param) + colors.reset + '\n' - } - output += '\n' - } - } - output += "!! Only displaying parameters that differ from the pipeline defaults !!\n" - output += NfcoreTemplate.dashedLine(params.monochrome_logs) - return output - } - - // - // Loop over nested exceptions and print the causingException - // - private static void printExceptions(ex_json, params_json, log, enums, limit=5) { - def causingExceptions = ex_json['causingExceptions'] - if (causingExceptions.length() == 0) { - def m = ex_json['message'] =~ /required key \[([^\]]+)\] not found/ - // Missing required param - if (m.matches()) { - log.error "* Missing required parameter: --${m[0][1]}" - } - // Other base-level error - else if (ex_json['pointerToViolation'] == '#') { - log.error "* ${ex_json['message']}" - } - // Error with specific param - else { - def param = ex_json['pointerToViolation'] - ~/^#\// - def param_val = params_json[param].toString() - if (enums.containsKey(param)) { - def error_msg = "* --${param}: '${param_val}' is not a valid choice (Available choices" - if (enums[param].size() > limit) { - log.error "${error_msg} (${limit} of ${enums[param].size()}): ${enums[param][0..limit-1].join(', ')}, ... )" - } else { - log.error "${error_msg}: ${enums[param].join(', ')})" - } - } else { - log.error "* --${param}: ${ex_json['message']} (${param_val})" - } - } - } - for (ex in causingExceptions) { - printExceptions(ex, params_json, log, enums) - } - } - - // - // Remove an element from a JSONArray - // - private static JSONArray removeElement(json_array, element) { - def list = [] - int len = json_array.length() - for (int i=0;i - if(raw_schema.keySet().contains('definitions')){ - raw_schema.definitions.each { definition -> - for (key in definition.keySet()){ - if (definition[key].get("properties").keySet().contains(ignore_param)){ - // Remove the param to ignore - definition[key].get("properties").remove(ignore_param) - // If the param was required, change this - if (definition[key].has("required")) { - def cleaned_required = removeElement(definition[key].required, ignore_param) - definition[key].put("required", cleaned_required) - } - } - } - } - } - if(raw_schema.keySet().contains('properties') && raw_schema.get('properties').keySet().contains(ignore_param)) { - raw_schema.get("properties").remove(ignore_param) - } - if(raw_schema.keySet().contains('required') && raw_schema.required.contains(ignore_param)) { - def cleaned_required = removeElement(raw_schema.required, ignore_param) - raw_schema.put("required", cleaned_required) - } - } - return raw_schema - } - - // - // Clean and check parameters relative to Nextflow native classes - // - private static Map cleanParameters(params) { - def new_params = params.getClass().newInstance(params) - for (p in params) { - // remove anything evaluating to false - if (!p['value']) { - new_params.remove(p.key) - } - // Cast MemoryUnit to String - if (p['value'].getClass() == nextflow.util.MemoryUnit) { - new_params.replace(p.key, p['value'].toString()) - } - // Cast Duration to String - if (p['value'].getClass() == nextflow.util.Duration) { - new_params.replace(p.key, p['value'].toString().replaceFirst(/d(?!\S)/, "day")) - } - // Cast LinkedHashMap to String - if (p['value'].getClass() == LinkedHashMap) { - new_params.replace(p.key, p['value'].toString()) - } - } - return new_params - } - - // - // This function tries to read a JSON params file - // - private static LinkedHashMap paramsLoad(String json_schema) { - def params_map = new LinkedHashMap() - try { - params_map = paramsRead(json_schema) - } catch (Exception e) { - println "Could not read parameters settings from JSON. $e" - params_map = new LinkedHashMap() - } - return params_map - } - - // - // Method to actually read in JSON file using Groovy. - // Group (as Key), values are all parameters - // - Parameter1 as Key, Description as Value - // - Parameter2 as Key, Description as Value - // .... - // Group - // - - private static LinkedHashMap paramsRead(String json_schema) throws Exception { - def json = new File(json_schema).text - def Map schema_definitions = (Map) new JsonSlurper().parseText(json).get('definitions') - def Map schema_properties = (Map) new JsonSlurper().parseText(json).get('properties') - /* Tree looks like this in nf-core schema - * definitions <- this is what the first get('definitions') gets us - group 1 - title - description - properties - parameter 1 - type - description - parameter 2 - type - description - group 2 - title - description - properties - parameter 1 - type - description - * properties <- parameters can also be ungrouped, outside of definitions - parameter 1 - type - description - */ - - // Grouped params - def params_map = new LinkedHashMap() - schema_definitions.each { key, val -> - def Map group = schema_definitions."$key".properties // Gets the property object of the group - def title = schema_definitions."$key".title - def sub_params = new LinkedHashMap() - group.each { innerkey, value -> - sub_params.put(innerkey, value) - } - params_map.put(title, sub_params) - } - - // Ungrouped params - def ungrouped_params = new LinkedHashMap() - schema_properties.each { innerkey, value -> - ungrouped_params.put(innerkey, value) - } - params_map.put("Other parameters", ungrouped_params) - - return params_map - } - - // - // Get maximum number of characters across all parameter names - // - private static Integer paramsMaxChars(params_map) { - Integer max_chars = 0 - for (group in params_map.keySet()) { - def group_params = params_map.get(group) // This gets the parameters of that particular group - for (param in group_params.keySet()) { - if (param.size() > max_chars) { - max_chars = param.size() - } - } - } - return max_chars - } -} diff --git a/lib/NfcoreTemplate.groovy b/lib/NfcoreTemplate.groovy index 25a0a74a..01b8653d 100755 --- a/lib/NfcoreTemplate.groovy +++ b/lib/NfcoreTemplate.groovy @@ -3,6 +3,7 @@ // import org.yaml.snakeyaml.Yaml +import groovy.json.JsonOutput class NfcoreTemplate { @@ -128,7 +129,7 @@ class NfcoreTemplate { def email_html = html_template.toString() // Render the sendmail template - def max_multiqc_email_size = params.max_multiqc_email_size as nextflow.util.MemoryUnit + def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "$projectDir", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] def sf = new File("$projectDir/assets/sendmail_template.txt") def sendmail_template = engine.createTemplate(sf).make(smail_fields) @@ -222,6 +223,21 @@ class NfcoreTemplate { } } + // + // Dump pipeline parameters in a json file + // + public static void dump_parameters(workflow, params) { + def output_d = new File("${params.outdir}/pipeline_info/") + if (!output_d.exists()) { + output_d.mkdirs() + } + + def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') + def output_pf = new File(output_d, "params_${timestamp}.json") + def jsonStr = JsonOutput.toJson(params) + output_pf.text = JsonOutput.prettyPrint(jsonStr) + } + // // Print pipeline summary on completion // diff --git a/lib/WorkflowMain.groovy b/lib/WorkflowMain.groovy index 8db3c4ec..6478740f 100755 --- a/lib/WorkflowMain.groovy +++ b/lib/WorkflowMain.groovy @@ -2,6 +2,8 @@ // This file holds several functions specific to the main.nf workflow in the nf-core/rnafusion pipeline // +import nextflow.Nextflow + class WorkflowMain { // @@ -17,40 +19,11 @@ class WorkflowMain { " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" } - // - // Generate help string - // - public static String help(workflow, params, log) { - def command = "nextflow run ${workflow.manifest.name} --input samplesheet.csv --genome GRCh38 -profile docker" - def help_string = '' - help_string += NfcoreTemplate.logo(workflow, params.monochrome_logs) - help_string += NfcoreSchema.paramsHelp(workflow, params, command) - help_string += '\n' + citation(workflow) + '\n' - help_string += NfcoreTemplate.dashedLine(params.monochrome_logs) - return help_string - } - - // - // Generate parameter summary log string - // - public static String paramsSummaryLog(workflow, params, log) { - def summary_log = '' - summary_log += NfcoreTemplate.logo(workflow, params.monochrome_logs) - summary_log += NfcoreSchema.paramsSummaryLog(workflow, params) - summary_log += '\n' + citation(workflow) + '\n' - summary_log += NfcoreTemplate.dashedLine(params.monochrome_logs) - return summary_log - } // // Validate parameters and print summary to screen // public static void initialise(workflow, params, log) { - // Print help to screen if required - if (params.help) { - log.info help(workflow, params, log) - System.exit(0) - } // Print workflow version and exit on --version if (params.version) { @@ -59,14 +32,6 @@ class WorkflowMain { System.exit(0) } - // Print parameter summary log to screen - log.info paramsSummaryLog(workflow, params, log) - - // Validate workflow parameters via the JSON schema - if (params.validate_params) { - NfcoreSchema.validateParameters(workflow, params, log) - } - // Check that a -profile or Nextflow config has been provided to run the pipeline NfcoreTemplate.checkConfigProvided(workflow, log) @@ -80,8 +45,7 @@ class WorkflowMain { // Check input has been provided if (!params.input) { - log.error "Please provide an input samplesheet to the pipeline e.g. '--input samplesheet.csv'" - System.exit(1) + Nextflow.error("Please provide an input samplesheet to the pipeline e.g. '--input samplesheet.csv'") } } // diff --git a/lib/WorkflowRnafusion.groovy b/lib/WorkflowRnafusion.groovy index f31abbf7..1e289fdc 100755 --- a/lib/WorkflowRnafusion.groovy +++ b/lib/WorkflowRnafusion.groovy @@ -2,6 +2,7 @@ // This file holds several functions specific to the workflow/rnafusion.nf in the nf-core/rnafusion pipeline // +import nextflow.Nextflow import groovy.text.SimpleTemplateEngine class WorkflowRnafusion { @@ -10,12 +11,12 @@ class WorkflowRnafusion { // Check and validate parameters // public static void initialise(params, log) { + genomeExistsError(params, log) if (!params.fasta) { - log.error "Genome fasta file not specified with e.g. '--fasta genome.fa' or via a detectable config file." - System.exit(1) + Nextflow.error "Genome fasta file not specified with e.g. '--fasta genome.fa' or via a detectable config file." } } @@ -46,32 +47,76 @@ class WorkflowRnafusion { return yaml_file_text } - public static String methodsDescriptionText(run_workflow, mqc_methods_yaml) { + // + // Generate methods description for MultiQC + // + + public static String toolCitationText(params) { + + // TODO nf-core: Optionally add in-text citation tools to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "Tool (Foo et al. 2023)" : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def citation_text = [ + "Tools used in the workflow included:", + "FastQC (Andrews 2010),", + "MultiQC (Ewels et al. 2016)", + "." + ].join(' ').trim() + + return citation_text + } + + public static String toolBibliographyText(params) { + + // TODO Optionally add bibliographic entries to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "
  • Author (2023) Pub name, Journal, DOI
    • " : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def reference_text = [ + "
  • Andrews S, (2010) FastQC, URL: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
    • ", + "
  • Ewels, P., Magnusson, M., Lundin, S., & Käller, M. (2016). MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics , 32(19), 3047–3048. doi: /10.1093/bioinformatics/btw354
    • " + ].join(' ').trim() + + return reference_text + } + + public static String methodsDescriptionText(run_workflow, mqc_methods_yaml, params) { // Convert to a named map so can be used as with familar NXF ${workflow} variable syntax in the MultiQC YML file def meta = [:] meta.workflow = run_workflow.toMap() meta["manifest_map"] = run_workflow.manifest.toMap() + // Pipeline DOI meta["doi_text"] = meta.manifest_map.doi ? "(doi: ${meta.manifest_map.doi})" : "" meta["nodoi_text"] = meta.manifest_map.doi ? "": "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
    • " + // Tool references + meta["tool_citations"] = "" + meta["tool_bibliography"] = "" + + // TODO Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled! + //meta["tool_citations"] = toolCitationText(params).replaceAll(", \\.", ".").replaceAll("\\. \\.", ".").replaceAll(", \\.", ".") + //meta["tool_bibliography"] = toolBibliographyText(params) + + def methods_text = mqc_methods_yaml.text def engine = new SimpleTemplateEngine() def description_html = engine.createTemplate(methods_text).make(meta) return description_html - }// + } + + // // Exit pipeline if incorrect --genome key provided // private static void genomeExistsError(params, log) { if (params.genomes && params.genome && !params.genomes.containsKey(params.genome)) { - log.error "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + + def error_string = "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + " Genome '${params.genome}' not found in any config files provided to the pipeline.\n" + " Currently, the available genome keys are:\n" + " ${params.genomes.keySet().join(", ")}\n" + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" - System.exit(1) + Nextflow.error(error_string) } } } diff --git a/main.nf b/main.nf index 54dddc53..520bcff7 100644 --- a/main.nf +++ b/main.nf @@ -4,7 +4,6 @@ nf-core/rnafusion ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Github : https://github.com/nf-core/rnafusion - Website: https://nf-co.re/rnafusion Slack : https://nfcore.slack.com/channels/rnafusion ---------------------------------------------------------------------------------------- @@ -24,7 +23,7 @@ params.gtf = WorkflowMain.getGenomeAttribute(params, 'gtf') params.chrgtf = WorkflowMain.getGenomeAttribute(params, 'chrgtf') params.transcript = WorkflowMain.getGenomeAttribute(params, 'transcript') params.refflat = WorkflowMain.getGenomeAttribute(params, 'refflat') -params.rrna_intervals = WorkflowMain.getGenomeAttribute(params, 'rrna_intervals') +params.rrna_intervals = WorkflowMain.getGenomeAttribute(params, 'rrna_intervals') /* ======================================================================================== @@ -32,13 +31,28 @@ params.rrna_intervals = WorkflowMain.getGenomeAttribute(params, 'rrna_interval ======================================================================================== */ - /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ VALIDATE & PRINT PARAMETER SUMMARY ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ +include { validateParameters; paramsHelp } from 'plugin/nf-validation' + +// Print help message if needed +if (params.help) { + def logo = NfcoreTemplate.logo(workflow, params.monochrome_logs) + def citation = '\n' + WorkflowMain.citation(workflow) + '\n' + def String command = "nextflow run ${workflow.manifest.name} --input samplesheet.csv --genome GRCh37 -profile docker" + log.info logo + paramsHelp(command) + citation + NfcoreTemplate.dashedLine(params.monochrome_logs) + System.exit(0) +} + +// Validate input parameters +if (params.validate_params) { + validateParameters() +} + WorkflowMain.initialise(workflow, params, log) /* diff --git a/modules.json b/modules.json index cfa3ec10..345e65b8 100644 --- a/modules.json +++ b/modules.json @@ -5,109 +5,109 @@ "https://github.com/nf-core/modules.git": { "modules": { "nf-core": { + "agat/convertspgff2tsv": { + "branch": "master", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", + "installed_by": ["modules"] + }, "arriba": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "ea9e2892a9d12e8769402f12096219942bcf6536", "installed_by": ["modules"] }, "cat/cat": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "cat/fastq": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "custom/dumpsoftwareversions": { "branch": "master", - "git_sha": "b6d4d476aee074311c89d82a69c1921bd70c8180", + "git_sha": "bba7e362e4afead70653f84d8700588ea28d0f9e", "installed_by": ["modules"] }, "fastp": { "branch": "master", - "git_sha": "20a508676f40d0fd3f911ac595af91ec845704c4", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "fastqc": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "gatk4/bedtointervallist": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "gatk4/createsequencedictionary": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, - "kallisto/index": { + "gatk4/markduplicates": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "multiqc": { "branch": "master", - "git_sha": "ee80d14721e76e2e079103b8dcd5d57129e584ba", - "installed_by": ["modules"] - }, - "picard/collectwgsmetrics": { - "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "1537442a7be4a78efa3d1ff700a923c627bbda5d", "installed_by": ["modules"] }, - "picard/markduplicates": { + "picard/collectinsertsizemetrics": { "branch": "master", - "git_sha": "2f88b26e9804b99e98f7cd08e74c3f88288a3358", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, - "qualimap/rnaseq": { + "picard/collectwgsmetrics": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "samtools/faidx": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "samtools/index": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "5394565c5fe4c760e5b35977ec7607c62e81d1f8", "installed_by": ["modules"] }, "samtools/sort": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "samtools/view": { "branch": "master", - "git_sha": "0f8a77ff00e65eaeebc509b8156eaa983192474b", + "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", "installed_by": ["modules"] }, "star/align": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "9f6b233518f7d9ecdcf24b798b7e491db5424273", "installed_by": ["modules"] }, "star/genomegenerate": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "0e98289b5bec6e3f8f588a8a9d05e8aacc1179a0", "installed_by": ["modules"] }, "stringtie/merge": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "b0dcb44b018d9b2bcb35b1abb7bcd34061bc5a6d", "installed_by": ["modules"] }, "stringtie/stringtie": { "branch": "master", - "git_sha": "c8e35eb2055c099720a75538d1b8adb3fb5a464c", + "git_sha": "b0dcb44b018d9b2bcb35b1abb7bcd34061bc5a6d", "installed_by": ["modules"] } } diff --git a/modules/local/arriba/download/main.nf b/modules/local/arriba/download/main.nf index 166ed69f..860439ad 100644 --- a/modules/local/arriba/download/main.nf +++ b/modules/local/arriba/download/main.nf @@ -13,11 +13,11 @@ process ARRIBA_DOWNLOAD { script: """ - wget https://github.com/suhrig/arriba/releases/download/v2.3.0/arriba_v2.3.0.tar.gz -O arriba_v2.3.0.tar.gz - tar -xzvf arriba_v2.3.0.tar.gz - rm arriba_v2.3.0.tar.gz - mv arriba_v2.3.0/database/* . - rm -r arriba_v2.3.0 + wget https://github.com/suhrig/arriba/releases/download/v2.4.0/arriba_v2.4.0.tar.gz -O arriba_v2.4.0.tar.gz + tar -xzvf arriba_v2.4.0.tar.gz + rm arriba_v2.4.0.tar.gz + mv arriba_v2.4.0/database/* . + rm -r arriba_v2.4.0 cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -27,11 +27,11 @@ process ARRIBA_DOWNLOAD { stub: """ - touch blacklist_hg38_GRCh38_v2.3.0.tsv.gz - touch protein_domains_hg38_GRCh38_v2.3.0.gff3 - touch cytobands_hg38_GRCh38_v2.3.0.tsv - touch known_fusions_hg38_GRCh38_v2.3.0.tsv.gz - touch protein_domains_hg38_GRCh38_v2.3.0.gff3 + touch blacklist_hg38_GRCh38_v2.4.0.tsv.gz + touch protein_domains_hg38_GRCh38_v2.4.0.gff3 + touch cytobands_hg38_GRCh38_v2.4.0.tsv + touch known_fusions_hg38_GRCh38_v2.4.0.tsv.gz + touch protein_domains_hg38_GRCh38_v2.4.0.gff3 cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/local/arriba/visualisation/main.nf b/modules/local/arriba/visualisation/main.nf index b55666ca..cc120119 100644 --- a/modules/local/arriba/visualisation/main.nf +++ b/modules/local/arriba/visualisation/main.nf @@ -2,16 +2,16 @@ process ARRIBA_VISUALISATION { tag "$meta.id" label 'process_medium' - conda "bioconda::arriba=2.3.0" + conda "bioconda::arriba=2.4.0" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/arriba:2.3.0--haa8aa89_0' : - 'quay.io/biocontainers/arriba:2.3.0--haa8aa89_0' }" + 'https://depot.galaxyproject.org/singularity/arriba:2.4.0--h0033a41_2' : + 'biocontainers/arriba:2.4.0--h0033a41_2' }" input: tuple val(meta), path(bam), path(bai), path(fusions) - path gtf - path protein_domains - path cytobands + tuple val(meta2), path(gtf) + tuple val(meta3), path(protein_domains) + tuple val(meta4), path(cytobands) output: tuple val(meta), path("*.pdf") , emit: pdf diff --git a/modules/local/convert2bed/meta.yml b/modules/local/convert2bed/meta.yml index e578330b..31ff3649 100644 --- a/modules/local/convert2bed/meta.yml +++ b/modules/local/convert2bed/meta.yml @@ -4,7 +4,7 @@ description: convert from GTF to BED format tools: - convert2bed: description: convert from GTF to BED format - homepage: https://pachterlab.github.io/kallisto/ + homepage: https://github.com/bedops/bedops documentation: https://bedops.readthedocs.io/en/latest/index.html tool_dev_url: https://github.com/bedops/bedops doi: "" diff --git a/modules/local/ensembl/main.nf b/modules/local/ensembl/main.nf index d6d71e6d..4a782c0d 100644 --- a/modules/local/ensembl/main.nf +++ b/modules/local/ensembl/main.nf @@ -9,13 +9,16 @@ process ENSEMBL_DOWNLOAD { input: val ensembl_version + val genome + val meta output: - path "versions.yml" , emit: versions - path "Homo_sapiens.${params.genome}.${ensembl_version}.all.fa" , emit: fasta - path "Homo_sapiens.${params.genome}.${ensembl_version}.gtf" , emit: gtf - path "Homo_sapiens.${params.genome}.${ensembl_version}.chr.gtf" , emit: chrgtf - path "Homo_sapiens.${params.genome}.${ensembl_version}.cdna.all.fa.gz", emit: transcript + tuple val(meta), path("Homo_sapiens.${genome}.${ensembl_version}.all.fa") , emit: fasta + tuple val(meta), path("Homo_sapiens.${genome}.${ensembl_version}.gtf") , emit: gtf + tuple val(meta), path("Homo_sapiens.${genome}.${ensembl_version}.chr.gtf") , emit: chrgtf + tuple val(meta), path("Homo_sapiens.${genome}.${ensembl_version}.cdna.all.fa.gz"), emit: transcript + path "versions.yml" , emit: versions + script: """ @@ -40,10 +43,10 @@ process ENSEMBL_DOWNLOAD { stub: """ - touch "Homo_sapiens.${params.genome}.${ensembl_version}.all.fa" - touch "Homo_sapiens.${params.genome}.${ensembl_version}.gtf" - touch "Homo_sapiens.${params.genome}.${ensembl_version}.chr.gtf" - touch "Homo_sapiens.${params.genome}.${ensembl_version}.cdna.all.fa.gz" + touch "Homo_sapiens.${genome}.${ensembl_version}.all.fa" + touch "Homo_sapiens.${genome}.${ensembl_version}.gtf" + touch "Homo_sapiens.${genome}.${ensembl_version}.chr.gtf" + touch "Homo_sapiens.${genome}.${ensembl_version}.cdna.all.fa.gz" cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/local/fusioncatcher/detect/main.nf b/modules/local/fusioncatcher/detect/main.nf index fa072bf4..2977d668 100644 --- a/modules/local/fusioncatcher/detect/main.nf +++ b/modules/local/fusioncatcher/detect/main.nf @@ -39,7 +39,7 @@ process FUSIONCATCHER { cat <<-END_VERSIONS > versions.yml "${task.process}": - fusioncatcher: \$(echo \$(fusioncatcher --version 2>&1)| sed 's/fusioncatcher.py //') + fusioncatcher: \$(echo \$(fusioncatcher.py --version 2>&1)| sed 's/fusioncatcher.py //') END_VERSIONS """ @@ -52,7 +52,7 @@ process FUSIONCATCHER { touch ${prefix}.fusioncatcher.log cat <<-END_VERSIONS > versions.yml "${task.process}": - fusioncatcher: \$(echo \$(fusioncatcher --version 2>&1)| sed 's/fusioncatcher.py //') + fusioncatcher: \$(echo \$(fusioncatcher.py --version 2>&1)| sed 's/fusioncatcher.py //') END_VERSIONS """ } diff --git a/modules/local/fusioninspector/main.nf b/modules/local/fusioninspector/main.nf index 6f59a590..c7fcd3f0 100644 --- a/modules/local/fusioninspector/main.nf +++ b/modules/local/fusioninspector/main.nf @@ -10,9 +10,11 @@ process FUSIONINSPECTOR { path reference output: - tuple val(meta), path("*FusionInspector.fusions.tsv") , emit: tsv - path "*" , emit: output - path "versions.yml" , emit: versions + tuple val(meta), path("*FusionInspector.fusions.tsv") , emit: tsv + tuple val(meta), path("*.coding_effect") , optional:true, emit: tsv_coding_effect + tuple val(meta), path("*.gtf") , optional:true, emit: out_gtf + path "*" , emit: output + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -21,6 +23,7 @@ process FUSIONINSPECTOR { def prefix = task.ext.prefix ?: "${meta.id}" def fasta = meta.single_end ? "--left_fq ${reads[0]}" : "--left_fq ${reads[0]} --right_fq ${reads[1]}" def args = task.ext.args ?: '' + def args2 = task.ext.args2 ?: '' """ FusionInspector \\ --fusions $fusion_list \\ @@ -29,7 +32,7 @@ process FUSIONINSPECTOR { --CPU ${task.cpus} \\ -O . \\ --out_prefix $prefix \\ - --vis $args + --vis $args $args2 cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -38,9 +41,12 @@ process FUSIONINSPECTOR { """ stub: + def prefix = task.ext.prefix ?: "${meta.id}" """ - touch FusionInspector.log - touch FusionInspector.fusions.tsv + touch ${prefix}.FusionInspector.log + touch ${prefix}.FusionInspector.fusions.tsv + touch ${prefix}.FusionInspector.fusions.tsv.annotated.coding_effect + touch ${prefix}.gtf cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/local/fusionreport/detect/main.nf b/modules/local/fusionreport/detect/main.nf index 8c35be4a..8024d8f8 100644 --- a/modules/local/fusionreport/detect/main.nf +++ b/modules/local/fusionreport/detect/main.nf @@ -2,21 +2,21 @@ process FUSIONREPORT { tag "$meta.id" label 'process_medium' - // Note: 2.7X indices incompatible with AWS iGenomes. conda "bioconda::star=2.7.9a" - container "docker.io/clinicalgenomics/fusion-report:2.1.5p2.1" + container "docker.io/clinicalgenomics/fusion-report:2.1.8" input: - tuple val(meta), path(reads), path(arriba_fusions), path(pizzly_fusions), path(squid_fusions), path(starfusion_fusions), path(fusioncatcher_fusions) - path(fusionreport_ref) + tuple val(meta), path(reads), path(arriba_fusions), path(starfusion_fusions), path(fusioncatcher_fusions) + tuple val(meta2), path(fusionreport_ref) + val(tools_cutoff) output: path "versions.yml" , emit: versions tuple val(meta), path("*fusionreport.tsv") , emit: fusion_list tuple val(meta), path("*fusionreport_filtered.tsv") , emit: fusion_list_filtered - tuple val(meta), path("index.html") , emit: report - tuple val(meta), path("*_*.html") , emit: html + tuple val(meta), path("*index.html") , emit: report + tuple val(meta), path("*_*.html") , optional:true, emit: html tuple val(meta), path("*.csv") , optional:true, emit: csv tuple val(meta), path("*.json") , optional:true, emit: json @@ -27,16 +27,15 @@ process FUSIONREPORT { def args = task.ext.args ?: '' def args2 = task.ext.args2 ?: '' def tools = params.arriba || params.all ? "--arriba ${arriba_fusions} " : '' - tools += params.pizzly || params.all ? "--pizzly ${pizzly_fusions} " : '' - tools += params.squid || params.all ? "--squid ${squid_fusions} " : '' tools += params.starfusion || params.all ? "--starfusion ${starfusion_fusions} " : '' tools += params.fusioncatcher || params.all ? "--fusioncatcher ${fusioncatcher_fusions} " : '' def prefix = task.ext.prefix ?: "${meta.id}" """ - fusion_report run $meta.id . $fusionreport_ref $tools --allow-multiple-gene-symbols $args $args2 + fusion_report run $meta.id . $fusionreport_ref $tools --allow-multiple-gene-symbols --tool-cutoff $tools_cutoff $args $args2 mv fusion_list.tsv ${prefix}.fusionreport.tsv mv fusion_list_filtered.tsv ${prefix}.fusionreport_filtered.tsv + mv index.html ${prefix}_fusionreport_index.html [ ! -f fusions.csv ] || mv fusions.csv ${prefix}.fusions.csv [ ! -f fusions.json ] || mv fusions.json ${prefix}.fusions.json @@ -52,7 +51,7 @@ process FUSIONREPORT { """ touch ${prefix}.fusionreport_filtered.tsv touch ${prefix}.fusionreport.tsv - touch index.html + touch ${prefix}_fusionreport_index.html touch AAA_BBB.html touch ${prefix}.fusions.csv touch ${prefix}.fusions.json diff --git a/modules/local/fusionreport/detect/meta.yml b/modules/local/fusionreport/detect/meta.yml index f3d5cd88..ae3601dc 100644 --- a/modules/local/fusionreport/detect/meta.yml +++ b/modules/local/fusionreport/detect/meta.yml @@ -4,8 +4,8 @@ keywords: - sort tools: - fusionreport: - description: fusionreport - homepage: https://github.com/matq007/fusion-report + description: Tool for parsing outputs from fusion detection tools + homepage: https://github.com/Clinical-Genomics/fusion-report documentation: https://matq007.github.io/fusion-report/#/ doi: "10.1101/011650" licence: ["GPL v3"] @@ -24,14 +24,6 @@ input: type: path description: File pattern: "*.fusions.tsv" - - pizzly_fusions: - type: path - description: File containing fusions from pizzly - pattern: "*.pizzly.txt" - - squid_fusions: - type: path - description: File containing fusions from squid - pattern: "*.annotated.txt" - starfusion_fusions: type: path description: File containing fusions from STARfusion diff --git a/modules/local/fusionreport/download/main.nf b/modules/local/fusionreport/download/main.nf index 5dca9b2a..ac288ade 100644 --- a/modules/local/fusionreport/download/main.nf +++ b/modules/local/fusionreport/download/main.nf @@ -2,9 +2,8 @@ process FUSIONREPORT_DOWNLOAD { tag 'fusionreport' label 'process_medium' - // Note: 2.7X indices incompatible with AWS iGenomes. conda "bioconda::star=2.7.9a" - container "docker.io/clinicalgenomics/fusion-report:2.1.5p2.1" + container "docker.io/clinicalgenomics/fusion-report:2.1.8" input: val(username) diff --git a/modules/local/hgnc/main.nf b/modules/local/hgnc/main.nf new file mode 100644 index 00000000..1b3808f6 --- /dev/null +++ b/modules/local/hgnc/main.nf @@ -0,0 +1,41 @@ +process HGNC_DOWNLOAD { + tag "hgnc" + label 'process_low' + + conda "bioconda::gnu-wget=1.18" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/gnu-wget:1.18--h5bf99c6_5' : + 'quay.io/biocontainers/gnu-wget:1.18--h5bf99c6_5' }" + + input: + + output: + path "hgnc_complete_set.txt" , emit: hgnc_ref + path "HGNC-DB-timestamp.txt" , emit: hgnc_date + + path "versions.yml" , emit: versions + + + script: + """ + wget https://ftp.ebi.ac.uk/pub/databases/genenames/hgnc/tsv/hgnc_complete_set.txt + date +%Y-%m-%d/%H:%M > HGNC-DB-timestamp.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + wget: \$(echo wget -V 2>&1 | grep "GNU Wget" | cut -d" " -f3 > versions.yml) + END_VERSIONS + """ + + stub: + """ + touch "hgnc_complete_set.txt" + touch "HGNC-DB-timestamp.txt" + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + wget: \$(echo wget -V 2>&1 | grep "GNU Wget" | cut -d" " -f3 > versions.yml) + END_VERSIONS + """ + +} diff --git a/modules/local/kallisto/quant/main.nf b/modules/local/kallisto/quant/main.nf deleted file mode 100644 index 7d3e5dfb..00000000 --- a/modules/local/kallisto/quant/main.nf +++ /dev/null @@ -1,47 +0,0 @@ -process KALLISTO_QUANT { - tag "$meta.id" - label 'process_medium' - - conda "bioconda::kallisto=0.46.2" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/kallisto:0.46.2--h4f7b962_1' : - 'quay.io/biocontainers/kallisto:0.46.2--h4f7b962_1' }" - - - input: - tuple val(meta), path(reads) - path index - - output: - path "versions.yml" , emit: versions - tuple val(meta), path("*fusions.txt") , emit: txt - - script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - """ - kallisto quant \ - -t $task.cpus \ - -i $index \ - --fusion \ - -o . \ - $reads - mv fusion.txt ${prefix}.kallisto_quant.fusions.txt - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - kallisto: \$(echo \$(kallisto 2>&1) | sed 's/^kallisto //; s/Usage.*\$//') - END_VERSIONS - """ - - stub: - def prefix = task.ext.prefix ?: "${meta.id}" - """ - touch ${prefix}.kallisto_quant.fusions.txt - cat <<-END_VERSIONS > versions.yml - "${task.process}": - kallisto: \$(echo \$(kallisto 2>&1) | sed 's/^kallisto //; s/Usage.*\$//') - END_VERSIONS - """ -} - diff --git a/modules/local/kallisto/quant/meta.yml b/modules/local/kallisto/quant/meta.yml deleted file mode 100644 index 31821aa6..00000000 --- a/modules/local/kallisto/quant/meta.yml +++ /dev/null @@ -1,44 +0,0 @@ -name: kallisto_quant -description: runs the kallisto quantification algorithm - - quant -tools: - - kallisto: - description: Quantifying abundances of transcripts from bulk and single-cell RNA-Seq data, or more generally of target sequences using high-throughput sequencing reads. - homepage: https://pachterlab.github.io/kallisto/ - documentation: https://pachterlab.github.io/kallisto/manual - tool_dev_url: https://github.com/pachterlab/kallisto - doi: "" - licence: ["BSD-2-Clause"] - -input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: FASTQ file - pattern: "*.{fastq}" - - reference: - type: directory - description: Path to kallisto index - pattern: "*" - -output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - fusions: - type: file - description: fusions - pattern: "*.txt" - -authors: - - "@rannick" diff --git a/modules/local/picard/collectrnaseqmetrics/main.nf b/modules/local/picard/collectrnaseqmetrics/main.nf index f1b2fff5..af0b8958 100644 --- a/modules/local/picard/collectrnaseqmetrics/main.nf +++ b/modules/local/picard/collectrnaseqmetrics/main.nf @@ -2,15 +2,15 @@ process PICARD_COLLECTRNASEQMETRICS { tag "$meta.id" label 'process_medium' - conda "bioconda::picard=2.27.4" + conda "bioconda::picard=3.0.0 r::r-base" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/picard:2.27.4--hdfd78af_0' : - 'quay.io/biocontainers/picard:2.27.4--hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/picard:3.0.0--hdfd78af_1' : + 'biocontainers/picard:3.0.0--hdfd78af_1' }" input: tuple val(meta), path(bam), path(bai) - path(refflat) - path(rrna_intervals) + tuple val(meta2), path(refflat) + tuple val(meta3), path(rrna_intervals) output: tuple val(meta), path("*rna_metrics.txt") , emit: metrics diff --git a/modules/local/pizzly/detect/main.nf b/modules/local/pizzly/detect/main.nf deleted file mode 100644 index 9f10caf8..00000000 --- a/modules/local/pizzly/detect/main.nf +++ /dev/null @@ -1,49 +0,0 @@ -process PIZZLY { - tag "$meta.id" - label 'process_medium' - - conda "bioconda::kallisto=0.46.2 bioconda::pizzly==0.37.3" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/pizzly:0.37.3--py36_2' : - 'quay.io/biocontainers/pizzly:0.37.3--h470a237_3' }" - - input: - tuple val(meta), path(txt) - path transcript - path gtf - - output: - path "versions.yml" , emit: versions - tuple val(meta), path("*pizzly.txt") , emit: fusions - tuple val(meta), path("*unfiltered.json") , emit: fusions_unfiltered - - script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - """ - pizzly \\ - $args \\ - --gtf $gtf \\ - --fasta $transcript \\ - --output ${prefix}.pizzly $txt - - pizzly_flatten_json.py ${prefix}.pizzly.json ${prefix}.pizzly.txt - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - pizzly: \$(pizzly --version | grep pizzly | sed -e "s/pizzly version: //g") - END_VERSIONS - """ - - stub: - def prefix = task.ext.prefix ?: "${meta.id}" - """ - touch ${prefix}.pizzly.txt - touch ${prefix}.pizzly.unfiltered.json - cat <<-END_VERSIONS > versions.yml - "${task.process}": - pizzly: \$(pizzly --version | grep pizzly | sed -e "s/pizzly version: //g") - END_VERSIONS - """ -} - diff --git a/modules/local/pizzly/detect/meta.yml b/modules/local/pizzly/detect/meta.yml deleted file mode 100644 index 930b3a62..00000000 --- a/modules/local/pizzly/detect/meta.yml +++ /dev/null @@ -1,44 +0,0 @@ -name: pizzly -description: Pizzly detection of fusions. -keywords: - - fusion - - pizzly -tools: - - pizzly: - description: Fast fusion detection using kallisto - homepage: https://github.com/pmelsted/pizzly - documentation: https://github.com/pmelsted/pizzly - tool_dev_url: https://github.com/pmelsted/pizzly - doi: "" - licence: ["BSD-2-Clause"] - -input: - - fasta: - type: file - description: genome fasta file - pattern: "*.{fasta*}" - - reference: - type: directory - description: Path to kallisto index - pattern: "*" - - gtf: - type: file - description: gtf reference - pattern: "*.gtf" - -output: - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - fusions: - type: file - description: fusions - pattern: "*pizzly.txt" - - unfiltered: - type: file - description: unfiltered fusions - pattern: "*unfiltered.json" - -authors: - - "@rannick" diff --git a/modules/local/pizzly/download/main.nf b/modules/local/pizzly/download/main.nf deleted file mode 100644 index 571cd4dc..00000000 --- a/modules/local/pizzly/download/main.nf +++ /dev/null @@ -1,40 +0,0 @@ -process PIZZLY_DOWNLOAD { - tag "pizzly" - label 'process_medium' - - conda "bioconda::kallisto=0.46.2" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/kallisto:0.46.2--h4f7b962_1' : - 'quay.io/biocontainers/kallisto:0.46.2--h4f7b962_1' }" - - input: - path transcript - - output: - path "versions.yml" , emit: versions - path "index.idx" , emit: reference - - script: - def args = task.ext.args ?: '' - """ - kallisto index \\ - -i index.idx \\ - $args \\ - $transcript - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - kallisto: \$(echo \$(kallisto 2>&1) | sed 's/^kallisto //; s/Usage.*\$//') - END_VERSIONS """ - - stub: - """ - touch index.idx - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - kallisto: \$(echo \$(kallisto 2>&1) | sed 's/^kallisto //; s/Usage.*\$//') - END_VERSIONS - """ - -} diff --git a/modules/local/reformat/main.nf b/modules/local/reformat/main.nf deleted file mode 100644 index 969b0e34..00000000 --- a/modules/local/reformat/main.nf +++ /dev/null @@ -1,53 +0,0 @@ -process REFORMAT { - tag "$meta.id" - label 'process_medium' - - conda "bioconda::bbmap=38.90" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/bbmap:38.90--he522d1c_1' : - 'quay.io/biocontainers/bbmap:38.90--he522d1c_1' }" - - - input: - tuple val(meta), path(reads) - - output: - path "versions.yml" , emit: versions - tuple val(meta), path("*trimmed.fq.gz") , emit: reads_out - - - when: - task.ext.when == null || task.ext.when - - script: - def args = task.ext.args ?: '' - def args2 = task.ext.args2 ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - def in1 = "in=${reads[0]}" - def in2 = meta.single_end ? "" : "in=${reads[1]}" - def out1 ="out=${prefix}_R1_trimmed.fq.gz" - def out2 =meta.single_end ? "" : "out=${prefix}_R2_trimmed.fq.gz" - - """ - reformat.sh $in1 $out1 $args - reformat.sh $in2 $out2 $args2 - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - reformat.sh: \$(echo \$(reformat.sh --version 2>&1)| sed -e "s/BBMap version //g" ) - END_VERSIONS - """ - - stub: - def prefix = task.ext.prefix ?: "${meta.id}" - def out1 ="out=${prefix}_R1_trimmed.fq.gz" - def out2 =meta.single_end ? "" : "out=${prefix}_R2_trimmed.fq.gz" - """ - touch $out1 - touch $out2 - cat <<-END_VERSIONS > versions.yml - "${task.process}": - reformat.sh: \$(echo \$(reformat.sh --version 2>&1)| sed -e "s/BBMap version //g" ) - END_VERSIONS - """ -} diff --git a/modules/local/reformat/meta.yml b/modules/local/reformat/meta.yml deleted file mode 100644 index 86e0970a..00000000 --- a/modules/local/reformat/meta.yml +++ /dev/null @@ -1,40 +0,0 @@ -name: fusionreport -description: fusionreport -keywords: - - sort -tools: - - fusionreport: - description: fusionreport - homepage: https://github.com/matq007/fusion-report - documentation: https://matq007.github.io/fusion-report/#/ - doi: "10.1101/011650" - licence: ["GPL v3"] - -input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: FASTQ file - pattern: "*.{fastq}*" - -output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - reads: - type: file - description: FASTQ file - pattern: "*.{fq.gz}" - -authors: - - "@praveenraj2018, @rannick" diff --git a/modules/local/samplesheet_check.nf b/modules/local/samplesheet_check.nf index a17dc6dc..9473ea1b 100644 --- a/modules/local/samplesheet_check.nf +++ b/modules/local/samplesheet_check.nf @@ -5,8 +5,9 @@ process SAMPLESHEET_CHECK { conda "conda-forge::python=3.8.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/python:3.9--1' : - 'quay.io/biocontainers/python:3.9--1' }" + 'https://depot.galaxyproject.org/singularity/python:3.8.3' : + 'biocontainers/python:3.8.3' }" + input: path samplesheet diff --git a/modules/local/squid/annotate/main.nf b/modules/local/squid/annotate/main.nf deleted file mode 100644 index 19975b00..00000000 --- a/modules/local/squid/annotate/main.nf +++ /dev/null @@ -1,41 +0,0 @@ - -process SQUID_ANNOTATE { - tag "$meta.id" - label 'process_medium' - - conda "bioconda::squid=1.5" - container "docker.io/nfcore/rnafusion:squid_1.5-star2.7.1a" - - - - input: - tuple val(meta), path(txt) - path gtf - - output: - tuple val(meta), path("*annotated.txt") , emit: fusions_annotated - path "versions.yml" , emit: versions - - - script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - """ - AnnotateSQUIDOutput.py $gtf $txt ${prefix}.squid.fusions.annotated.txt - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - squid: \$(echo \$(squid --version 2>&1) | sed 's/v//') - END_VERSIONS - """ - - stub: - def prefix = task.ext.prefix ?: "${meta.id}" - """ - touch ${prefix}.squid.fusions.annotated.txt - cat <<-END_VERSIONS > versions.yml - "${task.process}": - squid: \$(echo \$(squid --version 2>&1) | sed 's/v//') - END_VERSIONS - """ -} diff --git a/modules/local/squid/annotate/meta.yml b/modules/local/squid/annotate/meta.yml deleted file mode 100644 index e1a1f0d2..00000000 --- a/modules/local/squid/annotate/meta.yml +++ /dev/null @@ -1,36 +0,0 @@ -name: squid -description: Squid detection of fusions. -keywords: - - fusion - - pizzly -tools: - - pizzly: - description: Fusion detection using squid - homepage: https://github.com/Kingsford-Group/squid - documentation: https://github.com/Kingsford-Group/squid - tool_dev_url: https://github.com/Kingsford-Group/squid - doi: "" - licence: ["BSD-3-Clause"] - -input: - - fusions: - type: directory - description: Path to squid fusions - pattern: "*.txt" - - gtf: - type: file - description: gtf reference - pattern: "*.gtf" - -output: - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - fusions_annotated: - type: file - description: squid fusions annotated - pattern: "*squid.fusions.annotated.txt" - -authors: - - "@rannick" diff --git a/modules/local/squid/detect/main.nf b/modules/local/squid/detect/main.nf deleted file mode 100644 index 3ccb6e3e..00000000 --- a/modules/local/squid/detect/main.nf +++ /dev/null @@ -1,40 +0,0 @@ - -process SQUID { - tag "squid" - label 'process_medium' - - conda "bioconda::squid=1.5" - container "docker.io/nfcore/rnafusion:squid_1.5-star2.7.1a" - - - - input: - tuple val(meta), path(bam), path(chimeric_bam) - - output: - tuple val(meta), path("*sv.txt") , emit: fusions - path "versions.yml" , emit: versions - - - script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - """ - squid -b $bam -c $chimeric_bam -o ${prefix}.squid.fusions - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - squid: \$(echo \$(squid --version 2>&1) | sed 's/v//') - END_VERSIONS - """ - - stub: - def prefix = task.ext.prefix ?: "${meta.id}" - """ - touch ${prefix}.squid.fusions_sv.txt - cat <<-END_VERSIONS > versions.yml - "${task.process}": - squid: \$(echo \$(squid --version 2>&1) | sed 's/v//') - END_VERSIONS - """ -} diff --git a/modules/local/squid/detect/meta.yml b/modules/local/squid/detect/meta.yml deleted file mode 100644 index a7f1e61a..00000000 --- a/modules/local/squid/detect/meta.yml +++ /dev/null @@ -1,41 +0,0 @@ -name: squid -description: Squid detection of fusions. -keywords: - - fusion - - pizzly -tools: - - pizzly: - description: Fusion detection using squid - homepage: https://github.com/Kingsford-Group/squid - documentation: https://github.com/Kingsford-Group/squid - tool_dev_url: https://github.com/Kingsford-Group/squid - doi: "" - licence: ["BSD-3-Clause"] - -input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - bam: - type: file - description: BAM/CRAM/SAM file - pattern: "*.{bam,cram,sam}" - - chimeric_bam: - type: file - description: BAM/CRAM/SAM file containing only chimeric sorted reads - pattern: "*.{bam,cram,sam}" - -output: - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - fusions: - type: directory - description: Path to squid fusions - pattern: "*.txt" - -authors: - - "@rannick" diff --git a/modules/local/starfusion/build/main.nf b/modules/local/starfusion/build/main.nf index da5b0c3b..e2bd7879 100644 --- a/modules/local/starfusion/build/main.nf +++ b/modules/local/starfusion/build/main.nf @@ -5,8 +5,8 @@ process STARFUSION_BUILD { container "docker.io/trinityctat/starfusion:1.12.0" input: - path fasta - path gtf + tuple val(meta), path(fasta) + tuple val(meta2), path(gtf) output: path "*" , emit: reference diff --git a/modules/local/uscs/custom_gtftogenepred/main.nf b/modules/local/uscs/custom_gtftogenepred/main.nf index 46052b5a..78fcbd29 100644 --- a/modules/local/uscs/custom_gtftogenepred/main.nf +++ b/modules/local/uscs/custom_gtftogenepred/main.nf @@ -7,7 +7,7 @@ process GTF_TO_REFFLAT { 'quay.io/biocontainers/ucsc-gtftogenepred:377--ha8a8165_5' }" input: - path gtf + tuple val(meta), path (gtf) output: path('*.refflat'), emit: refflat diff --git a/modules/local/megafusion/main.nf b/modules/local/vcf_collect/main.nf similarity index 57% rename from modules/local/megafusion/main.nf rename to modules/local/vcf_collect/main.nf index d8cb5db0..3ede7936 100644 --- a/modules/local/megafusion/main.nf +++ b/modules/local/vcf_collect/main.nf @@ -1,18 +1,20 @@ -process MEGAFUSION { +process VCF_COLLECT { tag "$meta.id" label 'process_single' - conda "conda-forge::python=3.8.3" + conda "conda-forge::pandas=1.5.2" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/pandas:1.5.2' : 'quay.io/biocontainers/pandas:1.5.2' }" input: - tuple val(meta), path(tsv), path(report) + tuple val(meta), path(fusioninspector_tsv), path(fusioninspector_gtf_tsv), path(fusionreport_report), path(fusionreport_csv) + tuple val(meta2), path(hgnc_ref) + tuple val(meta3), path(hgnc_date) output: path "versions.yml" , emit: versions - tuple val(meta), path("*vcf") , emit: vcf + tuple val(meta), path("*vcf.gz") , emit: vcf when: task.ext.when == null || task.ext.when @@ -20,11 +22,13 @@ process MEGAFUSION { script: def prefix = task.ext.prefix ?: "${meta.id}" """ - megafusion.py --fusioninspector $tsv --fusionreport $report --sample ${prefix} --out ${prefix}.vcf + vcf_collect.py --fusioninspector $fusioninspector_tsv --fusionreport $fusionreport_report --fusioninspector_gtf $fusioninspector_gtf_tsv --fusionreport_csv $fusionreport_csv --hgnc $hgnc_ref --sample ${prefix} --out ${prefix}_fusion_data.vcf + gzip ${prefix}_fusion_data.vcf cat <<-END_VERSIONS > versions.yml "${task.process}": python: \$(python --version | sed 's/Python //g') + HGNC DB retrieval: \$(cat $hgnc_date) END_VERSIONS """ diff --git a/modules/local/megafusion/meta.yml b/modules/local/vcf_collect/meta.yml similarity index 80% rename from modules/local/megafusion/meta.yml rename to modules/local/vcf_collect/meta.yml index a25cd74c..de4667bb 100644 --- a/modules/local/megafusion/meta.yml +++ b/modules/local/vcf_collect/meta.yml @@ -1,10 +1,10 @@ -name: megafusion -description: megafusion +name: vcf_collect +description: vcf_collect keywords: - sort tools: - fusionreport: - description: megafusion + description: Converts RNA fusion files to SV VCF and collects statistics and metrics in a VCF file. homepage: Adapted from https://github.com/J35P312/MegaFusion documentation: https://github.com/J35P312/MegaFusion doi: "" @@ -32,8 +32,8 @@ output: pattern: "versions.yml" - vcf: type: file - description: File containing the summary of all fusions as vcf file - pattern: "*.tsv" + description: File containing the summary of all fusions as compressed vcf file + pattern: "*.vcf.gz" authors: - "@rannick" diff --git a/modules/nf-core/agat/convertspgff2tsv/environment.yml b/modules/nf-core/agat/convertspgff2tsv/environment.yml new file mode 100644 index 00000000..b5fdf3db --- /dev/null +++ b/modules/nf-core/agat/convertspgff2tsv/environment.yml @@ -0,0 +1,7 @@ +name: agat_convertspgff2tsv +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::agat=1.2.0 diff --git a/modules/nf-core/agat/convertspgff2tsv/main.nf b/modules/nf-core/agat/convertspgff2tsv/main.nf new file mode 100644 index 00000000..cef48360 --- /dev/null +++ b/modules/nf-core/agat/convertspgff2tsv/main.nf @@ -0,0 +1,35 @@ +process AGAT_CONVERTSPGFF2TSV { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/agat:1.2.0--pl5321hdfd78af_0' : + 'biocontainers/agat:1.2.0--pl5321hdfd78af_0' }" + + input: + tuple val(meta), path(gff) + + output: + tuple val(meta), path("*.tsv"), emit: tsv + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + + """ + agat_convert_sp_gff2tsv.pl \\ + --gff $gff \\ + --output ${prefix}.tsv \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + agat: \$(agat_convert_sp_gff2tsv.pl --help | sed '3!d; s/.*v//' | sed 's/ .*//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/agat/convertspgff2tsv/meta.yml b/modules/nf-core/agat/convertspgff2tsv/meta.yml new file mode 100644 index 00000000..f5865dfe --- /dev/null +++ b/modules/nf-core/agat/convertspgff2tsv/meta.yml @@ -0,0 +1,38 @@ +name: agat_convertspgff2tsv +description: | + Converts a GFF/GTF file into a TSV file +keywords: + - genome + - gff + - gtf + - conversion + - tsv +tools: + - agat: + description: "AGAT is a toolkit for manipulation and getting information from GFF/GTF files" + homepage: "https://github.com/NBISweden/AGAT" + documentation: "https://agat.readthedocs.io/" + tool_dev_url: "https://github.com/NBISweden/AGAT" + doi: "10.5281/zenodo.3552717" + licence: ["GPL v3"] +input: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - gff: + type: file + description: Annotation file in GFF3/GTF format + pattern: "*.{gff, gtf}" +output: + - tsv: + type: file + description: Annotation file in TSV format + pattern: "*.{gtf}" + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@rannick" diff --git a/modules/nf-core/arriba/main.nf b/modules/nf-core/arriba/main.nf index e4b48be2..2537d05b 100644 --- a/modules/nf-core/arriba/main.nf +++ b/modules/nf-core/arriba/main.nf @@ -2,20 +2,20 @@ process ARRIBA { tag "$meta.id" label 'process_medium' - conda "bioconda::arriba=2.3.0" + conda "bioconda::arriba=2.4.0" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/arriba:2.3.0--haa8aa89_0' : - 'quay.io/biocontainers/arriba:2.3.0--haa8aa89_0' }" + 'https://depot.galaxyproject.org/singularity/arriba:2.4.0--h0033a41_2' : + 'biocontainers/arriba:2.4.0--h0033a41_2' }" input: tuple val(meta), path(bam) - path fasta - path gtf - path blacklist - path known_fusions - path structural_variants - path tags - path protein_domains + tuple val(meta2), path(fasta) + tuple val(meta3), path(gtf) + tuple val(meta4), path(blacklist) + tuple val(meta5), path(known_fusions) + tuple val(meta6), path(structural_variants) + tuple val(meta7), path(tags) + tuple val(meta8), path(protein_domains) output: tuple val(meta), path("*.fusions.tsv") , emit: fusions diff --git a/modules/nf-core/arriba/meta.yml b/modules/nf-core/arriba/meta.yml index 119dd912..85b3a30b 100644 --- a/modules/nf-core/arriba/meta.yml +++ b/modules/nf-core/arriba/meta.yml @@ -3,6 +3,8 @@ description: Arriba is a command-line tool for the detection of gene fusions fro keywords: - fusion - arriba + - detection + - RNA-Seq tools: - arriba: description: Fast and accurate gene fusion detection from RNA-Seq data @@ -22,30 +24,65 @@ input: type: file description: BAM/CRAM/SAM file pattern: "*.{bam,cram,sam}" + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - fasta: type: file description: Assembly FASTA file pattern: "*.{fasta}" + - meta3: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - gtf: type: file description: Annotation GTF file pattern: "*.{gtf}" + - meta4: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - blacklist: type: file description: Blacklist file pattern: "*.{tsv}" + - meta5: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - known_fusions: type: file description: Known fusions file pattern: "*.{tsv}" + - meta6: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - structural_variants: type: file description: Structural variants file pattern: "*.{tsv}" + - meta7: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - tags: type: file description: Tags file pattern: "*.{tsv}" + - meta8: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - protein_domains: type: file description: Protein domains file diff --git a/modules/nf-core/cat/cat/environment.yml b/modules/nf-core/cat/cat/environment.yml new file mode 100644 index 00000000..17a04ef2 --- /dev/null +++ b/modules/nf-core/cat/cat/environment.yml @@ -0,0 +1,7 @@ +name: cat_cat +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - conda-forge::pigz=2.3.4 diff --git a/modules/nf-core/cat/cat/main.nf b/modules/nf-core/cat/cat/main.nf index 840af4b9..4264a92c 100644 --- a/modules/nf-core/cat/cat/main.nf +++ b/modules/nf-core/cat/cat/main.nf @@ -2,10 +2,10 @@ process CAT_CAT { tag "$meta.id" label 'process_low' - conda "conda-forge::pigz=2.3.4" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/pigz:2.3.4' : - 'quay.io/biocontainers/pigz:2.3.4' }" + 'biocontainers/pigz:2.3.4' }" input: tuple val(meta), path(files_in) diff --git a/modules/nf-core/cat/cat/meta.yml b/modules/nf-core/cat/cat/meta.yml index 8acc0bfa..00a8db0b 100644 --- a/modules/nf-core/cat/cat/meta.yml +++ b/modules/nf-core/cat/cat/meta.yml @@ -7,9 +7,7 @@ keywords: tools: - cat: description: Just concatenation - documentation: https://man7.org/linux/man-pages/man1/cat.1.html - licence: ["GPL-3.0-or-later"] input: - meta: @@ -21,7 +19,6 @@ input: type: file description: List of compressed / uncompressed files pattern: "*" - output: - versions: type: file @@ -31,7 +28,9 @@ output: type: file description: Concatenated file. Will be gzipped if file_out ends with ".gz" pattern: "${file_out}" - authors: - "@erikrikarddaniel" - "@FriederikeHanssen" +maintainers: + - "@erikrikarddaniel" + - "@FriederikeHanssen" diff --git a/modules/nf-core/cat/cat/tests/main.nf.test b/modules/nf-core/cat/cat/tests/main.nf.test new file mode 100644 index 00000000..5766daaf --- /dev/null +++ b/modules/nf-core/cat/cat/tests/main.nf.test @@ -0,0 +1,153 @@ +nextflow_process { + + name "Test Process CAT_CAT" + script "../main.nf" + process "CAT_CAT" + tag "modules" + tag "modules_nfcore" + tag "cat" + tag "cat/cat" + + test("test_cat_unzipped_unzipped") { + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'test', single_end:true ], + [ + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true), + file(params.test_data['sarscov2']['genome']['genome_sizes'], checkIfExists: true) + ] + ] + """ + } + } + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + + test("test_cat_zipped_zipped") { + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'test', single_end:true ], + [ + file(params.test_data['sarscov2']['genome']['genome_gff3_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['genome']['contigs_genome_maf_gz'], checkIfExists: true) + ] + ] + """ + } + } + then { + def lines = path(process.out.file_out.get(0).get(1)).linesGzip + assertAll( + { assert process.success }, + { assert snapshot(lines[0..5]).match("test_cat_zipped_zipped_lines") }, + { assert snapshot(lines.size()).match("test_cat_zipped_zipped_size")} + ) + } + } + + test("test_cat_zipped_unzipped") { + config './nextflow_zipped_unzipped.config' + + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'test', single_end:true ], + [ + file(params.test_data['sarscov2']['genome']['genome_gff3_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['genome']['contigs_genome_maf_gz'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_cat_unzipped_zipped") { + config './nextflow_unzipped_zipped.config' + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'test', single_end:true ], + [ + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true), + file(params.test_data['sarscov2']['genome']['genome_sizes'], checkIfExists: true) + ] + ] + """ + } + } + then { + def lines = path(process.out.file_out.get(0).get(1)).linesGzip + assertAll( + { assert process.success }, + { assert snapshot(lines[0..5]).match("test_cat_unzipped_zipped_lines") }, + { assert snapshot(lines.size()).match("test_cat_unzipped_zipped_size")} + ) + } + } + + test("test_cat_one_file_unzipped_zipped") { + config './nextflow_unzipped_zipped.config' + when { + params { + outdir = "${outputDir}" + } + process { + """ + input[0] = + [ + [ id:'test', single_end:true ], + [ + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + ] + """ + } + } + then { + def lines = path(process.out.file_out.get(0).get(1)).linesGzip + assertAll( + { assert process.success }, + { assert snapshot(lines[0..5]).match("test_cat_one_file_unzipped_zipped_lines") }, + { assert snapshot(lines.size()).match("test_cat_one_file_unzipped_zipped_size")} + ) + } + } +} + diff --git a/modules/nf-core/cat/cat/tests/main.nf.test.snap b/modules/nf-core/cat/cat/tests/main.nf.test.snap new file mode 100644 index 00000000..423571ba --- /dev/null +++ b/modules/nf-core/cat/cat/tests/main.nf.test.snap @@ -0,0 +1,121 @@ +{ + "test_cat_unzipped_zipped_size": { + "content": [ + 375 + ], + "timestamp": "2023-10-16T14:33:08.049445686" + }, + "test_cat_unzipped_unzipped": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2" + ] + ], + "1": [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ], + "file_out": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2" + ] + ], + "versions": [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + } + ], + "timestamp": "2023-10-16T14:32:18.500464399" + }, + "test_cat_zipped_unzipped": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9" + ] + ], + "1": [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ], + "file_out": [ + [ + { + "id": "test", + "single_end": true + }, + "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9" + ] + ], + "versions": [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + } + ], + "timestamp": "2023-10-16T14:32:49.642741302" + }, + "test_cat_zipped_zipped_lines": { + "content": [ + [ + "MT192765.1\tGenbank\ttranscript\t259\t29667\t.\t+\t.\tID=unknown_transcript_1;geneID=orf1ab;gene_name=orf1ab", + "MT192765.1\tGenbank\tgene\t259\t21548\t.\t+\t.\tParent=unknown_transcript_1", + "MT192765.1\tGenbank\tCDS\t259\t13461\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1", + "MT192765.1\tGenbank\tCDS\t13461\t21548\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1", + "MT192765.1\tGenbank\tCDS\t21556\t25377\t.\t+\t0\tParent=unknown_transcript_1;gbkey=CDS;gene=S;note=\"structural protein\";product=\"surface glycoprotein\";protein_id=QIK50427.1", + "MT192765.1\tGenbank\tgene\t21556\t25377\t.\t+\t.\tParent=unknown_transcript_1" + ] + ], + "timestamp": "2023-10-16T14:32:33.629048645" + }, + "test_cat_unzipped_zipped_lines": { + "content": [ + [ + ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", + "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT", + "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG", + "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", + "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", + "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ] + ], + "timestamp": "2023-10-16T14:33:08.038830506" + }, + "test_cat_one_file_unzipped_zipped_lines": { + "content": [ + [ + ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", + "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT", + "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG", + "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", + "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", + "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ] + ], + "timestamp": "2023-10-16T14:33:21.39642399" + }, + "test_cat_zipped_zipped_size": { + "content": [ + 78 + ], + "timestamp": "2023-10-16T14:32:33.641869244" + }, + "test_cat_one_file_unzipped_zipped_size": { + "content": [ + 374 + ], + "timestamp": "2023-10-16T14:33:21.4094373" + } +} \ No newline at end of file diff --git a/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config b/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config new file mode 100644 index 00000000..ec26b0fd --- /dev/null +++ b/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config @@ -0,0 +1,6 @@ + +process { + withName: CAT_CAT { + ext.prefix = 'cat.txt.gz' + } +} diff --git a/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config b/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config new file mode 100644 index 00000000..fbc79783 --- /dev/null +++ b/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config @@ -0,0 +1,8 @@ + +process { + + withName: CAT_CAT { + ext.prefix = 'cat.txt' + } + +} diff --git a/modules/nf-core/cat/cat/tests/tags.yml b/modules/nf-core/cat/cat/tests/tags.yml new file mode 100644 index 00000000..37b578f5 --- /dev/null +++ b/modules/nf-core/cat/cat/tests/tags.yml @@ -0,0 +1,2 @@ +cat/cat: + - modules/nf-core/cat/cat/** diff --git a/modules/nf-core/cat/fastq/environment.yml b/modules/nf-core/cat/fastq/environment.yml new file mode 100644 index 00000000..bff93add --- /dev/null +++ b/modules/nf-core/cat/fastq/environment.yml @@ -0,0 +1,7 @@ +name: cat_fastq +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - conda-forge::sed=4.7 diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf index 8a0b5600..3d963784 100644 --- a/modules/nf-core/cat/fastq/main.nf +++ b/modules/nf-core/cat/fastq/main.nf @@ -2,10 +2,10 @@ process CAT_FASTQ { tag "$meta.id" label 'process_single' - conda "conda-forge::sed=4.7" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : - 'ubuntu:20.04' }" + 'nf-core/ubuntu:20.04' }" input: tuple val(meta), path(reads, stageAs: "input*/*") diff --git a/modules/nf-core/cat/fastq/meta.yml b/modules/nf-core/cat/fastq/meta.yml index c836598e..db4ac3c7 100644 --- a/modules/nf-core/cat/fastq/meta.yml +++ b/modules/nf-core/cat/fastq/meta.yml @@ -1,6 +1,7 @@ name: cat_fastq description: Concatenates fastq files keywords: + - cat - fastq - concatenate tools: @@ -16,7 +17,7 @@ input: Groovy Map containing sample information e.g. [ id:'test', single_end:false ] - reads: - type: list + type: file description: | List of input FastQ files to be concatenated. output: @@ -33,7 +34,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test new file mode 100644 index 00000000..f5f94182 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test @@ -0,0 +1,143 @@ +nextflow_process { + + name "Test Process CAT_FASTQ" + script "../main.nf" + process "CAT_FASTQ" + tag "modules" + tag "modules_nfcore" + tag "cat" + tag "cat/fastq" + + test("test_cat_fastq_single_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_paired_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test2_2_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_single_end_same_name") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_paired_end_same_name") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } + + test("test_cat_fastq_single_end_single_file") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.reads).match() }, + { assert path(process.out.versions.get(0)).getText().contains("cat") } + ) + } + } +} diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap new file mode 100644 index 00000000..ec2342e5 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap @@ -0,0 +1,78 @@ +{ + "test_cat_fastq_single_end": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,f9cf5e375f7de81a406144a2c70cc64d" + ] + ] + ], + "timestamp": "2023-10-17T23:19:12.990284837" + }, + "test_cat_fastq_single_end_same_name": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,63f817db7a29a03eb538104495556f66" + ] + ] + ], + "timestamp": "2023-10-17T23:19:31.554568147" + }, + "test_cat_fastq_single_end_single_file": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,e325ef7deb4023447a1f074e285761af" + ] + ] + ], + "timestamp": "2023-10-17T23:19:49.629360033" + }, + "test_cat_fastq_paired_end_same_name": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,63f817db7a29a03eb538104495556f66", + "test_2.merged.fastq.gz:md5,fe9f266f43a6fc3dcab690a18419a56e" + ] + ] + ] + ], + "timestamp": "2023-10-17T23:19:40.711617539" + }, + "test_cat_fastq_paired_end": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,f9cf5e375f7de81a406144a2c70cc64d", + "test_2.merged.fastq.gz:md5,77c8e966e130d8c6b6ec9be52fcb2bda" + ] + ] + ] + ], + "timestamp": "2023-10-18T07:53:20.923560211" + } +} \ No newline at end of file diff --git a/modules/nf-core/cat/fastq/tests/tags.yml b/modules/nf-core/cat/fastq/tests/tags.yml new file mode 100644 index 00000000..6ac43614 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/tags.yml @@ -0,0 +1,2 @@ +cat/fastq: + - modules/nf-core/cat/fastq/** diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml new file mode 100644 index 00000000..f0c63f69 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/environment.yml @@ -0,0 +1,7 @@ +name: custom_dumpsoftwareversions +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::multiqc=1.17 diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf index 800a6099..7685b33c 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/main.nf +++ b/modules/nf-core/custom/dumpsoftwareversions/main.nf @@ -2,10 +2,10 @@ process CUSTOM_DUMPSOFTWAREVERSIONS { label 'process_single' // Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container - conda "bioconda::multiqc=1.14" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.14--pyhdfd78af_0' : - 'quay.io/biocontainers/multiqc:1.14--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.17--pyhdfd78af_0' : + 'biocontainers/multiqc:1.17--pyhdfd78af_0' }" input: path versions diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml index 60b546a0..5f15a5fd 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/meta.yml +++ b/modules/nf-core/custom/dumpsoftwareversions/meta.yml @@ -1,7 +1,9 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json name: custom_dumpsoftwareversions description: Custom module used to dump software versions within the nf-core pipeline template keywords: - custom + - dump - version tools: - custom: @@ -14,7 +16,6 @@ input: type: file description: YML file containing software versions pattern: "*.yml" - output: - yml: type: file @@ -28,7 +29,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@drpatelh" - "@grst" +maintainers: + - "@drpatelh" + - "@grst" diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test new file mode 100644 index 00000000..eec1db10 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test @@ -0,0 +1,38 @@ +nextflow_process { + + name "Test Process CUSTOM_DUMPSOFTWAREVERSIONS" + script "../main.nf" + process "CUSTOM_DUMPSOFTWAREVERSIONS" + tag "modules" + tag "modules_nfcore" + tag "custom" + tag "dumpsoftwareversions" + tag "custom/dumpsoftwareversions" + + test("Should run without failures") { + when { + process { + """ + def tool1_version = ''' + TOOL1: + tool1: 0.11.9 + '''.stripIndent() + + def tool2_version = ''' + TOOL2: + tool2: 1.9 + '''.stripIndent() + + input[0] = Channel.of(tool1_version, tool2_version).collectFile() + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap new file mode 100644 index 00000000..4274ed57 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap @@ -0,0 +1,27 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + "software_versions.yml:md5,1c851188476409cda5752ce971b20b58" + ], + "1": [ + "software_versions_mqc.yml:md5,2570f4ba271ad08357b0d3d32a9cf84d" + ], + "2": [ + "versions.yml:md5,3843ac526e762117eedf8825b40683df" + ], + "mqc_yml": [ + "software_versions_mqc.yml:md5,2570f4ba271ad08357b0d3d32a9cf84d" + ], + "versions": [ + "versions.yml:md5,3843ac526e762117eedf8825b40683df" + ], + "yml": [ + "software_versions.yml:md5,1c851188476409cda5752ce971b20b58" + ] + } + ], + "timestamp": "2023-11-03T14:43:22.157011" + } +} diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml new file mode 100644 index 00000000..405aa24a --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml @@ -0,0 +1,2 @@ +custom/dumpsoftwareversions: + - modules/nf-core/custom/dumpsoftwareversions/** diff --git a/modules/nf-core/fastp/environment.yml b/modules/nf-core/fastp/environment.yml new file mode 100644 index 00000000..70389e66 --- /dev/null +++ b/modules/nf-core/fastp/environment.yml @@ -0,0 +1,7 @@ +name: fastp +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::fastp=0.23.4 diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf index 5eeb9b09..c8e815ae 100644 --- a/modules/nf-core/fastp/main.nf +++ b/modules/nf-core/fastp/main.nf @@ -2,10 +2,10 @@ process FASTP { tag "$meta.id" label 'process_medium' - conda "bioconda::fastp=0.23.2" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fastp:0.23.2--h79da9fb_0' : - 'quay.io/biocontainers/fastp:0.23.2--h79da9fb_0' }" + 'https://depot.galaxyproject.org/singularity/fastp:0.23.4--h5f740d0_0' : + 'biocontainers/fastp:0.23.4--h5f740d0_0' }" input: tuple val(meta), path(reads) diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml index 197ea7ca..c22a16ab 100644 --- a/modules/nf-core/fastp/meta.yml +++ b/modules/nf-core/fastp/meta.yml @@ -33,7 +33,6 @@ input: - save_merged: type: boolean description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz` - output: - meta: type: map @@ -71,3 +70,6 @@ output: authors: - "@drpatelh" - "@kevinmenden" +maintainers: + - "@drpatelh" + - "@kevinmenden" diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test new file mode 100644 index 00000000..f610b735 --- /dev/null +++ b/modules/nf-core/fastp/tests/main.nf.test @@ -0,0 +1,485 @@ +nextflow_process { + + name "Test Process FASTP" + script "../main.nf" + process "FASTP" + tag "modules" + tag "modules_nfcore" + tag "fastp" + + test("test_fastp_single_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = [ + [ id:'test', single_end:true ], + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] + ] + + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:12.922000 K (92.984097%)", + "single end (151 cycles)" ] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_paired_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("fastp test_fastp_interleaved") { + config './nextflow.config' + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = [ [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_interleaved_fastq_gz'], checkIfExists: true) ] + ] + + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "paired end (151 cycles + 151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 198"] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_single_end_trim_fail") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + + input[0] = [ [ id:'test', single_end:true ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) ] + ] + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:12.922000 K (92.984097%)", + "single end (151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { failed_read_lines.each { failed_read_line -> + { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_paired_end_trim_fail") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { failed_read2_lines.each { failed_read2_line -> + { assert path(process.out.reads_fail.get(0).get(1).get(1)).linesGzip.contains(failed_read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_paired_end_merged") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + + input[0] = [ [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "
    "] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683'] + def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } + + test("test_fastp_paired_end_merged_adapterlist") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = file("https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/fastp/adapters.fasta", checkIfExists: true) + save_trimmed_fail = false + save_merged = true + + input[0] = [ [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "
    "] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"] + def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } +} diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap new file mode 100644 index 00000000..0fa68c7d --- /dev/null +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -0,0 +1,52 @@ +{ + "fastp test_fastp_interleaved_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,168f516f7bd4b7b6c32da7cba87299a4" + ] + ] + ], + "timestamp": "2023-10-17T11:04:45.794175881" + }, + "test_fastp_single_end_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" + ] + ] + ], + "timestamp": "2023-10-17T11:04:10.566343705" + }, + "versions": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "timestamp": "2023-10-17T11:04:10.582076024" + }, + "test_fastp_single_end_trim_fail_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + ] + ] + ], + "timestamp": "2023-10-17T11:05:00.379878948" + } +} \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/nextflow.config b/modules/nf-core/fastp/tests/nextflow.config new file mode 100644 index 00000000..0f7849ad --- /dev/null +++ b/modules/nf-core/fastp/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + + withName: FASTP { + ext.args = "--interleaved_in" + } +} diff --git a/modules/nf-core/fastp/tests/tags.yml b/modules/nf-core/fastp/tests/tags.yml new file mode 100644 index 00000000..c1afcce7 --- /dev/null +++ b/modules/nf-core/fastp/tests/tags.yml @@ -0,0 +1,2 @@ +fastp: + - modules/nf-core/fastp/** diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml new file mode 100644 index 00000000..1787b38a --- /dev/null +++ b/modules/nf-core/fastqc/environment.yml @@ -0,0 +1,7 @@ +name: fastqc +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index 9ae58381..50e59f2b 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -2,10 +2,10 @@ process FASTQC { tag "$meta.id" label 'process_medium' - conda "bioconda::fastqc=0.11.9" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fastqc:0.11.9--0' : - 'quay.io/biocontainers/fastqc:0.11.9--0' }" + 'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' : + 'biocontainers/fastqc:0.12.1--hdfd78af_0' }" input: tuple val(meta), path(reads) @@ -29,7 +29,11 @@ process FASTQC { printf "%s %s\\n" $rename_to | while read old_name new_name; do [ -f "\${new_name}" ] || ln -s \$old_name \$new_name done - fastqc $args --threads $task.cpus $renamed_files + + fastqc \\ + $args \\ + --threads $task.cpus \\ + $renamed_files cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index 4da5bb5a..ee5507e0 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -50,3 +50,8 @@ authors: - "@grst" - "@ewels" - "@FelixKrueger" +maintainers: + - "@drpatelh" + - "@grst" + - "@ewels" + - "@FelixKrueger" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test new file mode 100644 index 00000000..6437a144 --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -0,0 +1,41 @@ +nextflow_process { + + name "Test Process FASTQC" + script "../main.nf" + process "FASTQC" + tag "modules" + tag "modules_nfcore" + tag "fastqc" + + test("Single-Read") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id: 'test', single_end:true ], + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
    Mon 2 Oct 2023
    test.gz
    + // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html.get(0).get(1) ==~ ".*/test_fastqc.html" }, + { assert path(process.out.html.get(0).get(1)).getText().contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match("versions") }, + { assert process.out.zip.get(0).get(1) ==~ ".*/test_fastqc.zip" } + ) + } + } +} diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap new file mode 100644 index 00000000..636a32ce --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -0,0 +1,10 @@ +{ + "versions": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "timestamp": "2023-10-09T23:40:54+0000" + } +} \ No newline at end of file diff --git a/modules/nf-core/fastqc/tests/tags.yml b/modules/nf-core/fastqc/tests/tags.yml new file mode 100644 index 00000000..7834294b --- /dev/null +++ b/modules/nf-core/fastqc/tests/tags.yml @@ -0,0 +1,2 @@ +fastqc: + - modules/nf-core/fastqc/** diff --git a/modules/nf-core/gatk4/bedtointervallist/environment.yml b/modules/nf-core/gatk4/bedtointervallist/environment.yml new file mode 100644 index 00000000..e7cb4280 --- /dev/null +++ b/modules/nf-core/gatk4/bedtointervallist/environment.yml @@ -0,0 +1,7 @@ +name: gatk4_bedtointervallist +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::gatk4=4.4.0.0 diff --git a/modules/nf-core/gatk4/bedtointervallist/main.nf b/modules/nf-core/gatk4/bedtointervallist/main.nf index 41fab003..88b24b1a 100644 --- a/modules/nf-core/gatk4/bedtointervallist/main.nf +++ b/modules/nf-core/gatk4/bedtointervallist/main.nf @@ -2,14 +2,14 @@ process GATK4_BEDTOINTERVALLIST { tag "$meta.id" label 'process_medium' - conda "bioconda::gatk4=4.3.0.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.3.0.0--py36hdfd78af_0': - 'quay.io/biocontainers/gatk4:4.3.0.0--py36hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/gatk4:4.4.0.0--py36hdfd78af_0': + 'biocontainers/gatk4:4.4.0.0--py36hdfd78af_0' }" input: tuple val(meta), path(bed) - path dict + tuple val(meta2), path(dict) output: tuple val(meta), path('*.interval_list'), emit: interval_list @@ -22,14 +22,15 @@ process GATK4_BEDTOINTERVALLIST { def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def avail_mem = 3 + def avail_mem = 3072 if (!task.memory) { log.info '[GATK BedToIntervalList] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' } else { - avail_mem = task.memory.giga + avail_mem = (task.memory.mega*0.8).intValue() } """ - gatk --java-options "-Xmx${avail_mem}g" BedToIntervalList \\ + gatk --java-options "-Xmx${avail_mem}M -XX:-UsePerfData" \\ + BedToIntervalList \\ --INPUT $bed \\ --OUTPUT ${prefix}.interval_list \\ --SEQUENCE_DICTIONARY $dict \\ diff --git a/modules/nf-core/gatk4/bedtointervallist/meta.yml b/modules/nf-core/gatk4/bedtointervallist/meta.yml index 986f1592..187da885 100644 --- a/modules/nf-core/gatk4/bedtointervallist/meta.yml +++ b/modules/nf-core/gatk4/bedtointervallist/meta.yml @@ -2,6 +2,8 @@ name: gatk4_bedtointervallist description: Creates an interval list from a bed file and a reference dict keywords: - bed + - bedtointervallist + - gatk4 - interval list tools: - gatk4: @@ -23,6 +25,11 @@ input: type: file description: Input bed file pattern: "*.bed" + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] - dict: type: file description: Sequence dictionary @@ -38,3 +45,7 @@ output: pattern: "versions.yml" authors: - "@kevinmenden" + - "@ramprasadn" +maintainers: + - "@kevinmenden" + - "@ramprasadn" diff --git a/modules/nf-core/gatk4/createsequencedictionary/environment.yml b/modules/nf-core/gatk4/createsequencedictionary/environment.yml new file mode 100644 index 00000000..db663e14 --- /dev/null +++ b/modules/nf-core/gatk4/createsequencedictionary/environment.yml @@ -0,0 +1,7 @@ +name: gatk4_createsequencedictionary +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::gatk4=4.4.0.0 diff --git a/modules/nf-core/gatk4/createsequencedictionary/main.nf b/modules/nf-core/gatk4/createsequencedictionary/main.nf index bc324ada..b47ad162 100644 --- a/modules/nf-core/gatk4/createsequencedictionary/main.nf +++ b/modules/nf-core/gatk4/createsequencedictionary/main.nf @@ -2,17 +2,17 @@ process GATK4_CREATESEQUENCEDICTIONARY { tag "$fasta" label 'process_medium' - conda "bioconda::gatk4=4.3.0.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/gatk4:4.3.0.0--py36hdfd78af_0': - 'quay.io/biocontainers/gatk4:4.3.0.0--py36hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/gatk4:4.4.0.0--py36hdfd78af_0': + 'biocontainers/gatk4:4.4.0.0--py36hdfd78af_0' }" input: - path fasta + tuple val(meta), path(fasta) output: - path "*.dict" , emit: dict - path "versions.yml" , emit: versions + tuple val(meta), path('*.dict') , emit: dict + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -20,14 +20,15 @@ process GATK4_CREATESEQUENCEDICTIONARY { script: def args = task.ext.args ?: '' - def avail_mem = 6 + def avail_mem = 6144 if (!task.memory) { log.info '[GATK CreateSequenceDictionary] Available memory not known - defaulting to 6GB. Specify process memory requirements to change this.' } else { - avail_mem = task.memory.giga + avail_mem = (task.memory.mega*0.8).intValue() } """ - gatk --java-options "-Xmx${avail_mem}g" CreateSequenceDictionary \\ + gatk --java-options "-Xmx${avail_mem}M -XX:-UsePerfData" \\ + CreateSequenceDictionary \\ --REFERENCE $fasta \\ --URI $fasta \\ --TMP_DIR . \\ diff --git a/modules/nf-core/gatk4/createsequencedictionary/meta.yml b/modules/nf-core/gatk4/createsequencedictionary/meta.yml index 69c23581..f9d70be0 100644 --- a/modules/nf-core/gatk4/createsequencedictionary/meta.yml +++ b/modules/nf-core/gatk4/createsequencedictionary/meta.yml @@ -1,8 +1,10 @@ name: gatk4_createsequencedictionary description: Creates a sequence dictionary for a reference sequence keywords: + - createsequencedictionary - dictionary - fasta + - gatk4 tools: - gatk: description: | @@ -13,8 +15,12 @@ tools: documentation: https://gatk.broadinstitute.org/hc/en-us/categories/360002369672s doi: 10.1158/1538-7445.AM2017-3590 licence: ["Apache-2.0"] - input: + - meta: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'genome' ] - fasta: type: file description: Input fasta file @@ -30,3 +36,7 @@ output: pattern: "versions.yml" authors: - "@maxulysse" + - "@ramprasadn" +maintainers: + - "@maxulysse" + - "@ramprasadn" diff --git a/modules/nf-core/gatk4/markduplicates/environment.yml b/modules/nf-core/gatk4/markduplicates/environment.yml new file mode 100644 index 00000000..9adad104 --- /dev/null +++ b/modules/nf-core/gatk4/markduplicates/environment.yml @@ -0,0 +1,8 @@ +name: gatk4_markduplicates +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::gatk4=4.4.0.0 + - bioconda::samtools=1.17 diff --git a/modules/nf-core/gatk4/markduplicates/main.nf b/modules/nf-core/gatk4/markduplicates/main.nf new file mode 100644 index 00000000..564b86d3 --- /dev/null +++ b/modules/nf-core/gatk4/markduplicates/main.nf @@ -0,0 +1,85 @@ +process GATK4_MARKDUPLICATES { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/mulled-v2-d9e7bad0f7fbc8f4458d5c3ab7ffaaf0235b59fb:f857e2d6cc88d35580d01cf39e0959a68b83c1d9-0': + 'biocontainers/mulled-v2-d9e7bad0f7fbc8f4458d5c3ab7ffaaf0235b59fb:f857e2d6cc88d35580d01cf39e0959a68b83c1d9-0' }" + + input: + tuple val(meta), path(bam) + path fasta + path fasta_fai + + output: + tuple val(meta), path("*cram"), emit: cram, optional: true + tuple val(meta), path("*bam"), emit: bam, optional: true + tuple val(meta), path("*.crai"), emit: crai, optional: true + tuple val(meta), path("*.bai"), emit: bai, optional: true + tuple val(meta), path("*.metrics"), emit: metrics + path "versions.yml", emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + prefix = task.ext.prefix ?: "${meta.id}.bam" + + // If the extension is CRAM, then change it to BAM + prefix_bam = prefix.tokenize('.')[-1] == 'cram' ? "${prefix.substring(0, prefix.lastIndexOf('.'))}.bam" : prefix + + def input_list = bam.collect{"--INPUT $it"}.join(' ') + def reference = fasta ? "--REFERENCE_SEQUENCE ${fasta}" : "" + + def avail_mem = 3072 + if (!task.memory) { + log.info '[GATK MarkDuplicates] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' + } else { + avail_mem = (task.memory.mega*0.8).intValue() + } + + // Using samtools and not Markduplicates to compress to CRAM speeds up computation: + // https://medium.com/@acarroll.dna/looking-at-trade-offs-in-compression-levels-for-genomics-tools-eec2834e8b94 + """ + gatk --java-options "-Xmx${avail_mem}M -XX:-UsePerfData" \\ + MarkDuplicates \\ + $input_list \\ + --OUTPUT ${prefix_bam} \\ + --METRICS_FILE ${prefix}.metrics \\ + --TMP_DIR . \\ + ${reference} \\ + $args + + # If cram files are wished as output, the run samtools for conversion + if [[ ${prefix} == *.cram ]]; then + samtools view -Ch -T ${fasta} -o ${prefix} ${prefix_bam} + rm ${prefix_bam} + samtools index ${prefix} + fi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ + + stub: + prefix = task.ext.prefix ?: "${meta.id}.bam" + prefix_no_suffix = task.ext.prefix ? prefix.tokenize('.')[0] : "${meta.id}" + """ + touch ${prefix_no_suffix}.bam + touch ${prefix_no_suffix}.cram + touch ${prefix_no_suffix}.cram.crai + touch ${prefix_no_suffix}.bai + touch ${prefix}.metrics + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + gatk4: \$(echo \$(gatk --version 2>&1) | sed 's/^.*(GATK) v//; s/ .*\$//') + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + END_VERSIONS + """ +} diff --git a/modules/nf-core/gatk4/markduplicates/meta.yml b/modules/nf-core/gatk4/markduplicates/meta.yml new file mode 100644 index 00000000..b0f09d4b --- /dev/null +++ b/modules/nf-core/gatk4/markduplicates/meta.yml @@ -0,0 +1,71 @@ +name: gatk4_markduplicates +description: This tool locates and tags duplicate reads in a BAM or SAM file, where duplicate reads are defined as originating from a single fragment of DNA. +keywords: + - bam + - gatk4 + - markduplicates + - sort +tools: + - gatk4: + description: Developed in the Data Sciences Platform at the Broad Institute, the toolkit offers a wide variety of tools with a primary focus on variant discovery and genotyping. Its powerful processing engine and high-performance computing features make it capable of taking on projects of any size. + homepage: https://gatk.broadinstitute.org/hc/en-us + documentation: https://gatk.broadinstitute.org/hc/en-us/articles/360037052812-MarkDuplicates-Picard- + tool_dev_url: https://github.com/broadinstitute/gatk + doi: 10.1158/1538-7445.AM2017-3590 + licence: ["MIT"] +input: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: Sorted BAM file + pattern: "*.{bam}" + - fasta: + type: file + description: Fasta file + pattern: "*.{fasta}" + - fasta_fai: + type: file + description: Fasta index file + pattern: "*.{fai}" +output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" + - bam: + type: file + description: Marked duplicates BAM file + pattern: "*.{bam}" + - cram: + type: file + description: Marked duplicates CRAM file + pattern: "*.{cram}" + - bai: + type: file + description: BAM index file + pattern: "*.{bam.bai}" + - crai: + type: file + description: CRAM index file + pattern: "*.{cram.crai}" + - metrics: + type: file + description: Duplicate metrics file generated by GATK + pattern: "*.{metrics.txt}" +authors: + - "@ajodeh-juma" + - "@FriederikeHanssen" + - "@maxulysse" +maintainers: + - "@ajodeh-juma" + - "@FriederikeHanssen" + - "@maxulysse" diff --git a/modules/nf-core/kallisto/index/main.nf b/modules/nf-core/kallisto/index/main.nf deleted file mode 100644 index a24024b4..00000000 --- a/modules/nf-core/kallisto/index/main.nf +++ /dev/null @@ -1,44 +0,0 @@ -process KALLISTO_INDEX { - tag "$fasta" - label 'process_medium' - - conda "bioconda::kallisto=0.46.2" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/kallisto:0.46.2--h4f7b962_1' : - 'quay.io/biocontainers/kallisto:0.46.2--h4f7b962_1' }" - - input: - path fasta - - output: - path "kallisto" , emit: idx - path "versions.yml" , emit: versions - - when: - task.ext.when == null || task.ext.when - - script: - def args = task.ext.args ?: '' - """ - kallisto \\ - index \\ - $args \\ - -i kallisto \\ - $fasta - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - kallisto: \$(echo \$(kallisto 2>&1) | sed 's/^kallisto //; s/Usage.*\$//') - END_VERSIONS - """ - - stub: - """ - touch kallisto - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - kallisto: \$(echo \$(kallisto 2>&1) | sed 's/^kallisto //; s/Usage.*\$//') - END_VERSIONS - """ -} diff --git a/modules/nf-core/kallisto/index/meta.yml b/modules/nf-core/kallisto/index/meta.yml deleted file mode 100644 index 47f40c9a..00000000 --- a/modules/nf-core/kallisto/index/meta.yml +++ /dev/null @@ -1,31 +0,0 @@ -name: kallisto_index -description: Create kallisto index -keywords: - - index -tools: - - kallisto: - description: Quantifying abundances of transcripts from bulk and single-cell RNA-Seq data, or more generally of target sequences using high-throughput sequencing reads. - homepage: https://pachterlab.github.io/kallisto/ - documentation: https://pachterlab.github.io/kallisto/manual - tool_dev_url: https://github.com/pachterlab/kallisto - - licence: ["BSD-2-Clause"] - -input: - - fasta: - type: file - description: genome fasta file - pattern: "*.{fasta}" - -output: - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - idx: - type: index - description: Kallisto genome index - pattern: "*.idx" - -authors: - - "@ggabernet" diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml new file mode 100644 index 00000000..bc0bdb5b --- /dev/null +++ b/modules/nf-core/multiqc/environment.yml @@ -0,0 +1,7 @@ +name: multiqc +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::multiqc=1.18 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 4b604749..00cc48d2 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -1,10 +1,10 @@ process MULTIQC { label 'process_single' - conda "bioconda::multiqc=1.14" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.14--pyhdfd78af_0' : - 'quay.io/biocontainers/multiqc:1.14--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.18--pyhdfd78af_0' : + 'biocontainers/multiqc:1.18--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" @@ -25,12 +25,14 @@ process MULTIQC { def args = task.ext.args ?: '' def config = multiqc_config ? "--config $multiqc_config" : '' def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' + def logo = multiqc_logo ? /--cl-config 'custom_logo: "${multiqc_logo}"'/ : '' """ multiqc \\ --force \\ $args \\ $config \\ $extra_config \\ + $logo \\ . cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml index ebc29b27..f1aa660e 100644 --- a/modules/nf-core/multiqc/meta.yml +++ b/modules/nf-core/multiqc/meta.yml @@ -1,4 +1,5 @@ -name: MultiQC +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json +name: multiqc description: Aggregate results from bioinformatics analyses across many samples into a single report keywords: - QC @@ -12,7 +13,6 @@ tools: homepage: https://multiqc.info/ documentation: https://multiqc.info/docs/ licence: ["GPL-3.0-or-later"] - input: - multiqc_files: type: file @@ -30,14 +30,13 @@ input: type: file description: Optional logo file for MultiQC pattern: "*.{png}" - output: - report: type: file description: MultiQC report file pattern: "multiqc_report.html" - data: - type: dir + type: directory description: MultiQC data dir pattern: "multiqc_data" - plots: @@ -53,3 +52,8 @@ authors: - "@bunop" - "@drpatelh" - "@jfy133" +maintainers: + - "@abhi18av" + - "@bunop" + - "@drpatelh" + - "@jfy133" diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test new file mode 100644 index 00000000..68fffa90 --- /dev/null +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -0,0 +1,91 @@ +nextflow_process { + + name "Test Process MULTIQC" + script "../main.nf" + process "MULTIQC" + tag "modules" + tag "modules_nfcore" + tag "multiqc" + + test("MULTIQC: FASTQC") { + + setup { + run("FASTQC") { + script "../../fastqc/main.nf" + process { + """ + input[0] = Channel.of([ + [ id: 'test', single_end: false ], + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)] + ]) + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = FASTQC.out.zip.collect { it[1] } + input[1] = [] + input[2] = [] + input[3] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.report.get(0)).exists() }, + { assert path(process.out.data.get(0)).exists() }, + { assert path(process.out.versions.get(0)).getText().contains("multiqc") } + ) + } + + } + + test("MULTIQC: FASTQC and a config file") { + + setup { + run("FASTQC") { + script "../../fastqc/main.nf" + process { + """ + input[0] = Channel.of([ + [ id: 'test', single_end: false ], + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)] + ]) + """ + } + } + } + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = FASTQC.out.zip.collect { it[1] } + input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) + input[2] = [] + input[3] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.report.get(0)).exists() }, + { assert path(process.out.data.get(0)).exists() }, + { assert path(process.out.versions.get(0)).getText().contains("multiqc") } + ) + } + + } +} diff --git a/modules/nf-core/multiqc/tests/tags.yml b/modules/nf-core/multiqc/tests/tags.yml new file mode 100644 index 00000000..bea6c0d3 --- /dev/null +++ b/modules/nf-core/multiqc/tests/tags.yml @@ -0,0 +1,2 @@ +multiqc: + - modules/nf-core/multiqc/** diff --git a/modules/nf-core/picard/collectinsertsizemetrics/environment.yml b/modules/nf-core/picard/collectinsertsizemetrics/environment.yml new file mode 100644 index 00000000..5c85f872 --- /dev/null +++ b/modules/nf-core/picard/collectinsertsizemetrics/environment.yml @@ -0,0 +1,7 @@ +name: picard_collectinsertsizemetrics +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::picard=3.1.0 diff --git a/modules/nf-core/picard/collectinsertsizemetrics/main.nf b/modules/nf-core/picard/collectinsertsizemetrics/main.nf new file mode 100644 index 00000000..48e4d2ad --- /dev/null +++ b/modules/nf-core/picard/collectinsertsizemetrics/main.nf @@ -0,0 +1,61 @@ +process PICARD_COLLECTINSERTSIZEMETRICS { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/picard:3.1.0--hdfd78af_0' : + 'biocontainers/picard:3.1.0--hdfd78af_0' }" + + input: + tuple val(meta), path(bam) + + output: + tuple val(meta), path("*.txt"), emit: metrics + tuple val(meta), path("*.pdf"), emit: histogram + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + + def avail_mem = 3072 + if (!task.memory) { + log.info '[Picard CollectInsertSizeMetrics] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' + } else { + avail_mem = (task.memory.mega*0.8).intValue() + } + """ + picard \\ + -Xmx${avail_mem}M \\ + CollectInsertSizeMetrics \\ + $args \\ + --INPUT $bam \\ + --OUTPUT ${prefix}.txt \\ + --Histogram_FILE ${prefix}.pdf \\ + $args + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + picard: \$(picard CollectInsertSizeMetrics --version 2>&1 | grep -o 'Version:.*' | cut -f2- -d:) + END_VERSIONS + """ + + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.pdf + touch ${prefix}.txt + cat <<-END_VERSIONS > versions.yml + "${task.process}": + picard: \$(picard CollectInsertSizeMetrics --version 2>&1 | grep -o 'Version:.*' | cut -f2- -d:) + END_VERSIONS + """ + + + +} diff --git a/modules/nf-core/picard/collectinsertsizemetrics/meta.yml b/modules/nf-core/picard/collectinsertsizemetrics/meta.yml new file mode 100644 index 00000000..efd5abe0 --- /dev/null +++ b/modules/nf-core/picard/collectinsertsizemetrics/meta.yml @@ -0,0 +1,47 @@ +name: "picard_collectinsertsizemetrics" +description: Collect metrics about the insert size distribution of a paired-end library. +keywords: + - metrics + - alignment + - insert + - statistics + - bam +tools: + - "picard": + description: "Java tools for working with NGS data in the BAM format" + homepage: "https://broadinstitute.github.io/picard/" + documentation: "https://broadinstitute.github.io/picard/" + tool_dev_url: "https://github.com/broadinstitute/picard" + licence: "['MIT']" +input: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: BAM/CRAM/SAM file + pattern: "*.{bam,cram,sam}" +output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - versions: + type: file + description: File containing software versions + pattern: "versions.yml" + - pdf: + type: file + description: Histogram plots of the insert size metrics computed by Picard + pattern: "*.pdf" + - metrics: + type: file + description: Values used by Picard to generate the insert size histograms + pattern: "*.txt" +authors: + - "@FerriolCalvet" +maintainers: + - "@FerriolCalvet" diff --git a/modules/nf-core/picard/collectwgsmetrics/environment.yml b/modules/nf-core/picard/collectwgsmetrics/environment.yml new file mode 100644 index 00000000..8adda491 --- /dev/null +++ b/modules/nf-core/picard/collectwgsmetrics/environment.yml @@ -0,0 +1,8 @@ +name: picard_collectwgsmetrics +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::picard=3.1.0 + - r::r-base diff --git a/modules/nf-core/picard/collectwgsmetrics/main.nf b/modules/nf-core/picard/collectwgsmetrics/main.nf index 827dfb23..67aa5b5e 100644 --- a/modules/nf-core/picard/collectwgsmetrics/main.nf +++ b/modules/nf-core/picard/collectwgsmetrics/main.nf @@ -2,15 +2,15 @@ process PICARD_COLLECTWGSMETRICS { tag "$meta.id" label 'process_single' - conda "bioconda::picard=3.0.0 r::r-base" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/picard:3.0.0--hdfd78af_1' : - 'quay.io/biocontainers/picard:3.0.0--hdfd78af_1' }" + 'https://depot.galaxyproject.org/singularity/picard:3.1.0--hdfd78af_0' : + 'biocontainers/picard:3.1.0--hdfd78af_0' }" input: tuple val(meta), path(bam), path(bai) tuple val(meta2), path(fasta) - tuple val(meta2), path(fai) + tuple val(meta3), path(fai) path intervallist output: @@ -23,16 +23,16 @@ process PICARD_COLLECTWGSMETRICS { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def avail_mem = 3 + def avail_mem = 3072 def interval = intervallist ? "--INTERVALS ${intervallist}" : '' if (!task.memory) { log.info '[Picard CollectWgsMetrics] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' } else { - avail_mem = task.memory.giga + avail_mem = (task.memory.mega*0.8).intValue() } """ picard \\ - -Xmx${avail_mem}g \\ + -Xmx${avail_mem}M \\ CollectWgsMetrics \\ $args \\ --INPUT $bam \\ diff --git a/modules/nf-core/picard/collectwgsmetrics/meta.yml b/modules/nf-core/picard/collectwgsmetrics/meta.yml index 2f8dbd3c..5576ef92 100644 --- a/modules/nf-core/picard/collectwgsmetrics/meta.yml +++ b/modules/nf-core/picard/collectwgsmetrics/meta.yml @@ -37,7 +37,7 @@ input: type: file description: Genome fasta file pattern: "*.{fa,fasta,fna}" - - meta2: + - meta3: type: map description: | Groovy Map containing reference information @@ -67,3 +67,9 @@ authors: - "@drpatelh" - "@flowuenne" - "@lassefolkersen" + - "@ramprasadn" +maintainers: + - "@drpatelh" + - "@flowuenne" + - "@lassefolkersen" + - "@ramprasadn" diff --git a/modules/nf-core/picard/markduplicates/main.nf b/modules/nf-core/picard/markduplicates/main.nf deleted file mode 100644 index be243a95..00000000 --- a/modules/nf-core/picard/markduplicates/main.nf +++ /dev/null @@ -1,61 +0,0 @@ -process PICARD_MARKDUPLICATES { - tag "$meta.id" - label 'process_medium' - - conda "bioconda::picard=3.0.0" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/picard:3.0.0--hdfd78af_1' : - 'quay.io/biocontainers/picard:3.0.0--hdfd78af_1' }" - - input: - tuple val(meta), path(bam) - path fasta - path fai - - output: - tuple val(meta), path("*.bam") , emit: bam - tuple val(meta), path("*.bai") , optional:true, emit: bai - tuple val(meta), path("*.metrics.txt"), emit: metrics - path "versions.yml" , emit: versions - - when: - task.ext.when == null || task.ext.when - - script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - def avail_mem = 3 - if (!task.memory) { - log.info '[Picard MarkDuplicates] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' - } else { - avail_mem = task.memory.giga - } - """ - picard \\ - -Xmx${avail_mem}g \\ - MarkDuplicates \\ - $args \\ - --INPUT $bam \\ - --OUTPUT ${prefix}.bam \\ - --REFERENCE_SEQUENCE $fasta \\ - --METRICS_FILE ${prefix}.MarkDuplicates.metrics.txt - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - picard: \$(echo \$(picard MarkDuplicates --version 2>&1) | grep -o 'Version:.*' | cut -f2- -d:) - END_VERSIONS - """ - - stub: - def prefix = task.ext.prefix ?: "${meta.id}" - """ - touch ${prefix}.bam - touch ${prefix}.bam.bai - touch ${prefix}.MarkDuplicates.metrics.txt - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - picard: \$(echo \$(picard MarkDuplicates --version 2>&1) | grep -o 'Version:.*' | cut -f2- -d:) - END_VERSIONS - """ -} diff --git a/modules/nf-core/picard/markduplicates/meta.yml b/modules/nf-core/picard/markduplicates/meta.yml deleted file mode 100644 index 3f2357bb..00000000 --- a/modules/nf-core/picard/markduplicates/meta.yml +++ /dev/null @@ -1,60 +0,0 @@ -name: picard_markduplicates -description: Locate and tag duplicate reads in a BAM file -keywords: - - markduplicates - - pcr - - duplicates - - bam - - sam - - cram -tools: - - picard: - description: | - A set of command line tools (in Java) for manipulating high-throughput sequencing (HTS) - data and formats such as SAM/BAM/CRAM and VCF. - homepage: https://broadinstitute.github.io/picard/ - documentation: https://broadinstitute.github.io/picard/ - licence: ["MIT"] -input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - bam: - type: file - description: BAM file - pattern: "*.{bam,cram,sam}" - - fasta: - type: file - description: Reference genome fasta file - pattern: "*.{fasta,fa}" - - fai: - type: file - description: Reference genome fasta index - pattern: "*.{fai}" -output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - bam: - type: file - description: BAM file with duplicate reads marked/removed - pattern: "*.{bam}" - - bai: - type: file - description: An optional BAM index file. If desired, --CREATE_INDEX must be passed as a flag - pattern: "*.{bai}" - - metrics: - type: file - description: Duplicate metrics file generated by picard - pattern: "*.{metrics.txt}" - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" -authors: - - "@drpatelh" - - "@projectoriented" diff --git a/modules/nf-core/qualimap/rnaseq/main.nf b/modules/nf-core/qualimap/rnaseq/main.nf deleted file mode 100644 index ad15ebc2..00000000 --- a/modules/nf-core/qualimap/rnaseq/main.nf +++ /dev/null @@ -1,63 +0,0 @@ -process QUALIMAP_RNASEQ { - tag "$meta.id" - label 'process_medium' - - conda "bioconda::qualimap=2.2.2d" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/qualimap:2.2.2d--1' : - 'quay.io/biocontainers/qualimap:2.2.2d--1' }" - - input: - tuple val(meta), path(bam) - path gtf - - output: - tuple val(meta), path("${prefix}"), emit: results - path "versions.yml" , emit: versions - - when: - task.ext.when == null || task.ext.when - - script: - def args = task.ext.args ?: '' - prefix = task.ext.prefix ?: "${meta.id}" - def paired_end = meta.single_end ? '' : '-pe' - def memory = task.memory.toGiga() + "G" - - def strandedness = 'non-strand-specific' - if (meta.strandedness == 'forward') { - strandedness = 'strand-specific-forward' - } else if (meta.strandedness == 'reverse') { - strandedness = 'strand-specific-reverse' - } - """ - unset DISPLAY - mkdir tmp - export _JAVA_OPTIONS=-Djava.io.tmpdir=./tmp - qualimap \\ - --java-mem-size=$memory \\ - rnaseq \\ - $args \\ - -bam $bam \\ - -gtf $gtf \\ - -p $strandedness \\ - $paired_end \\ - -outdir $prefix - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - qualimap: \$(echo \$(qualimap 2>&1) | sed 's/^.*QualiMap v.//; s/Built.*\$//') - END_VERSIONS - """ - - stub: - prefix = task.ext.prefix ?: "${meta.id}" - """ - mkdir ${prefix} - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - qualimap: \$(echo \$(qualimap 2>&1) | sed 's/^.*QualiMap v.//; s/Built.*\$//') - END_VERSIONS - """ -} diff --git a/modules/nf-core/samtools/faidx/environment.yml b/modules/nf-core/samtools/faidx/environment.yml new file mode 100644 index 00000000..73badedb --- /dev/null +++ b/modules/nf-core/samtools/faidx/environment.yml @@ -0,0 +1,7 @@ +name: samtools_faidx +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.17 diff --git a/modules/nf-core/samtools/faidx/main.nf b/modules/nf-core/samtools/faidx/main.nf index ce6580d2..3aa98822 100644 --- a/modules/nf-core/samtools/faidx/main.nf +++ b/modules/nf-core/samtools/faidx/main.nf @@ -2,18 +2,20 @@ process SAMTOOLS_FAIDX { tag "$fasta" label 'process_single' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : + 'biocontainers/samtools:1.17--h00cdaf9_0' }" input: tuple val(meta), path(fasta) + tuple val(meta2), path(fai) output: - tuple val(meta), path ("*.fai"), emit: fai - tuple val(meta), path ("*.gzi"), emit: gzi, optional: true - path "versions.yml" , emit: versions + tuple val(meta), path ("*.{fa,fasta}") , emit: fa , optional: true + tuple val(meta), path ("*.fai") , emit: fai, optional: true + tuple val(meta), path ("*.gzi") , emit: gzi, optional: true + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -23,8 +25,8 @@ process SAMTOOLS_FAIDX { """ samtools \\ faidx \\ - $args \\ - $fasta + $fasta \\ + $args cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -33,8 +35,12 @@ process SAMTOOLS_FAIDX { """ stub: + def match = (task.ext.args =~ /-o(?:utput)?\s(.*)\s?/).findAll() + def fastacmd = match[0] ? "touch ${match[0][1]}" : '' """ + ${fastacmd} touch ${fasta}.fai + cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/faidx/meta.yml b/modules/nf-core/samtools/faidx/meta.yml index fe2fe9a1..e189af28 100644 --- a/modules/nf-core/samtools/faidx/meta.yml +++ b/modules/nf-core/samtools/faidx/meta.yml @@ -3,6 +3,7 @@ description: Index FASTA file keywords: - index - fasta + - faidx tools: - samtools: description: | @@ -17,12 +18,21 @@ input: - meta: type: map description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] + Groovy Map containing reference information + e.g. [ id:'test' ] - fasta: type: file description: FASTA file pattern: "*.{fa,fasta}" + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - fai: + type: file + description: FASTA index file + pattern: "*.{fai}" output: - meta: type: map @@ -45,3 +55,7 @@ authors: - "@drpatelh" - "@ewels" - "@phue" +maintainers: + - "@drpatelh" + - "@ewels" + - "@phue" diff --git a/modules/nf-core/samtools/index/environment.yml b/modules/nf-core/samtools/index/environment.yml new file mode 100644 index 00000000..3c6f95b2 --- /dev/null +++ b/modules/nf-core/samtools/index/environment.yml @@ -0,0 +1,7 @@ +name: samtools_index +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.17 diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf index 8b95687a..256bd7c4 100644 --- a/modules/nf-core/samtools/index/main.nf +++ b/modules/nf-core/samtools/index/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_INDEX { tag "$meta.id" label 'process_low' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : + 'biocontainers/samtools:1.17--h00cdaf9_0' }" input: tuple val(meta), path(input) diff --git a/modules/nf-core/samtools/index/meta.yml b/modules/nf-core/samtools/index/meta.yml index 8bd2fa6f..01a4ee03 100644 --- a/modules/nf-core/samtools/index/meta.yml +++ b/modules/nf-core/samtools/index/meta.yml @@ -51,3 +51,7 @@ authors: - "@drpatelh" - "@ewels" - "@maxulysse" +maintainers: + - "@drpatelh" + - "@ewels" + - "@maxulysse" diff --git a/modules/nf-core/samtools/index/tests/csi.nextflow.config b/modules/nf-core/samtools/index/tests/csi.nextflow.config new file mode 100644 index 00000000..0ed260ef --- /dev/null +++ b/modules/nf-core/samtools/index/tests/csi.nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_INDEX { + ext.args = '-c' + } + +} diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test new file mode 100644 index 00000000..c76a9169 --- /dev/null +++ b/modules/nf-core/samtools/index/tests/main.nf.test @@ -0,0 +1,87 @@ +nextflow_process { + + name "Test Process SAMTOOLS_INDEX" + script "../main.nf" + process "SAMTOOLS_INDEX" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/index" + + test("sarscov2 [BAI]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.bai).match("bai") }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } + + test("homo_sapiens [CRAI]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_recalibrated_sorted_cram'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out.crai).match("crai") }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } + + test("homo_sapiens [CSI]") { + + config "./csi.nextflow.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert path(process.out.csi.get(0).get(1)).exists() }, + { assert path(process.out.versions.get(0)).getText().contains("samtools") } + ) + } + } +} diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap new file mode 100644 index 00000000..b3baee7f --- /dev/null +++ b/modules/nf-core/samtools/index/tests/main.nf.test.snap @@ -0,0 +1,28 @@ +{ + "crai": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ] + ], + "timestamp": "2023-11-15T15:17:37.30801" + }, + "bai": { + "content": [ + [ + [ + { + "id": "test" + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ] + ], + "timestamp": "2023-11-15T15:17:30.869234" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/index/tests/tags.yml b/modules/nf-core/samtools/index/tests/tags.yml new file mode 100644 index 00000000..e0f58a7a --- /dev/null +++ b/modules/nf-core/samtools/index/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/index: + - modules/nf-core/samtools/index/** diff --git a/modules/nf-core/samtools/sort/environment.yml b/modules/nf-core/samtools/sort/environment.yml new file mode 100644 index 00000000..508659f0 --- /dev/null +++ b/modules/nf-core/samtools/sort/environment.yml @@ -0,0 +1,7 @@ +name: samtools_sort +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.17 diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf index 84c167cd..60f0c634 100644 --- a/modules/nf-core/samtools/sort/main.nf +++ b/modules/nf-core/samtools/sort/main.nf @@ -2,10 +2,10 @@ process SAMTOOLS_SORT { tag "$meta.id" label 'process_medium' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : + 'biocontainers/samtools:1.17--h00cdaf9_0' }" input: tuple val(meta), path(bam) @@ -23,7 +23,13 @@ process SAMTOOLS_SORT { def prefix = task.ext.prefix ?: "${meta.id}" if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" """ - samtools sort $args -@ $task.cpus -o ${prefix}.bam -T $prefix $bam + samtools sort \\ + $args \\ + -@ $task.cpus \\ + -o ${prefix}.bam \\ + -T $prefix \\ + $bam + cat <<-END_VERSIONS > versions.yml "${task.process}": samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') diff --git a/modules/nf-core/samtools/sort/meta.yml b/modules/nf-core/samtools/sort/meta.yml index 07328431..2200de72 100644 --- a/modules/nf-core/samtools/sort/meta.yml +++ b/modules/nf-core/samtools/sort/meta.yml @@ -46,3 +46,6 @@ output: authors: - "@drpatelh" - "@ewels" +maintainers: + - "@drpatelh" + - "@ewels" diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test new file mode 100644 index 00000000..1f72f3b9 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/main.nf.test @@ -0,0 +1,70 @@ +nextflow_process { + + name "Test Process SAMTOOLS_SORT" + script "../main.nf" + process "SAMTOOLS_SORT" + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/sort" + + test("test_samtools_sort") { + + config "./nextflow.config" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + [ + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("test_samtools_sort_stub") { + + config "./nextflow.config" + options "-stub-run" + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + [ + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap new file mode 100644 index 00000000..a43566da --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/main.nf.test.snap @@ -0,0 +1,39 @@ +{ + "test_samtools_sort": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,a29570e7607d217c2fa4d75829e09cd7" + ] + ], + "1": [ + + ], + "2": [ + "versions.yml:md5,46f7a36082fa1f68285fe30d689244e8" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,a29570e7607d217c2fa4d75829e09cd7" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,46f7a36082fa1f68285fe30d689244e8" + ] + } + ], + "timestamp": "2023-10-17T17:21:46.5427968" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/sort/tests/nextflow.config b/modules/nf-core/samtools/sort/tests/nextflow.config new file mode 100644 index 00000000..d0f35086 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_SORT { + ext.prefix = { "${meta.id}.sorted" } + } + +} diff --git a/modules/nf-core/samtools/sort/tests/tags.yml b/modules/nf-core/samtools/sort/tests/tags.yml new file mode 100644 index 00000000..cd63ea20 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/tags.yml @@ -0,0 +1,3 @@ +samtools/sort: + - modules/nf-core/samtools/sort/** + - tests/modules/nf-core/samtools/sort/** diff --git a/modules/nf-core/samtools/view/environment.yml b/modules/nf-core/samtools/view/environment.yml new file mode 100644 index 00000000..141e7bd8 --- /dev/null +++ b/modules/nf-core/samtools/view/environment.yml @@ -0,0 +1,7 @@ +name: samtools_view +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::samtools=1.17 diff --git a/modules/nf-core/samtools/view/main.nf b/modules/nf-core/samtools/view/main.nf index 729c85e5..ddf3f88a 100644 --- a/modules/nf-core/samtools/view/main.nf +++ b/modules/nf-core/samtools/view/main.nf @@ -2,14 +2,14 @@ process SAMTOOLS_VIEW { tag "$meta.id" label 'process_low' - conda "bioconda::samtools=1.16.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'quay.io/biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.17--h00cdaf9_0' : + 'biocontainers/samtools:1.17--h00cdaf9_0' }" input: tuple val(meta), path(input), path(index) - path fasta + tuple val(meta2), path(fasta) path qname output: diff --git a/modules/nf-core/samtools/view/meta.yml b/modules/nf-core/samtools/view/meta.yml index 2e597d34..3dadafae 100644 --- a/modules/nf-core/samtools/view/meta.yml +++ b/modules/nf-core/samtools/view/meta.yml @@ -26,12 +26,17 @@ input: description: BAM/CRAM/SAM file pattern: "*.{bam,cram,sam}" - index: - type: optional file - description: BAM.BAI/CRAM.CRAI file - pattern: "*.{.bai,.crai}" + type: file + description: BAM.BAI/BAM.CSI/CRAM.CRAI file (optional) + pattern: "*.{.bai,.csi,.crai}" + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - fasta: - type: optional file - description: Reference file the CRAM was created with + type: file + description: Reference file the CRAM was created with (optional) pattern: "*.{fasta,fa}" - qname: type: file @@ -77,3 +82,8 @@ authors: - "@joseespinosa" - "@FriederikeHanssen" - "@priyanka-surana" +maintainers: + - "@drpatelh" + - "@joseespinosa" + - "@FriederikeHanssen" + - "@priyanka-surana" diff --git a/modules/nf-core/star/align/environment.yml b/modules/nf-core/star/align/environment.yml new file mode 100644 index 00000000..6db20988 --- /dev/null +++ b/modules/nf-core/star/align/environment.yml @@ -0,0 +1,9 @@ +name: star_align +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::star=2.7.10a + - bioconda::samtools=1.16.1 + - conda-forge::gawk=5.1.0 diff --git a/modules/nf-core/star/align/main.nf b/modules/nf-core/star/align/main.nf index 0e3bd713..cc4f5af5 100644 --- a/modules/nf-core/star/align/main.nf +++ b/modules/nf-core/star/align/main.nf @@ -2,33 +2,37 @@ process STAR_ALIGN { tag "$meta.id" label 'process_high' - conda "bioconda::star=2.7.10a bioconda::samtools=1.16.1 conda-forge::gawk=5.1.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1df389393721fc66f3fd8778ad938ac711951107-0' : - 'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1df389393721fc66f3fd8778ad938ac711951107-0' }" + 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:019f262d90511939dce2dca4b7c868fc108f73db-0' : + 'biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:019f262d90511939dce2dca4b7c868fc108f73db-0' }" input: - tuple val(meta), path(reads) - path index - path gtf + tuple val(meta), path(reads, stageAs: "input*/*") + tuple val(meta2), path(index) + tuple val(meta3), path(gtf) val star_ignore_sjdbgtf val seq_platform val seq_center output: - tuple val(meta), path('*d.out.bam') , emit: bam tuple val(meta), path('*Log.final.out') , emit: log_final tuple val(meta), path('*Log.out') , emit: log_out tuple val(meta), path('*Log.progress.out'), emit: log_progress path "versions.yml" , emit: versions + tuple val(meta), path('*d.out.bam') , optional:true, emit: bam tuple val(meta), path('*sortedByCoord.out.bam') , optional:true, emit: bam_sorted tuple val(meta), path('*toTranscriptome.out.bam'), optional:true, emit: bam_transcript tuple val(meta), path('*Aligned.unsort.out.bam') , optional:true, emit: bam_unsorted tuple val(meta), path('*fastq.gz') , optional:true, emit: fastq tuple val(meta), path('*.tab') , optional:true, emit: tab + tuple val(meta), path('*.SJ.out.tab') , optional:true, emit: spl_junc_tab + tuple val(meta), path('*.ReadsPerGene.out.tab') , optional:true, emit: read_per_gene_tab tuple val(meta), path('*.out.junction') , optional:true, emit: junction tuple val(meta), path('*.out.sam') , optional:true, emit: sam + tuple val(meta), path('*.wig') , optional:true, emit: wig + tuple val(meta), path('*.bg') , optional:true, emit: bedgraph when: task.ext.when == null || task.ext.when @@ -36,20 +40,23 @@ process STAR_ALIGN { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" + def reads1 = [], reads2 = [] + meta.single_end ? [reads].flatten().each{reads1 << it} : reads.eachWithIndex{ v, ix -> ( ix & 1 ? reads2 : reads1) << v } def ignore_gtf = star_ignore_sjdbgtf ? '' : "--sjdbGTFfile $gtf" def seq_platform = seq_platform ? "'PL:$seq_platform'" : "" - def seq_center = seq_center ? "--outSAMattrRGline ID:$prefix 'CN:$seq_center' 'SM:$prefix' $seq_platform " : "--outSAMattrRGline ID:$prefix 'SM:$prefix' $seq_platform " + def seq_center = seq_center ? "'CN:$seq_center'" : "" + def attrRG = args.contains("--outSAMattrRGline") ? "" : "--outSAMattrRGline 'ID:$prefix' $seq_center 'SM:$prefix' $seq_platform" def out_sam_type = (args.contains('--outSAMtype')) ? '' : '--outSAMtype BAM Unsorted' def mv_unsorted_bam = (args.contains('--outSAMtype BAM Unsorted SortedByCoordinate')) ? "mv ${prefix}.Aligned.out.bam ${prefix}.Aligned.unsort.out.bam" : '' """ STAR \\ --genomeDir $index \\ - --readFilesIn $reads \\ + --readFilesIn ${reads1.join(",")} ${reads2.join(",")} \\ --runThreadN $task.cpus \\ --outFileNamePrefix $prefix. \\ $out_sam_type \\ $ignore_gtf \\ - $seq_center \\ + $attrRG \\ $args $mv_unsorted_bam @@ -81,11 +88,16 @@ process STAR_ALIGN { touch ${prefix}.sortedByCoord.out.bam touch ${prefix}.toTranscriptome.out.bam touch ${prefix}.Aligned.unsort.out.bam + touch ${prefix}.Aligned.sortedByCoord.out.bam touch ${prefix}.unmapped_1.fastq.gz touch ${prefix}.unmapped_2.fastq.gz touch ${prefix}.tab + touch ${prefix}.SJ.out.tab + touch ${prefix}.ReadsPerGene.out.tab touch ${prefix}.Chimeric.out.junction touch ${prefix}.out.sam + touch ${prefix}.Signal.UniqueMultiple.str1.out.wig + touch ${prefix}.Signal.UniqueMultiple.str1.out.bg cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/star/align/meta.yml b/modules/nf-core/star/align/meta.yml index 7ee10f1c..e80dbb7d 100644 --- a/modules/nf-core/star/align/meta.yml +++ b/modules/nf-core/star/align/meta.yml @@ -25,10 +25,33 @@ input: description: | List of input FastQ files of size 1 and 2 for single-end and paired-end data, respectively. + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - index: type: directory description: STAR genome index pattern: "star" + - meta3: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - gtf: + type: file + description: Annotation GTF file + pattern: "*.{gtf}" + - star_ignore_sjdbgtf: + type: boolean + description: Ignore annotation GTF file + - seq_platform: + type: string + description: Sequencing platform + - seq_center: + type: string + description: Sequencing center output: - bam: type: file @@ -74,8 +97,19 @@ output: type: file description: STAR chimeric junction output file (optional) pattern: "*.out.junction" - + - wig: + type: file + description: STAR output wiggle format file(s) (optional) + pattern: "*.wig" + - bedgraph: + type: file + description: STAR output bedGraph format file(s) (optional) + pattern: "*.bg" authors: - "@kevinmenden" - "@drpatelh" - "@praveenraj2018" +maintainers: + - "@kevinmenden" + - "@drpatelh" + - "@praveenraj2018" diff --git a/modules/nf-core/star/align/tests/main.nf.test b/modules/nf-core/star/align/tests/main.nf.test new file mode 100644 index 00000000..4c878474 --- /dev/null +++ b/modules/nf-core/star/align/tests/main.nf.test @@ -0,0 +1,339 @@ +nextflow_process { + + name "Test Process STAR_ALIGN" + script "../main.nf" + process "STAR_ALIGN" + tag "modules" + tag "modules_nfcore" + tag "star" + tag "star/align" + + test("homo_sapiens - single_end") { + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_1_fastq_gz'], checkIfExists: true) ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - single_end - log_final") }, + { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - single_end - log_out") }, + { assert snapshot(process.out.bam).match("homo_sapiens - single_end - bam") }, + { assert snapshot(process.out.bam_sorted).match("homo_sapiens - single_end - bam_sorted") }, + { assert snapshot(process.out.bam_transcript).match("homo_sapiens - single_end - bam_transcript") }, + { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - single_end - bam_unsorted") }, + { assert snapshot(process.out.bedgraph).match("homo_sapiens - single_end - bedgraph") }, + { assert snapshot(process.out.fastq).match("homo_sapiens - single_end - fastq") }, + { assert snapshot(process.out.junction).match("homo_sapiens - single_end - junction") }, + { assert snapshot(process.out.log_progress).match("homo_sapiens - single_end - log_progress") }, + { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - single_end - read_per_gene_tab") }, + { assert snapshot(process.out.sam).match("homo_sapiens - single_end - sam") }, + { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - single_end - spl_junc_tab") }, + { assert snapshot(process.out.tab).match("homo_sapiens - single_end - tab") }, + { assert snapshot(process.out.wig).match("homo_sapiens - single_end - wig") }, + { assert snapshot(process.out.versions).match("homo_sapiens - single_end - versions") } + ) + } + } + + test("homo_sapiens - paired_end") { + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_1_fastq_gz'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_2_fastq_gz'], checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - log_final") }, + { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - log_out") }, + { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - bam") }, + { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - bam_sorted") }, + { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - bam_transcript") }, + { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - bam_unsorted") }, + { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - bedgraph") }, + { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - fastq") }, + { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - junction") }, + { assert snapshot(process.out.log_progress).match("homo_sapiens - paired_end - log_progress") }, + { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - read_per_gene_tab") }, + { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - sam") }, + { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - spl_junc_tab") }, + { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - tab") }, + { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - wig") }, + { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - versions") } + ) + } + } + + test("homo_sapiens - paired_end - arriba") { + config "./nextflow.arriba.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_1_fastq_gz'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_2_fastq_gz'], checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - arriba - log_final") }, + { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - arriba - log_out") }, + { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - arriba - log_progress") }, + { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - arriba - bam") }, + { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - arriba - bam_sorted") }, + { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - arriba - bam_transcript") }, + { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - arriba - bam_unsorted") }, + { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - arriba - bedgraph") }, + { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - arriba - fastq") }, + { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - arriba - junction") }, + { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - arriba - read_per_gene_tab") }, + { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - arriba - sam") }, + { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - arriba - spl_junc_tab") }, + { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - arriba - tab") }, + { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - arriba - wig") }, + { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - arriba - versions") } + ) + } + } + + test("homo_sapiens - paired_end - starfusion") { + config "./nextflow.starfusion.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_1_fastq_gz'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_2_fastq_gz'], checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_final") }, + { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_out") }, + { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_progress") }, + { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - starfusion - bam") }, + { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - starfusion - bam_sorted") }, + { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - starfusion - bam_transcript") }, + { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - starfusion - bam_unsorted") }, + { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - starfusion - bedgraph") }, + { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - starfusion - fastq") }, + { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - starfusion - junction") }, + { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - starfusion - read_per_gene_tab") }, + { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - starfusion - sam") }, + { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - starfusion - spl_junc_tab") }, + { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - starfusion - tab") }, + { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - starfusion - wig") }, + { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - starfusion - versions") } + ) + } + } + + test("homo_sapiens - paired_end - multiple") { + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_1_fastq_gz'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_2_fastq_gz'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_1_fastq_gz'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_rnaseq_2_fastq_gz'], checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - multiple - log_final") }, + { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - multiple - log_out") }, + { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - multiple - log_progress") }, + { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - multiple - bam") }, + { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - multiple - bam_sorted") }, + { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - multiple - bam_transcript") }, + { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - multiple - bam_unsorted") }, + { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - multiple - bedgraph") }, + { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - multiple - fastq") }, + { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - multiple - junction") }, + { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - multiple - read_per_gene_tab") }, + { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - multiple - sam") }, + { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - multiple - spl_junc_tab") }, + { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - multiple - tab") }, + { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - multiple - wig") }, + { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - multiple - versions") } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/star/align/tests/main.nf.test.snap b/modules/nf-core/star/align/tests/main.nf.test.snap new file mode 100644 index 00000000..59b735d4 --- /dev/null +++ b/modules/nf-core/star/align/tests/main.nf.test.snap @@ -0,0 +1,769 @@ +{ + "homo_sapiens - paired_end - multiple - bam_sorted": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,ab07c21d63ab0a6c07d171d213c81d5a" + ] + ] + ], + "timestamp": "2023-11-23T13:29:01.19639" + }, + "homo_sapiens - paired_end - multiple - wig": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:29:01.857804" + }, + "homo_sapiens - paired_end - arriba - tab": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c" + ] + ] + ], + "timestamp": "2023-11-23T13:25:07.396223" + }, + "homo_sapiens - single_end - wig": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:22:55.24701" + }, + "homo_sapiens - paired_end - sam": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:23:33.383818" + }, + "homo_sapiens - paired_end - arriba - versions": { + "content": [ + [ + "versions.yml:md5,452ef035aacbc68d47041e86279a9333" + ] + ], + "timestamp": "2023-11-23T13:25:07.494015" + }, + "homo_sapiens - paired_end - multiple - bedgraph": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a", + "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6" + ] + ] + ] + ], + "timestamp": "2023-11-23T13:29:01.396383" + }, + "homo_sapiens - paired_end - read_per_gene_tab": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:23:33.368841" + }, + "homo_sapiens - paired_end - arriba - bedgraph": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:25:07.102537" + }, + "homo_sapiens - single_end - junction": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:22:55.185369" + }, + "homo_sapiens - paired_end - arriba - spl_junc_tab": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c" + ] + ] + ], + "timestamp": "2023-11-23T13:25:07.348239" + }, + "homo_sapiens - single_end - sam": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:22:55.216183" + }, + "homo_sapiens - paired_end - fastq": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:23:33.327236" + }, + "homo_sapiens - single_end - versions": { + "content": [ + [ + "versions.yml:md5,452ef035aacbc68d47041e86279a9333" + ] + ], + "timestamp": "2023-11-23T13:22:55.259282" + }, + "homo_sapiens - paired_end - multiple - log_out": { + "content": [ + "test.Log.out" + ], + "timestamp": "2023-11-23T13:29:01.022176" + }, + "homo_sapiens - paired_end - arriba - fastq": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:25:07.15277" + }, + "homo_sapiens - paired_end - multiple - junction": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:29:01.52923" + }, + "homo_sapiens - paired_end - multiple - spl_junc_tab": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2" + ] + ] + ], + "timestamp": "2023-11-23T13:29:01.729175" + }, + "homo_sapiens - paired_end - starfusion - log_final": { + "content": [ + "test.Log.final.out" + ], + "timestamp": "2023-11-23T13:27:55.905883" + }, + "homo_sapiens - paired_end - starfusion - fastq": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:27:56.192302" + }, + "homo_sapiens - paired_end - multiple - sam": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:29:01.661837" + }, + "homo_sapiens - paired_end - multiple - log_final": { + "content": [ + "test.Log.final.out" + ], + "timestamp": "2023-11-23T13:29:00.966417" + }, + "homo_sapiens - paired_end - starfusion - bam": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.out.bam:md5,bcad07b838f6762fc01eea52b5cd3f84" + ] + ] + ], + "timestamp": "2023-11-23T13:27:56.003675" + }, + "homo_sapiens - paired_end - arriba - junction": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:25:07.202776" + }, + "homo_sapiens - single_end - bedgraph": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Signal.Unique.str1.out.bg:md5,c56fc1472776fb927eaf62d973da5f9a", + "test.Signal.UniqueMultiple.str1.out.bg:md5,e93373cf6f2a2a9506e2efdb260cdd4f" + ] + ] + ] + ], + "timestamp": "2023-11-23T13:22:55.163495" + }, + "homo_sapiens - paired_end - arriba - read_per_gene_tab": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:25:07.251962" + }, + "homo_sapiens - paired_end - starfusion - bam_sorted": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:27:56.040843" + }, + "homo_sapiens - single_end - bam_unsorted": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:22:55.154172" + }, + "homo_sapiens - paired_end - bam": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f" + ] + ] + ], + "timestamp": "2023-11-23T13:23:33.265265" + }, + "homo_sapiens - paired_end - arriba - bam_transcript": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:25:06.998817" + }, + "homo_sapiens - paired_end - log_out": { + "content": [ + "test.Log.out" + ], + "timestamp": "2023-11-23T13:23:33.259699" + }, + "homo_sapiens - paired_end - arriba - log_out": { + "content": [ + "test.Log.out" + ], + "timestamp": "2023-11-23T13:25:06.849451" + }, + "homo_sapiens - paired_end - multiple - versions": { + "content": [ + [ + "versions.yml:md5,452ef035aacbc68d47041e86279a9333" + ] + ], + "timestamp": "2023-11-23T13:29:01.937182" + }, + "homo_sapiens - paired_end - starfusion - bam_transcript": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:27:56.082408" + }, + "homo_sapiens - paired_end - starfusion - tab": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a" + ] + ] + ], + "timestamp": "2023-11-23T13:27:56.379367" + }, + "homo_sapiens - single_end - fastq": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:22:55.175307" + }, + "homo_sapiens - paired_end - tab": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" + ] + ] + ], + "timestamp": "2023-11-23T13:23:33.413683" + }, + "homo_sapiens - paired_end - starfusion - bedgraph": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:27:56.155413" + }, + "homo_sapiens - single_end - bam_transcript": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:22:55.144852" + }, + "homo_sapiens - paired_end - versions": { + "content": [ + [ + "versions.yml:md5,452ef035aacbc68d47041e86279a9333" + ] + ], + "timestamp": "2023-11-23T13:23:33.445323" + }, + "homo_sapiens - paired_end - multiple - tab": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2" + ] + ] + ], + "timestamp": "2023-11-23T13:29:01.793129" + }, + "homo_sapiens - single_end - bam": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.sortedByCoord.out.bam:md5,c6cfaccaf91bc7fdabed3cfe236d4535" + ] + ] + ], + "timestamp": "2023-11-23T13:22:55.128568" + }, + "homo_sapiens - paired_end - arriba - wig": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:25:07.444214" + }, + "homo_sapiens - paired_end - log_progress": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8" + ] + ] + ], + "timestamp": "2023-11-23T13:23:33.354416" + }, + "homo_sapiens - paired_end - arriba - log_final": { + "content": [ + "test.Log.final.out" + ], + "timestamp": "2023-11-23T13:25:06.829799" + }, + "homo_sapiens - paired_end - bam_unsorted": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:23:33.300509" + }, + "homo_sapiens - paired_end - arriba - sam": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:25:07.300383" + }, + "homo_sapiens - paired_end - multiple - bam": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,ab07c21d63ab0a6c07d171d213c81d5a" + ] + ] + ], + "timestamp": "2023-11-23T13:29:01.13168" + }, + "homo_sapiens - paired_end - multiple - fastq": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:29:01.462257" + }, + "homo_sapiens - single_end - bam_sorted": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.sortedByCoord.out.bam:md5,c6cfaccaf91bc7fdabed3cfe236d4535" + ] + ] + ], + "timestamp": "2023-11-23T13:22:55.134799" + }, + "homo_sapiens - paired_end - arriba - bam_sorted": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:25:06.94699" + }, + "homo_sapiens - paired_end - starfusion - junction": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,c10ef219f4a30e83711b995bc5e40dba" + ] + ] + ], + "timestamp": "2023-11-23T13:27:56.228327" + }, + "homo_sapiens - single_end - tab": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c" + ] + ] + ], + "timestamp": "2023-11-23T13:22:55.236346" + }, + "homo_sapiens - paired_end - starfusion - versions": { + "content": [ + [ + "versions.yml:md5,452ef035aacbc68d47041e86279a9333" + ] + ], + "timestamp": "2023-11-23T13:27:56.460903" + }, + "homo_sapiens - paired_end - multiple - bam_unsorted": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:29:01.330463" + }, + "homo_sapiens - paired_end - arriba - log_progress": { + "content": [ + "test.Log.progress.out" + ], + "timestamp": "2023-11-23T13:25:06.86866" + }, + "homo_sapiens - paired_end - bedgraph": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a", + "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6" + ] + ] + ] + ], + "timestamp": "2023-11-23T13:23:33.313258" + }, + "homo_sapiens - paired_end - starfusion - bam_unsorted": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:27:56.118974" + }, + "homo_sapiens - paired_end - starfusion - read_per_gene_tab": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:27:56.264699" + }, + "homo_sapiens - paired_end - multiple - log_progress": { + "content": [ + "test.Log.progress.out" + ], + "timestamp": "2023-11-23T13:29:01.076947" + }, + "homo_sapiens - paired_end - arriba - bam_unsorted": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:25:07.050409" + }, + "homo_sapiens - paired_end - bam_sorted": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f" + ] + ] + ], + "timestamp": "2023-11-23T13:23:33.274809" + }, + "homo_sapiens - single_end - spl_junc_tab": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c" + ] + ] + ], + "timestamp": "2023-11-23T13:22:55.226143" + }, + "homo_sapiens - paired_end - starfusion - spl_junc_tab": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a" + ] + ] + ], + "timestamp": "2023-11-23T13:27:56.337072" + }, + "homo_sapiens - single_end - log_out": { + "content": [ + "test.Log.out" + ], + "timestamp": "2023-11-23T13:22:55.126286" + }, + "homo_sapiens - paired_end - log_final": { + "content": [ + "test.Log.final.out" + ], + "timestamp": "2023-11-23T13:23:33.253884" + }, + "homo_sapiens - single_end - log_final": { + "content": [ + "test.Log.final.out" + ], + "timestamp": "2023-11-23T13:22:55.11799" + }, + "homo_sapiens - paired_end - bam_transcript": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:23:33.287684" + }, + "homo_sapiens - paired_end - starfusion - log_progress": { + "content": [ + "test.Log.progress.out" + ], + "timestamp": "2023-11-23T13:27:55.971484" + }, + "homo_sapiens - paired_end - multiple - bam_transcript": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:29:01.264176" + }, + "homo_sapiens - paired_end - multiple - read_per_gene_tab": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:29:01.596406" + }, + "homo_sapiens - single_end - read_per_gene_tab": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:22:55.205936" + }, + "homo_sapiens - paired_end - junction": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:23:33.340653" + }, + "homo_sapiens - paired_end - spl_junc_tab": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" + ] + ] + ], + "timestamp": "2023-11-23T13:23:33.398603" + }, + "homo_sapiens - paired_end - starfusion - sam": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:27:56.300637" + }, + "homo_sapiens - paired_end - arriba - bam": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.out.bam:md5,c1b1747f5873f2d17762725636e891d5" + ] + ] + ], + "timestamp": "2023-11-23T13:25:06.887604" + }, + "homo_sapiens - single_end - log_progress": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8" + ] + ] + ], + "timestamp": "2023-11-23T13:22:55.195544" + }, + "homo_sapiens - paired_end - starfusion - wig": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:27:56.422018" + }, + "homo_sapiens - paired_end - wig": { + "content": [ + [ + + ] + ], + "timestamp": "2023-11-23T13:23:33.429457" + }, + "homo_sapiens - paired_end - starfusion - log_out": { + "content": [ + "test.Log.out" + ], + "timestamp": "2023-11-23T13:27:55.93945" + } +} \ No newline at end of file diff --git a/modules/nf-core/star/align/tests/nextflow.arriba.config b/modules/nf-core/star/align/tests/nextflow.arriba.config new file mode 100644 index 00000000..2324b9e5 --- /dev/null +++ b/modules/nf-core/star/align/tests/nextflow.arriba.config @@ -0,0 +1,14 @@ +process { + + withName: STAR_GENOMEGENERATE { + ext.args = '--genomeSAindexNbases 9' + } + + withName: STAR_ALIGN { + ext.args = '--readFilesCommand zcat --outSAMtype BAM Unsorted --outSAMunmapped Within --outBAMcompression 0 --outFilterMultimapNmax 50 --peOverlapNbasesMin 10 --alignSplicedMateMapLminOverLmate 0.5 --alignSJstitchMismatchNmax 5 -1 5 5 --chimSegmentMin 10 --chimOutType WithinBAM HardClip --chimJunctionOverhangMin 10 --chimScoreDropMax 30 --chimScoreJunctionNonGTAG 0 --chimScoreSeparation 1 --chimSegmentReadGapMax 3 --chimMultimapNmax 50' + } + +} + +// Fix chown issue for the output star folder +docker.runOptions = '--platform=linux/amd64 -u $(id -u):$(id -g)' diff --git a/modules/nf-core/star/align/tests/nextflow.config b/modules/nf-core/star/align/tests/nextflow.config new file mode 100644 index 00000000..c4ac5808 --- /dev/null +++ b/modules/nf-core/star/align/tests/nextflow.config @@ -0,0 +1,14 @@ +process { + + withName: STAR_GENOMEGENERATE { + ext.args = '--genomeSAindexNbases 9' + } + + withName: STAR_ALIGN { + ext.args = '--readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --outWigType bedGraph --outWigStrand Unstranded' + } + +} + +// Fix chown issue for the output star folder +docker.runOptions = '--platform=linux/amd64 -u $(id -u):$(id -g)' diff --git a/modules/nf-core/star/align/tests/nextflow.starfusion.config b/modules/nf-core/star/align/tests/nextflow.starfusion.config new file mode 100644 index 00000000..467b6497 --- /dev/null +++ b/modules/nf-core/star/align/tests/nextflow.starfusion.config @@ -0,0 +1,14 @@ +process { + + withName: STAR_GENOMEGENERATE { + ext.args = '--genomeSAindexNbases 9' + } + + withName: STAR_ALIGN { + ext.args = '--readFilesCommand zcat --outSAMtype BAM Unsorted --outReadsUnmapped None --twopassMode Basic --outSAMstrandField intronMotif --outSAMunmapped Within --chimSegmentMin 12 --chimJunctionOverhangMin 8 --chimOutJunctionFormat 1 --alignSJDBoverhangMin 10 --alignMatesGapMax 100000 --alignIntronMax 100000 --alignSJstitchMismatchNmax 5 -1 5 5 --chimMultimapScoreRange 3 --chimScoreJunctionNonGTAG -4 --chimMultimapNmax 20 --chimNonchimScoreDropMin 10 --peOverlapNbasesMin 12 --peOverlapMMp 0.1 --alignInsertionFlush Right --alignSplicedMateMapLminOverLmate 0 --alignSplicedMateMapLmin 30' + } + +} + +// Fix chown issue for the output star folder +docker.runOptions = '--platform=linux/amd64 -u $(id -u):$(id -g)' diff --git a/modules/nf-core/star/align/tests/tags.yml b/modules/nf-core/star/align/tests/tags.yml new file mode 100644 index 00000000..8beace16 --- /dev/null +++ b/modules/nf-core/star/align/tests/tags.yml @@ -0,0 +1,2 @@ +star/align: + - modules/nf-core/star/align/** diff --git a/modules/nf-core/star/genomegenerate/environment.yml b/modules/nf-core/star/genomegenerate/environment.yml new file mode 100644 index 00000000..0b35ff51 --- /dev/null +++ b/modules/nf-core/star/genomegenerate/environment.yml @@ -0,0 +1,9 @@ +name: star_genomegenerate +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::star=2.7.10a + - bioconda::samtools=1.16.1 + - conda-forge::gawk=5.1.0 diff --git a/modules/nf-core/star/genomegenerate/main.nf b/modules/nf-core/star/genomegenerate/main.nf index 91462489..d2061844 100644 --- a/modules/nf-core/star/genomegenerate/main.nf +++ b/modules/nf-core/star/genomegenerate/main.nf @@ -2,18 +2,18 @@ process STAR_GENOMEGENERATE { tag "$fasta" label 'process_high' - conda "bioconda::star=2.7.10a bioconda::samtools=1.16.1 conda-forge::gawk=5.1.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1df389393721fc66f3fd8778ad938ac711951107-0' : - 'quay.io/biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1df389393721fc66f3fd8778ad938ac711951107-0' }" + 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:019f262d90511939dce2dca4b7c868fc108f73db-0' : + 'biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:019f262d90511939dce2dca4b7c868fc108f73db-0' }" input: - path fasta - path gtf + tuple val(meta), path(fasta) + tuple val(meta2), path(gtf) output: - path "star" , emit: index - path "versions.yml", emit: versions + tuple val(meta), path("star") , emit: index + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when diff --git a/modules/nf-core/star/genomegenerate/meta.yml b/modules/nf-core/star/genomegenerate/meta.yml index 8181157a..1061e1b8 100644 --- a/modules/nf-core/star/genomegenerate/meta.yml +++ b/modules/nf-core/star/genomegenerate/meta.yml @@ -15,14 +15,28 @@ tools: doi: 10.1093/bioinformatics/bts635 licence: ["MIT"] input: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] - fasta: type: file description: Fasta file of the reference genome + - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] - gtf: type: file description: GTF file of the reference genome - output: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] - index: type: directory description: Folder containing the star index files @@ -31,7 +45,9 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@kevinmenden" - "@drpatelh" +maintainers: + - "@kevinmenden" + - "@drpatelh" diff --git a/modules/nf-core/star/genomegenerate/tests/main.nf.test b/modules/nf-core/star/genomegenerate/tests/main.nf.test new file mode 100644 index 00000000..eed82926 --- /dev/null +++ b/modules/nf-core/star/genomegenerate/tests/main.nf.test @@ -0,0 +1,38 @@ +nextflow_process { + + name "Test Process STAR_GENOMEGENERATE" + script "../main.nf" + process "STAR_GENOMEGENERATE" + tag "modules" + tag "modules_nfcore" + tag "star" + tag "star/genomegenerate" + + test("homo_sapiens") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true)] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.index[0][1]).name).match("index") }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap b/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap new file mode 100644 index 00000000..bd4e0caa --- /dev/null +++ b/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap @@ -0,0 +1,16 @@ +{ + "versions": { + "content": [ + [ + "versions.yml:md5,9c11319b80fdedc90dadce4e0fb42ded" + ] + ], + "timestamp": "2023-11-23T11:18:14.835118" + }, + "index": { + "content": [ + "star" + ], + "timestamp": "2023-11-23T11:31:47.560528" + } +} \ No newline at end of file diff --git a/modules/nf-core/star/genomegenerate/tests/tags.yml b/modules/nf-core/star/genomegenerate/tests/tags.yml new file mode 100644 index 00000000..79f619bf --- /dev/null +++ b/modules/nf-core/star/genomegenerate/tests/tags.yml @@ -0,0 +1,2 @@ +star/genomegenerate: + - modules/nf-core/star/genomegenerate/** diff --git a/modules/nf-core/stringtie/merge/environment.yml b/modules/nf-core/stringtie/merge/environment.yml new file mode 100644 index 00000000..9914b202 --- /dev/null +++ b/modules/nf-core/stringtie/merge/environment.yml @@ -0,0 +1,7 @@ +name: stringtie_merge +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::stringtie=2.2.1 diff --git a/modules/nf-core/stringtie/merge/main.nf b/modules/nf-core/stringtie/merge/main.nf index f1635afc..c2568219 100644 --- a/modules/nf-core/stringtie/merge/main.nf +++ b/modules/nf-core/stringtie/merge/main.nf @@ -2,10 +2,10 @@ process STRINGTIE_MERGE { label 'process_medium' // Note: 2.7X indices incompatible with AWS iGenomes. - conda "bioconda::stringtie=2.2.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/stringtie:2.2.1--hecb563c_2' : - 'quay.io/biocontainers/stringtie:2.2.1--hecb563c_2' }" + 'biocontainers/stringtie:2.2.1--hecb563c_2' }" input: path stringtie_gtf diff --git a/modules/nf-core/stringtie/merge/meta.yml b/modules/nf-core/stringtie/merge/meta.yml index 2e9784fe..5d02d678 100644 --- a/modules/nf-core/stringtie/merge/meta.yml +++ b/modules/nf-core/stringtie/merge/meta.yml @@ -32,6 +32,7 @@ output: type: file description: File containing software versions pattern: "versions.yml" - authors: - "@yuukiiwa" +maintainers: + - "@yuukiiwa" diff --git a/modules/nf-core/stringtie/merge/tests/main.nf.test b/modules/nf-core/stringtie/merge/tests/main.nf.test new file mode 100644 index 00000000..90368134 --- /dev/null +++ b/modules/nf-core/stringtie/merge/tests/main.nf.test @@ -0,0 +1,82 @@ +nextflow_process { + + name "Test Process STRINGTIE_MERGE" + script "../main.nf" + process "STRINGTIE_MERGE" + tag "modules" + tag "modules_nfcore" + tag "stringtie" + tag "stringtie/merge" + + test("homo_sapiens - forward strandedness") { + + setup { + run("STRINGTIE_STRINGTIE") { + script "../../stringtie/main.nf" + process { + """ + input[0] = [ + [ id:'test', strandedness:'forward' ], // meta map + [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ] + ] + input[1] = file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true) + """ + } + } + + } + + when { + process { + """ + input[0] = STRINGTIE_STRINGTIE.out.transcript_gtf.map { it -> it[1] } + input[1] = file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.gtf).match("fs_gtf") }, + { assert snapshot(process.out.versions).match("fs_versions") } + ) + } + } + + test("homo_sapiens - reverse strandedness") { + + setup { + run("STRINGTIE_STRINGTIE") { + script "../../stringtie/main.nf" + process { + """ + input[0] = [ + [ id:'test', strandedness:'reverse' ], // meta map + [ file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ] + ] + input[1] = file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true) + """ + } + } + + } + + when { + process { + """ + input[0] = STRINGTIE_STRINGTIE.out.transcript_gtf.map { it -> it[1] } + input[1] = file(params.test_data['homo_sapiens']['genome']['genome_gtf'], checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.gtf).match("rs_gtf") }, + { assert snapshot(process.out.versions).match("rs_versions") } + ) + } + } +} diff --git a/modules/nf-core/stringtie/merge/tests/main.nf.test.snap b/modules/nf-core/stringtie/merge/tests/main.nf.test.snap new file mode 100644 index 00000000..3e4bc68f --- /dev/null +++ b/modules/nf-core/stringtie/merge/tests/main.nf.test.snap @@ -0,0 +1,34 @@ +{ + "rs_versions": { + "content": [ + [ + "versions.yml:md5,b73d45fdebf4c8c446bb01817db1665d" + ] + ], + "timestamp": "2023-11-23T14:14:39.697712988" + }, + "rs_gtf": { + "content": [ + [ + "stringtie.merged.gtf:md5,6da479298d73d5b3216d4e1576a2bdf4" + ] + ], + "timestamp": "2023-11-23T14:14:39.691894799" + }, + "fs_gtf": { + "content": [ + [ + "stringtie.merged.gtf:md5,d959eb2fab0db48ded7275e0a2e83c05" + ] + ], + "timestamp": "2023-11-23T14:14:20.872841278" + }, + "fs_versions": { + "content": [ + [ + "versions.yml:md5,b73d45fdebf4c8c446bb01817db1665d" + ] + ], + "timestamp": "2023-11-23T14:14:20.883140097" + } +} \ No newline at end of file diff --git a/modules/nf-core/stringtie/merge/tests/tags.yml b/modules/nf-core/stringtie/merge/tests/tags.yml new file mode 100644 index 00000000..58cef46b --- /dev/null +++ b/modules/nf-core/stringtie/merge/tests/tags.yml @@ -0,0 +1,2 @@ +stringtie/merge: + - modules/nf-core/stringtie/merge/** diff --git a/modules/nf-core/stringtie/stringtie/environment.yml b/modules/nf-core/stringtie/stringtie/environment.yml new file mode 100644 index 00000000..7a0eccdb --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/environment.yml @@ -0,0 +1,7 @@ +name: stringtie_stringtie +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bioconda::stringtie=2.2.1 diff --git a/modules/nf-core/stringtie/stringtie/main.nf b/modules/nf-core/stringtie/stringtie/main.nf index 2d5b035f..6e25ba27 100644 --- a/modules/nf-core/stringtie/stringtie/main.nf +++ b/modules/nf-core/stringtie/stringtie/main.nf @@ -2,10 +2,10 @@ process STRINGTIE_STRINGTIE { tag "$meta.id" label 'process_medium' - conda "bioconda::stringtie=2.2.1" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/stringtie:2.2.1--hecb563c_2' : - 'quay.io/biocontainers/stringtie:2.2.1--hecb563c_2' }" + 'biocontainers/stringtie:2.2.1--hecb563c_2' }" input: tuple val(meta), path(bam) diff --git a/modules/nf-core/stringtie/stringtie/meta.yml b/modules/nf-core/stringtie/stringtie/meta.yml index 75518470..d8ebdd88 100644 --- a/modules/nf-core/stringtie/stringtie/meta.yml +++ b/modules/nf-core/stringtie/stringtie/meta.yml @@ -5,7 +5,6 @@ keywords: - assembly - quantification - gtf - tools: - stringtie2: description: | @@ -55,3 +54,5 @@ output: pattern: "versions.yml" authors: - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/modules/nf-core/stringtie/stringtie/tests/main.nf.test b/modules/nf-core/stringtie/stringtie/tests/main.nf.test new file mode 100644 index 00000000..68786b74 --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/tests/main.nf.test @@ -0,0 +1,108 @@ +nextflow_process { + + name "Test Process STRINGTIE_STRINGTIE" + script "../main.nf" + process "STRINGTIE_STRINGTIE" + tag "modules" + tag "modules_nfcore" + tag "stringtie" + tag "stringtie/stringtie" + + test("sarscov2 [bam] - forward strandedness") { + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'forward' ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.transcript_gtf).match("fs_transcript_gtf") }, + { assert snapshot(process.out.abundance).match("fs_abundance") }, + { assert snapshot(process.out.versions).match("fs_versions") } + ) + } + } + + test("sarscov2 [bam] - forward strandedness + reference annotation") { + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'forward' ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ] + ] + input[1] = file(params.test_data['sarscov2']['genome']['genome_gtf'], checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.transcript_gtf).match("fs_gtf_transcript_gtf") }, + { assert snapshot(process.out.abundance).match("fs_gtf_abundance") }, + { assert snapshot(process.out.ballgown).match("fs_gtf_ballgown") }, + { assert snapshot(process.out.versions).match("fs_gtf_versions") } + ) + } + } + + test("sarscov2 [bam] - reverse strandedness") { + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'reverse' ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.transcript_gtf).match("rs_transcript_gtf") }, + { assert snapshot(process.out.abundance).match("rs_abundance") }, + { assert snapshot(process.out.versions).match("rs_versions") } + ) + } + } + + test("sarscov2 [bam] - reverse strandedness + reference annotation") { + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'reverse' ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) ] + ] + input[1] = file(params.test_data['sarscov2']['genome']['genome_gtf'], checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.transcript_gtf).match("rs_gtf_transcript_gtf") }, + { assert snapshot(process.out.abundance).match("rs_gtf_abundance") }, + { assert snapshot(process.out.ballgown).match("rs_gtf_ballgown") }, + { assert snapshot(process.out.versions).match("rs_gtf_versions") } + ) + } + } +} diff --git a/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap b/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap new file mode 100644 index 00000000..bf751636 --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap @@ -0,0 +1,186 @@ +{ + "fs_abundance": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3" + ] + ] + ], + "timestamp": "2023-11-23T13:55:41.032044613" + }, + "fs_transcript_gtf": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,569137af5be452413086b50653a97203" + ] + ] + ], + "timestamp": "2023-11-23T13:55:41.017978904" + }, + "rs_abundance": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3" + ] + ] + ], + "timestamp": "2023-11-23T13:56:13.601112933" + }, + "fs_gtf_versions": { + "content": [ + [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ] + ], + "timestamp": "2023-11-23T13:56:00.523797974" + }, + "fs_gtf_transcript_gtf": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,f56cf8aba2c4a5673bc7963ba5f12d04" + ] + ] + ], + "timestamp": "2023-11-23T13:56:00.475164879" + }, + "rs_versions": { + "content": [ + [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ] + ], + "timestamp": "2023-11-23T13:56:13.623892691" + }, + "rs_gtf_transcript_gtf": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,bb346053a8c156b803b055133376c7fa" + ] + ] + ], + "timestamp": "2023-11-23T13:56:22.693599559" + }, + "fs_gtf_abundance": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,7d8bce7f2a922e367cedccae7267c22e" + ] + ] + ], + "timestamp": "2023-11-23T13:56:00.482135418" + }, + "rs_gtf_ballgown": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + [ + "e2t.ctab:md5,e981c0038295ae54b63cedb1083f1540", + "e_data.ctab:md5,879b6696029d19c4737b562e9d149218", + "i2t.ctab:md5,8a117c8aa4334b4c2d4711932b006fb4", + "i_data.ctab:md5,be3abe09740603213f83d50dcf81427f", + "t_data.ctab:md5,3b66c065da73ae0dd41cc332eff6a818" + ] + ] + ] + ], + "timestamp": "2023-11-23T13:56:22.715698347" + }, + "rs_transcript_gtf": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,31c34aec2bf36bb0ea3c16c2afeeeb1f" + ] + ] + ], + "timestamp": "2023-11-23T13:56:13.590054035" + }, + "rs_gtf_versions": { + "content": [ + [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ] + ], + "timestamp": "2023-11-23T13:56:22.725513476" + }, + "fs_gtf_ballgown": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + [ + "e2t.ctab:md5,e981c0038295ae54b63cedb1083f1540", + "e_data.ctab:md5,6b4cf69bc03f3f69890f972a0e8b7471", + "i2t.ctab:md5,8a117c8aa4334b4c2d4711932b006fb4", + "i_data.ctab:md5,be3abe09740603213f83d50dcf81427f", + "t_data.ctab:md5,3b66c065da73ae0dd41cc332eff6a818" + ] + ] + ] + ], + "timestamp": "2023-11-23T13:56:00.494299817" + }, + "fs_versions": { + "content": [ + [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ] + ], + "timestamp": "2023-11-23T13:55:41.049417582" + }, + "rs_gtf_abundance": { + "content": [ + [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,7385b870b955dae2c2ab78a70cf05cce" + ] + ] + ], + "timestamp": "2023-11-23T13:56:22.701059059" + } +} diff --git a/modules/nf-core/stringtie/stringtie/tests/tags.yml b/modules/nf-core/stringtie/stringtie/tests/tags.yml new file mode 100644 index 00000000..da9b051c --- /dev/null +++ b/modules/nf-core/stringtie/stringtie/tests/tags.yml @@ -0,0 +1,2 @@ +stringtie/stringtie: + - modules/nf-core/stringtie/stringtie/** diff --git a/nextflow.config b/nextflow.config index 0f0bbc88..3a54be0c 100644 --- a/nextflow.config +++ b/nextflow.config @@ -32,11 +32,9 @@ params { starfusion_build = true // Filtering - fusioninspector_filter = false - fusionreport_filter = true + tools_cutoff = 1 // Trimming - trim = false fastp_trim = false trim_tail = null adapter_fasta = [] @@ -55,8 +53,6 @@ params { all = false arriba = false fusioncatcher = false - pizzly = false - squid = false starindex = false starfusion = false stringtie = false @@ -70,13 +66,13 @@ params { // Path to references ensembl_ref = "${params.genomes_base}/ensembl" arriba_ref = "${params.genomes_base}/arriba" - arriba_ref_blacklist = "${params.genomes_base}/arriba/blacklist_hg38_GRCh38_v2.3.0.tsv.gz" - arriba_ref_cytobands = "${params.genomes_base}/arriba/cytobands_hg38_GRCh38_v2.3.0.tsv" - arriba_ref_known_fusions = "${params.genomes_base}/arriba/known_fusions_hg38_GRCh38_v2.3.0.tsv.gz" - arriba_ref_protein_domain = "${params.genomes_base}/arriba/protein_domains_hg38_GRCh38_v2.3.0.gff3" + arriba_ref_blacklist = "${params.genomes_base}/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz" + arriba_ref_cytobands = "${params.genomes_base}/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv" + arriba_ref_known_fusions = "${params.genomes_base}/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz" + arriba_ref_protein_domains = "${params.genomes_base}/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3" fusioncatcher_ref = "${params.genomes_base}/fusioncatcher/human_v102" - pizzly_ref = "${params.genomes_base}/pizzly/kallisto" - squid_ref = "${params.genomes_base}/squid" + hgnc_ref = "${params.genomes_base}/hgnc/hgnc_complete_set.txt" + hgnc_date = "${params.genomes_base}/hgnc/HGNC-DB-timestamp.txt" starfusion_ref = "${params.genomes_base}/starfusion/ctat_genome_lib_build_dir" starindex_ref = "${params.genomes_base}/star" fusionreport_ref = "${params.genomes_base}/fusion_report_db" @@ -84,8 +80,6 @@ params { // Path to fusion outputs arriba_fusions = null - pizzly_fusions = null - squid_fusions = null starfusion_fusions = null fusioncatcher_fusions = null fusioninspector_fusions = null @@ -93,7 +87,6 @@ params { // Boilerplate options outdir = null - tracedir = "${params.outdir}/pipeline_info" publish_dir_mode = 'copy' email = null email_on_fail = null @@ -102,18 +95,14 @@ params { hook_url = null help = false version = false - validate_params = true - show_hidden_params = false - schema_ignore_params = 'genomes' - // Config options + config_profile_name = null + config_profile_description = null custom_config_version = 'master' custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" - config_profile_description = null config_profile_contact = null config_profile_url = null - config_profile_name = null // Max resource options @@ -121,6 +110,14 @@ params { max_memory = '128.GB' max_cpus = 16 max_time = '240.h' + + + // Schema validation default options + validationFailUnrecognisedParams = false + validationLenientMode = false + validationSchemaIgnoreParams = 'genomes' + validationShowHiddenParams = false + validate_params = true } // Load base.config by default for all pipelines @@ -137,15 +134,17 @@ try { // Load nf-core/rnafusion custom profiles from different institutions. // Warning: Uncomment only if a pipeline-specific instititutional config already exists on nf-core/configs! -// try { -// includeConfig "${params.custom_config_base}/pipeline/rnafusion.config" -// } catch (Exception e) { -// System.err.println("WARNING: Could not load nf-core/config/rnafusion profiles: ${params.custom_config_base}/pipeline/rnafusion.config") -// } - - +try { + includeConfig "${params.custom_config_base}/pipeline/rnafusion.config" +} catch (Exception e) { + System.err.println("WARNING: Could not load nf-core/config/rnafusion profiles: ${params.custom_config_base}/pipeline/rnafusion.config") +} profiles { - debug { process.beforeScript = 'echo $HOSTNAME' } + debug { + dumpHashes = true + process.beforeScript = 'echo $HOSTNAME' + cleanup = false + } conda { conda.enabled = true docker.enabled = false @@ -153,6 +152,7 @@ profiles { podman.enabled = false shifter.enabled = false charliecloud.enabled = false + apptainer.enabled = false } mamba { conda.enabled = true @@ -162,14 +162,17 @@ profiles { podman.enabled = false shifter.enabled = false charliecloud.enabled = false + apptainer.enabled = false } docker { docker.enabled = true docker.userEmulation = true + conda.enabled = false singularity.enabled = false podman.enabled = false shifter.enabled = false charliecloud.enabled = false + apptainer.enabled = false } arm { docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' @@ -177,31 +180,49 @@ profiles { singularity { singularity.enabled = true singularity.autoMounts = true + conda.enabled = false docker.enabled = false podman.enabled = false shifter.enabled = false charliecloud.enabled = false + apptainer.enabled = false } podman { podman.enabled = true + conda.enabled = false docker.enabled = false singularity.enabled = false shifter.enabled = false charliecloud.enabled = false + apptainer.enabled = false } shifter { shifter.enabled = true + conda.enabled = false docker.enabled = false singularity.enabled = false podman.enabled = false charliecloud.enabled = false + apptainer.enabled = false } charliecloud { charliecloud.enabled = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + apptainer.enabled = false + } + apptainer { + apptainer.enabled = true + apptainer.autoMounts = true + conda.enabled = false docker.enabled = false singularity.enabled = false podman.enabled = false shifter.enabled = false + charliecloud.enabled = false } test { includeConfig 'conf/test.config' @@ -212,11 +233,24 @@ profiles { gitpod { executor.name = 'local' - executor.cpus = 16 - executor.memory = 60.GB + executor.cpus = 4 + executor.memory = 8.GB } } +// Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile +// Will not be used unless Apptainer / Docker / Podman / Singularity are enabled +// Set to your registry if you have a mirror of containers +apptainer.registry = 'quay.io' +docker.registry = 'quay.io' +podman.registry = 'quay.io' +singularity.registry = 'quay.io' + +// Nextflow plugins +plugins { + id 'nf-validation' // Validation of pipeline parameters and creation of an input channel from a sample sheet +} + // Export these variables to prevent local Python/R libraries from conflicting with those in the container // The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. // See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable. @@ -234,19 +268,19 @@ process.shell = ['/bin/bash', '-euo', 'pipefail'] def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') timeline { enabled = true - file = "${params.tracedir}/execution_timeline_${trace_timestamp}.html" + file = "${params.outdir}/pipeline_info/execution_timeline_${trace_timestamp}.html" } report { enabled = true - file = "${params.tracedir}/execution_report_${trace_timestamp}.html" + file = "${params.outdir}/pipeline_info/execution_report_${trace_timestamp}.html" } trace { enabled = true - file = "${params.tracedir}/execution_trace_${trace_timestamp}.txt" + file = "${params.outdir}/pipeline_info/execution_trace_${trace_timestamp}.txt" } dag { enabled = true - file = "${params.tracedir}/pipeline_dag_${trace_timestamp}.html" + file = "${params.outdir}/pipeline_info/pipeline_dag_${trace_timestamp}.html" } manifest { @@ -255,8 +289,8 @@ manifest { homePage = 'https://github.com/nf-core/rnafusion' description = """Nextflow rnafusion analysis pipeline, part of the nf-core community.""" mainScript = 'main.nf' - nextflowVersion = '!>=22.10.1' - version = '2.3.4' + nextflowVersion = '!>=23.04.0' + version = '3.0.1' doi = '' } diff --git a/nextflow_schema.json b/nextflow_schema.json index 7f517b3e..29ae6288 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -34,7 +34,6 @@ "format": "file-path", "mimetype": "text/csv", "pattern": "^\\S+\\.csv$", - "schema": "assets/schema_input.json", "description": "Path to comma-separated file containing information about the samples in the experiment.", "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See [usage docs](https://nf-co.re/rnafusion/usage#samplesheet-input).", "fa_icon": "fas fa-file-csv" @@ -62,6 +61,16 @@ "fa_icon": "far fa-file-code", "description": "Specifies which analysis type for the pipeline - either build references or analyse data" }, + "cosmic_username": { + "type": "string", + "fa_icon": "far fa-file-code", + "description": "COSMIC username" + }, + "cosmic_passwd": { + "type": "string", + "fa_icon": "far fa-file-code", + "description": "COSMIC password" + }, "genomes_base": { "type": "string", "fa_icon": "far fa-file-code", @@ -114,7 +123,7 @@ "fa_icon": "far fa-file-code", "description": "Path to arriba reference known fusions" }, - "arriba_ref_protein_domain": { + "arriba_ref_protein_domains": { "type": "string", "fa_icon": "far fa-file-code", "description": "Path to arriba reference protein domain" @@ -149,11 +158,6 @@ "fa_icon": "far fa-file-code", "description": "Path to fusioncatcher references" }, - "fusioninspector_filter": { - "type": "boolean", - "fa_icon": "far fa-file-code", - "description": "Feed filtered fusionreport fusions to fusioninspector" - }, "fusioninspector_limitSjdbInsertNsj": { "type": "integer", "fa_icon": "far fa-file-code", @@ -179,41 +183,20 @@ "fa_icon": "far fa-file-code", "description": "Path to fusionreport references" }, - "fusionreport_filter": { - "type": "boolean", - "fa_icon": "far fa-file-code", - "default": true, - "description": "Display fusions identified with 2 tools or more" - }, - "pizzly": { - "type": "boolean", - "fa_icon": "far fa-file-code", - "description": "Build or run pizzly references/analyses" - }, - "pizzly_fusions": { + "hgnc_ref": { "type": "string", "fa_icon": "far fa-file-code", - "description": "Path to pizzly output" + "description": "Path to HGNC database file" }, - "pizzly_ref": { + "hgnc_date": { "type": "string", "fa_icon": "far fa-file-code", - "description": "Path to pizzly references" + "description": "Path to HGNC timestamp file for database retrieval" }, - "squid": { + "qiagen": { "type": "boolean", "fa_icon": "far fa-file-code", - "description": "Build or run squid references/analyses" - }, - "squid_fusions": { - "type": "string", - "fa_icon": "far fa-file-code", - "description": "Path to squid output" - }, - "squid_ref": { - "type": "string", - "fa_icon": "far fa-file-code", - "description": "Path to squid references" + "description": "Use QIAGEN instead of SANGER to download COSMIC database" }, "starfusion": { "type": "boolean", @@ -245,25 +228,15 @@ "fa_icon": "far fa-file-code", "description": "Run stringtie analysis" }, - "whitelist": { - "type": "string", - "fa_icon": "far fa-file-code", - "description": "Path to fusions to add to the input of fusioninspector" - }, - "cosmic_username": { - "type": "string", + "tools_cutoff": { + "type": "integer", "fa_icon": "far fa-file-code", - "description": "COSMIC username" + "description": "Discard fusions identified by less than INT tools" }, - "cosmic_passwd": { + "whitelist": { "type": "string", "fa_icon": "far fa-file-code", - "description": "COSMIC password" - }, - "qiagen": { - "type": "boolean", - "fa_icon": "far fa-file-code", - "description": "Use QIAGEN instead of SANGER to download COSMIC database" + "description": "Path to fusions to add to the input of fusioninspector" } } }, @@ -273,11 +246,6 @@ "fa_icon": "fas fa-cut", "description": "Options to adjust read trimming criteria.", "properties": { - "trim": { - "type": "boolean", - "description": "Preform trimming of reads, default: false", - "fa_icon": "fas fa-cut" - }, "fastp_trim": { "type": "boolean", "description": "Preform fastp trimming of reads, default: false", @@ -303,7 +271,7 @@ "properties": { "cram": { "type": "string", - "description": "List of tools for which to compress BAM file to CRAM,default: [], options: arriba, squid, starfusion. Leave no space between options", + "description": "List of tools for which to compress BAM file to CRAM,default: [], options: arriba, starfusion. Leave no space between options", "fa_icon": "fas fa-cut" } } @@ -454,7 +422,7 @@ "description": "Maximum amount of time that can be requested for any single job.", "default": "240.h", "fa_icon": "far fa-clock", - "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$", + "pattern": "^(\\d+\\.?\\s*(s|m|h|d|day)\\s*)+$", "hidden": true, "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`" } @@ -525,6 +493,7 @@ }, "multiqc_config": { "type": "string", + "format": "file-path", "description": "Custom config file to supply to MultiQC.", "fa_icon": "fas fa-cog", "hidden": true @@ -540,13 +509,6 @@ "description": "Custom MultiQC yaml file containing HTML including a methods description.", "fa_icon": "fas fa-cog" }, - "tracedir": { - "type": "string", - "description": "Directory to keep pipeline Nextflow logs and reports.", - "default": "${params.outdir}/pipeline_info", - "fa_icon": "fas fa-cogs", - "hidden": true - }, "validate_params": { "type": "boolean", "description": "Boolean whether to validate parameters against the schema at runtime", @@ -554,13 +516,27 @@ "fa_icon": "fas fa-check-square", "hidden": true }, - "show_hidden_params": { + "validationShowHiddenParams": { "type": "boolean", "fa_icon": "far fa-eye-slash", "description": "Show all params when using `--help`", "hidden": true, "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters." }, + "validationFailUnrecognisedParams": { + "type": "boolean", + "fa_icon": "far fa-check-circle", + "description": "Validation of parameters fails when an unrecognised parameter is found.", + "hidden": true, + "help_text": "By default, when an unrecognised parameter is found, it returns a warinig." + }, + "validationLenientMode": { + "type": "boolean", + "fa_icon": "far fa-check-circle", + "description": "Validation of parameters in lenient more.", + "hidden": true, + "help_text": "Allows string values that are parseable as numbers or booleans. For further information see [JSONSchema docs](https://github.com/everit-org/json-schema#lenient-mode)." + }, "seq_center": { "type": "string", "description": "Sequencing center", diff --git a/subworkflows/local/arriba_workflow.nf b/subworkflows/local/arriba_workflow.nf index 0712f787..f59018dc 100644 --- a/subworkflows/local/arriba_workflow.nf +++ b/subworkflows/local/arriba_workflow.nf @@ -1,6 +1,6 @@ include { ARRIBA } from '../../modules/nf-core/arriba/main' include { SAMTOOLS_INDEX as SAMTOOLS_INDEX_FOR_ARRIBA} from '../../modules/nf-core/samtools/index/main' -include { SAMTOOLS_SORT as SAMTOOLS_SORT_FOR_ARRIBA } from '../../modules/nf-core/samtools/sort/main' +include { SAMTOOLS_SORT as SAMTOOLS_SORT_FOR_ARRIBA} from '../../modules/nf-core/samtools/sort/main' include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_FOR_ARRIBA} from '../../modules/nf-core/samtools/view/main' include { STAR_ALIGN as STAR_FOR_ARRIBA } from '../../modules/nf-core/star/align/main' @@ -10,6 +10,9 @@ workflow ARRIBA_WORKFLOW { ch_gtf ch_fasta ch_starindex_ref + ch_arriba_ref_blacklist + ch_arriba_ref_known_fusions + ch_arriba_ref_protein_domains main: ch_versions = Channel.empty() @@ -20,21 +23,12 @@ workflow ARRIBA_WORKFLOW { STAR_FOR_ARRIBA( reads, ch_starindex_ref, ch_gtf, params.star_ignore_sjdbgtf, '', params.seq_center ?: '') ch_versions = ch_versions.mix(STAR_FOR_ARRIBA.out.versions) - SAMTOOLS_SORT_FOR_ARRIBA(STAR_FOR_ARRIBA.out.bam) - ch_versions = ch_versions.mix(SAMTOOLS_SORT_FOR_ARRIBA.out.versions) - - SAMTOOLS_INDEX_FOR_ARRIBA(SAMTOOLS_SORT_FOR_ARRIBA.out.bam) - ch_versions = ch_versions.mix(SAMTOOLS_INDEX_FOR_ARRIBA.out.versions) - - bam_indexed = SAMTOOLS_SORT_FOR_ARRIBA.out.bam.join(SAMTOOLS_INDEX_FOR_ARRIBA.out.bai) - if (params.arriba_fusions) { - // [meta, reads], fusions -> [meta, fusions] ch_arriba_fusions = reads.combine( Channel.value( file( params.arriba_fusions, checkIfExists: true ) ) ) .map { meta, reads, fusions -> [ meta, fusions ] } ch_arriba_fusion_fail = ch_dummy_file } else { - ARRIBA ( STAR_FOR_ARRIBA.out.bam, ch_fasta, ch_gtf, params.arriba_ref_blacklist, params.arriba_ref_known_fusions, [], [], params.arriba_ref_protein_domain ) + ARRIBA ( STAR_FOR_ARRIBA.out.bam, ch_fasta, ch_gtf, ch_arriba_ref_blacklist, ch_arriba_ref_known_fusions, [[],[]], [[],[]], ch_arriba_ref_protein_domains ) ch_versions = ch_versions.mix(ARRIBA.out.versions) ch_arriba_fusions = ARRIBA.out.fusions @@ -42,12 +36,17 @@ workflow ARRIBA_WORKFLOW { } if (params.cram.contains('arriba') ){ - SAMTOOLS_VIEW_FOR_ARRIBA(bam_indexed, ch_fasta, []) - ch_versions = ch_versions.mix(SAMTOOLS_VIEW_FOR_ARRIBA.out.versions ) - } + SAMTOOLS_SORT_FOR_ARRIBA(STAR_FOR_ARRIBA.out.bam) + ch_versions = ch_versions.mix(SAMTOOLS_SORT_FOR_ARRIBA.out.versions ) + + SAMTOOLS_VIEW_FOR_ARRIBA(SAMTOOLS_SORT_FOR_ARRIBA.out.bam.map { meta, bam -> [ meta, bam, [] ] }, ch_fasta, []) + ch_versions = ch_versions.mix(SAMTOOLS_VIEW_FOR_ARRIBA.out.versions ) + SAMTOOLS_INDEX_FOR_ARRIBA(SAMTOOLS_VIEW_FOR_ARRIBA.out.cram) + ch_versions = ch_versions.mix(SAMTOOLS_INDEX_FOR_ARRIBA.out.versions ) + } } else { @@ -60,6 +59,6 @@ workflow ARRIBA_WORKFLOW { emit: fusions = ch_arriba_fusions fusions_fail = ch_arriba_fusion_fail - versions = ch_versions.ifEmpty(null) + versions = ch_versions } diff --git a/subworkflows/local/fusioncatcher_workflow.nf b/subworkflows/local/fusioncatcher_workflow.nf index a9058dc6..ebb09e60 100644 --- a/subworkflows/local/fusioncatcher_workflow.nf +++ b/subworkflows/local/fusioncatcher_workflow.nf @@ -19,6 +19,7 @@ workflow FUSIONCATCHER_WORKFLOW { params.fusioncatcher_ref ) ch_fusioncatcher_fusions = FUSIONCATCHER.out.fusions + ch_versions = ch_versions.mix(FUSIONCATCHER.out.versions) } } else { @@ -28,6 +29,6 @@ workflow FUSIONCATCHER_WORKFLOW { emit: fusions = ch_fusioncatcher_fusions - versions = ch_versions.ifEmpty(null) + versions = ch_versions } diff --git a/subworkflows/local/fusioninspector_workflow.nf b/subworkflows/local/fusioninspector_workflow.nf index 388f42a6..7a31d7cd 100644 --- a/subworkflows/local/fusioninspector_workflow.nf +++ b/subworkflows/local/fusioninspector_workflow.nf @@ -1,6 +1,7 @@ +include { AGAT_CONVERTSPGFF2TSV } from '../../modules/nf-core/agat/convertspgff2tsv/main' include { ARRIBA_VISUALISATION } from '../../modules/local/arriba/visualisation/main' include { CAT_CAT } from '../../modules/nf-core/cat/cat/main' -include { MEGAFUSION } from '../../modules/local/megafusion/main' +include { VCF_COLLECT } from '../../modules/local/vcf_collect/main' include { FUSIONINSPECTOR } from '../../modules/local/fusioninspector/main' workflow FUSIONINSPECTOR_WORKFLOW { @@ -8,41 +9,57 @@ workflow FUSIONINSPECTOR_WORKFLOW { reads fusion_list fusion_list_filtered - report + fusionreport_out + fusionreport_csv bam_sorted_indexed ch_gtf + ch_arriba_ref_protein_domains + ch_arriba_ref_cytobands + ch_hgnc_ref + ch_hgnc_date main: ch_versions = Channel.empty() + ch_arriba_visualisation = Channel.empty() index ="${params.starfusion_ref}" - ch_fusion_list = params.fusioninspector_filter ? fusion_list_filtered : fusion_list + + ch_fusion_list = ( params.tools_cutoff > 1 ? fusion_list_filtered : fusion_list ) + .branch{ + no_fusions: it[1].size() == 0 + fusions: it[1].size() > 0 + } if (params.whitelist) { - ch_whitelist = ch_fusion_list.combine(Channel.value(file(params.whitelist, checkIfExists:true))) + ch_whitelist = ch_fusion_list.fusions.combine(Channel.value(file(params.whitelist, checkIfExists:true))) .map { meta, fusions, whitelist -> [ meta, [fusions, whitelist] ] } CAT_CAT(ch_whitelist) // fusioninspector takes care of possible duplicates ch_versions = ch_versions.mix(CAT_CAT.out.versions) - ch_fusion_list = CAT_CAT.out.file_out + ch_fusion_list.fusions = CAT_CAT.out.file_out } - reads_fusion = reads.join(ch_fusion_list ) + ch_reads_fusion = reads.join(ch_fusion_list.fusions ) - FUSIONINSPECTOR( reads_fusion, index) + FUSIONINSPECTOR( ch_reads_fusion, index) ch_versions = ch_versions.mix(FUSIONINSPECTOR.out.versions) - fusion_data = FUSIONINSPECTOR.out.tsv.join(report) - MEGAFUSION(fusion_data) - ch_versions = ch_versions.mix(MEGAFUSION.out.versions) + AGAT_CONVERTSPGFF2TSV(FUSIONINSPECTOR.out.out_gtf) + ch_versions = ch_versions.mix(AGAT_CONVERTSPGFF2TSV.out.versions) + + fusion_data = FUSIONINSPECTOR.out.tsv_coding_effect.join(AGAT_CONVERTSPGFF2TSV.out.tsv).join(fusionreport_out).join(fusionreport_csv) + VCF_COLLECT(fusion_data, ch_hgnc_ref, ch_hgnc_date) + ch_versions = ch_versions.mix(VCF_COLLECT.out.versions) if ((params.starfusion || params.all || params.stringtie) && !params.fusioninspector_only && !params.skip_vis) { - bam_sorted_indexed_fusions = bam_sorted_indexed.join(FUSIONINSPECTOR.out.tsv) - ARRIBA_VISUALISATION(bam_sorted_indexed_fusions, ch_gtf, params.arriba_ref_protein_domain, params.arriba_ref_cytobands) + ch_bam_sorted_indexed_fusions = bam_sorted_indexed.join(FUSIONINSPECTOR.out.tsv) + ARRIBA_VISUALISATION(ch_bam_sorted_indexed_fusions, ch_gtf, ch_arriba_ref_protein_domains, ch_arriba_ref_cytobands) ch_versions = ch_versions.mix(ARRIBA_VISUALISATION.out.versions) + ch_arriba_visualisation = ARRIBA_VISUALISATION.out.pdf } emit: - versions = ch_versions.ifEmpty(null) + ch_arriba_visualisation + versions = ch_versions } diff --git a/subworkflows/local/fusionreport_workflow.nf b/subworkflows/local/fusionreport_workflow.nf index 478986a4..09ec9965 100644 --- a/subworkflows/local/fusionreport_workflow.nf +++ b/subworkflows/local/fusionreport_workflow.nf @@ -6,28 +6,26 @@ workflow FUSIONREPORT_WORKFLOW { reads fusionreport_ref arriba_fusions - pizzly_fusions - squid_fusions starfusion_fusions fusioncatcher_fusions main: ch_versions = Channel.empty() ch_report = Channel.empty() + ch_csv = Channel.empty() if (!params.fusioninspector_only) { reads_fusions = reads .join(arriba_fusions, remainder: true) - .join(pizzly_fusions, remainder: true) - .join(squid_fusions, remainder: true) .join(starfusion_fusions, remainder: true) .join(fusioncatcher_fusions, remainder: true) - FUSIONREPORT(reads_fusions, fusionreport_ref) + FUSIONREPORT(reads_fusions, fusionreport_ref, params.tools_cutoff) ch_fusion_list = FUSIONREPORT.out.fusion_list ch_fusion_list_filtered = FUSIONREPORT.out.fusion_list_filtered ch_versions = ch_versions.mix(FUSIONREPORT.out.versions) ch_report = FUSIONREPORT.out.report + ch_csv = FUSIONREPORT.out.csv } else { ch_fusion_list = reads.combine(Channel.value(file(params.fusioninspector_fusions, checkIfExists:true))) .map { meta, reads, fusions -> [ meta, fusions ] } @@ -36,9 +34,11 @@ workflow FUSIONREPORT_WORKFLOW { } emit: - versions = ch_versions.ifEmpty(null) + versions = ch_versions fusion_list = ch_fusion_list fusion_list_filtered = ch_fusion_list_filtered - report = ch_report.ifEmpty(null) + report = ch_report.ifEmpty(null) + csv = ch_csv.ifEmpty(null) + } diff --git a/subworkflows/local/pizzly_workflow.nf b/subworkflows/local/pizzly_workflow.nf deleted file mode 100644 index 7675432b..00000000 --- a/subworkflows/local/pizzly_workflow.nf +++ /dev/null @@ -1,37 +0,0 @@ -include { KALLISTO_QUANT } from '../../modules/local/kallisto/quant/main' -include { PIZZLY } from '../../modules/local/pizzly/detect/main' - -workflow PIZZLY_WORKFLOW { - take: - reads - ch_gtf - ch_transcript - - main: - ch_versions = Channel.empty() - ch_dummy_file = file("$baseDir/assets/dummy_file_pizzly.txt", checkIfExists: true) - - if ((params.pizzly || params.all) && !params.fusioninspector_only) { - if (params.pizzly_fusions) { - ch_pizzly_fusions = reads.combine(Channel.value(file(params.pizzly_fusions, checkIfExists:true))) - .map { meta, reads, fusions -> [ meta, fusions ] } - } else { - KALLISTO_QUANT(reads, params.pizzly_ref ) - ch_versions = ch_versions.mix(KALLISTO_QUANT.out.versions) - - PIZZLY( KALLISTO_QUANT.out.txt, ch_transcript, ch_gtf ) - ch_versions = ch_versions.mix(PIZZLY.out.versions) - - ch_pizzly_fusions = PIZZLY.out.fusions - } - } - else { - ch_pizzly_fusions = reads.combine(Channel.value(file(ch_dummy_file, checkIfExists:true))) - .map { meta, reads, fusions -> [ meta, fusions ] } - } - - emit: - fusions = ch_pizzly_fusions - versions = ch_versions.ifEmpty(null) - } - diff --git a/subworkflows/local/qc_workflow.nf b/subworkflows/local/qc_workflow.nf index a2a1dec9..6b53358a 100644 --- a/subworkflows/local/qc_workflow.nf +++ b/subworkflows/local/qc_workflow.nf @@ -2,14 +2,14 @@ // Check input samplesheet and get read channels // -include { QUALIMAP_RNASEQ } from '../../modules/nf-core/qualimap/rnaseq/main' -include { SAMTOOLS_INDEX as SAMTOOLS_INDEX_FOR_QC } from '../../modules/nf-core/samtools/index/main' include { PICARD_COLLECTRNASEQMETRICS } from '../../modules/local/picard/collectrnaseqmetrics/main' -include { PICARD_MARKDUPLICATES } from '../../modules/nf-core/picard/markduplicates/main' +include { GATK4_MARKDUPLICATES } from '../../modules/nf-core/gatk4/markduplicates/main' +include { PICARD_COLLECTINSERTSIZEMETRICS } from '../../modules/nf-core/picard/collectinsertsizemetrics/main' workflow QC_WORKFLOW { take: - bam_sorted + ch_bam_sorted + ch_bam_sorted_indexed ch_chrgtf ch_refflat ch_fasta @@ -19,29 +19,24 @@ workflow QC_WORKFLOW { main: ch_versions = Channel.empty() - QUALIMAP_RNASEQ(bam_sorted, ch_chrgtf) - ch_versions = ch_versions.mix(QUALIMAP_RNASEQ.out.versions) - ch_qualimap_qc = Channel.empty().mix(QUALIMAP_RNASEQ.out.results) - - SAMTOOLS_INDEX_FOR_QC(bam_sorted) - ch_versions = ch_versions.mix(SAMTOOLS_INDEX_FOR_QC.out.versions) - - bam_indexed = bam_sorted.join(SAMTOOLS_INDEX_FOR_QC.out.bai) - - PICARD_COLLECTRNASEQMETRICS(bam_indexed, ch_refflat, ch_rrna_interval) + PICARD_COLLECTRNASEQMETRICS(ch_bam_sorted_indexed, ch_refflat, ch_rrna_interval) ch_versions = ch_versions.mix(PICARD_COLLECTRNASEQMETRICS.out.versions) ch_rnaseq_metrics = Channel.empty().mix(PICARD_COLLECTRNASEQMETRICS.out.metrics) - PICARD_MARKDUPLICATES(bam_sorted, ch_fasta, ch_fai) - ch_versions = ch_versions.mix(PICARD_MARKDUPLICATES.out.versions) - ch_duplicate_metrics = Channel.empty().mix(PICARD_MARKDUPLICATES.out.metrics) + GATK4_MARKDUPLICATES(ch_bam_sorted, ch_fasta.map { meta, fasta -> [ fasta ]}, ch_fai.map { meta, fasta_fai -> [ fasta_fai ]}) + ch_versions = ch_versions.mix(GATK4_MARKDUPLICATES.out.versions) + ch_duplicate_metrics = Channel.empty().mix(GATK4_MARKDUPLICATES.out.metrics) + + PICARD_COLLECTINSERTSIZEMETRICS(ch_bam_sorted) + ch_versions = ch_versions.mix(PICARD_COLLECTINSERTSIZEMETRICS.out.versions) + ch_insertsize_metrics = Channel.empty().mix(PICARD_COLLECTINSERTSIZEMETRICS.out.metrics) emit: - versions = ch_versions.ifEmpty(null) - qualimap_qc = ch_qualimap_qc + versions = ch_versions rnaseq_metrics = ch_rnaseq_metrics duplicate_metrics = ch_duplicate_metrics + insertsize_metrics = ch_insertsize_metrics } diff --git a/subworkflows/local/squid_workflow.nf b/subworkflows/local/squid_workflow.nf deleted file mode 100644 index c4f29425..00000000 --- a/subworkflows/local/squid_workflow.nf +++ /dev/null @@ -1,80 +0,0 @@ -include { SAMTOOLS_INDEX as SAMTOOLS_INDEX_FOR_SQUID } from '../../modules/nf-core/samtools/index/main' -include { SAMTOOLS_INDEX as SAMTOOLS_INDEX_FOR_SQUID_CHIMERIC } from '../../modules/nf-core/samtools/index/main' -include { SAMTOOLS_SORT as SAMTOOLS_SORT_FOR_SQUID_CHIMERIC } from '../../modules/nf-core/samtools/sort/main' -include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_FOR_SQUID_CHIMERIC } from '../../modules/nf-core/samtools/view/main' -include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_FOR_SQUID_CRAM } from '../../modules/nf-core/samtools/view/main' -include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_FOR_SQUID_CRAM_CHIMERIC } from '../../modules/nf-core/samtools/view/main' -include { SQUID } from '../../modules/local/squid/detect/main' -include { SQUID_ANNOTATE } from '../../modules/local/squid/annotate/main' -include { STAR_ALIGN as STAR_FOR_SQUID } from '../../modules/nf-core/star/align/main' - -workflow SQUID_WORKFLOW { - - take: - reads - ch_gtf - ch_starindex_ensembl_ref - ch_fasta - - main: - ch_versions = Channel.empty() - ch_dummy_file = file("$baseDir/assets/dummy_file_squid.txt", checkIfExists: true) - - if ((params.squid || params.all) && !params.fusioninspector_only) { - if (params.squid_fusions){ - ch_squid_fusions = reads.combine(Channel.value(file(params.squid_fusions, checkIfExists:true))) - .map { meta, reads, fusions -> [ meta, fusions ] } - } else { - - STAR_FOR_SQUID(reads, ch_starindex_ensembl_ref, ch_gtf, params.star_ignore_sjdbgtf, '', params.seq_center ?: '') - ch_versions = ch_versions.mix(STAR_FOR_SQUID.out.versions) - - STAR_FOR_SQUID.out.sam - .map { meta, sam -> - return [meta, sam, []] - }.set { chimeric_sam } - - - - SAMTOOLS_VIEW_FOR_SQUID_CHIMERIC (chimeric_sam, ch_fasta, []) - ch_versions = ch_versions.mix(SAMTOOLS_VIEW_FOR_SQUID_CHIMERIC.out.versions) - - SAMTOOLS_SORT_FOR_SQUID_CHIMERIC (SAMTOOLS_VIEW_FOR_SQUID_CHIMERIC.out.bam) - ch_versions = ch_versions.mix(SAMTOOLS_SORT_FOR_SQUID_CHIMERIC.out.versions) - - bam_chimeric = STAR_FOR_SQUID.out.bam_sorted.join(SAMTOOLS_SORT_FOR_SQUID_CHIMERIC.out.bam) - - if (params.cram.contains('squid')){ - SAMTOOLS_INDEX_FOR_SQUID(STAR_FOR_SQUID.out.bam_sorted) - ch_versions = ch_versions.mix(SAMTOOLS_INDEX_FOR_SQUID.out.versions) - SAMTOOLS_INDEX_FOR_SQUID_CHIMERIC(SAMTOOLS_SORT_FOR_SQUID_CHIMERIC.out.bam) - ch_versions = ch_versions.mix(SAMTOOLS_INDEX_FOR_SQUID_CHIMERIC.out.versions) - - bam_sorted_indexed = STAR_FOR_SQUID.out.bam_sorted.join(SAMTOOLS_INDEX_FOR_SQUID.out.bai) - chimeric_sorted_indexed = SAMTOOLS_SORT_FOR_SQUID_CHIMERIC.out.bam.join(SAMTOOLS_INDEX_FOR_SQUID_CHIMERIC.out.bai) - - SAMTOOLS_VIEW_FOR_SQUID_CRAM (bam_sorted_indexed, ch_fasta, []) - ch_versions = ch_versions.mix(SAMTOOLS_VIEW_FOR_SQUID_CRAM.out.versions) - SAMTOOLS_VIEW_FOR_SQUID_CRAM_CHIMERIC (chimeric_sorted_indexed, ch_fasta, []) - ch_versions = ch_versions.mix(SAMTOOLS_VIEW_FOR_SQUID_CRAM.out.versions) - } - - SQUID (bam_chimeric) - ch_versions = ch_versions.mix(SQUID.out.versions) - - SQUID_ANNOTATE (SQUID.out.fusions, ch_gtf) - ch_versions = ch_versions.mix(SQUID_ANNOTATE.out.versions) - - ch_squid_fusions = SQUID_ANNOTATE.out.fusions_annotated - } - } - else { - ch_squid_fusions = reads.combine(Channel.value(file(ch_dummy_file, checkIfExists:true))) - .map { meta, reads, fusions -> [ meta, fusions ] } - } - - emit: - fusions = ch_squid_fusions - versions = ch_versions.ifEmpty(null) - } - diff --git a/subworkflows/local/starfusion_workflow.nf b/subworkflows/local/starfusion_workflow.nf index 1656ec7a..ec7a832c 100644 --- a/subworkflows/local/starfusion_workflow.nf +++ b/subworkflows/local/starfusion_workflow.nf @@ -1,7 +1,8 @@ -include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_FOR_STARFUSION } from '../../modules/nf-core/samtools/view/main' -include { SAMTOOLS_INDEX as SAMTOOLS_INDEX_FOR_STARFUSION } from '../../modules/nf-core/samtools/index/main' -include { STAR_ALIGN as STAR_FOR_STARFUSION } from '../../modules/nf-core/star/align/main' -include { STARFUSION } from '../../modules/local/starfusion/detect/main' +include { SAMTOOLS_INDEX as SAMTOOLS_INDEX_FOR_STARFUSION } from '../../modules/nf-core/samtools/index/main' +include { SAMTOOLS_INDEX as SAMTOOLS_INDEX_FOR_STARFUSION_CRAM } from '../../modules/nf-core/samtools/index/main' +include { SAMTOOLS_VIEW as SAMTOOLS_VIEW_FOR_STARFUSION } from '../../modules/nf-core/samtools/view/main' +include { STAR_ALIGN as STAR_FOR_STARFUSION } from '../../modules/nf-core/star/align/main' +include { STARFUSION } from '../../modules/local/starfusion/detect/main' workflow STARFUSION_WORKFLOW { take: @@ -33,6 +34,9 @@ workflow STARFUSION_WORKFLOW { if (params.cram.contains('starfusion')){ SAMTOOLS_VIEW_FOR_STARFUSION (bam_sorted_indexed, ch_fasta, [] ) ch_versions = ch_versions.mix(SAMTOOLS_VIEW_FOR_STARFUSION.out.versions) + + SAMTOOLS_INDEX_FOR_STARFUSION_CRAM (SAMTOOLS_VIEW_FOR_STARFUSION.out.cram) + ch_versions = ch_versions.mix(SAMTOOLS_INDEX_FOR_STARFUSION_CRAM.out.versions) } reads_junction = reads.join(STAR_FOR_STARFUSION.out.junction ) @@ -41,18 +45,22 @@ workflow STARFUSION_WORKFLOW { ch_starfusion_fusions = STARFUSION.out.fusions ch_star_stats = STAR_FOR_STARFUSION.out.log_final + ch_star_gene_count = STAR_FOR_STARFUSION.out.read_per_gene_tab } } else { ch_starfusion_fusions = reads.combine(Channel.value(file(ch_dummy_file, checkIfExists:true))) .map { meta, reads, fusions -> [ meta, fusions ] } ch_star_stats = Channel.empty() + ch_star_gene_count = Channel.empty() } emit: fusions = ch_starfusion_fusions star_stats = ch_star_stats - bam_sorted = ch_align - versions = ch_versions.ifEmpty(null) - ch_bam_sorted_indexed = bam_sorted_indexed.ifEmpty(null) + star_gene_count = ch_star_gene_count + ch_bam_sorted = ch_align.ifEmpty([[],[]]) + ch_bam_sorted_indexed = bam_sorted_indexed.ifEmpty([[],[],[]]) + versions = ch_versions + } diff --git a/subworkflows/local/stringtie_workflow.nf b/subworkflows/local/stringtie_workflow.nf index d9e1c6c3..60bd4f38 100644 --- a/subworkflows/local/stringtie_workflow.nf +++ b/subworkflows/local/stringtie_workflow.nf @@ -12,7 +12,7 @@ workflow STRINGTIE_WORKFLOW { ch_stringtie_gtf = Channel.empty() if ((params.stringtie || params.all) && !params.fusioninspector_only) { - STRINGTIE_STRINGTIE(bam_sorted, ch_chrgtf) + STRINGTIE_STRINGTIE(bam_sorted, ch_chrgtf.map { meta, gtf -> [ gtf ]}) ch_versions = ch_versions.mix(STRINGTIE_STRINGTIE.out.versions) STRINGTIE_STRINGTIE @@ -20,15 +20,17 @@ workflow STRINGTIE_WORKFLOW { .transcript_gtf .map { it -> it[1] } .set { stringtie_gtf } + ch_versions = ch_versions.mix(STRINGTIE_STRINGTIE.out.versions) + - STRINGTIE_MERGE ( stringtie_gtf, ch_chrgtf ) + STRINGTIE_MERGE (stringtie_gtf, ch_chrgtf.map { meta, gtf -> [ gtf ]}) ch_versions = ch_versions.mix(STRINGTIE_MERGE.out.versions) ch_stringtie_gtf = STRINGTIE_MERGE.out.gtf } emit: stringtie_gtf = ch_stringtie_gtf.ifEmpty(null) - versions = ch_versions.ifEmpty(null) + versions = ch_versions } diff --git a/subworkflows/local/trim_workflow.nf b/subworkflows/local/trim_workflow.nf index 01baeec7..ea21134d 100644 --- a/subworkflows/local/trim_workflow.nf +++ b/subworkflows/local/trim_workflow.nf @@ -1,5 +1,3 @@ -include { REFORMAT } from '../../modules/local/reformat/main' -include { FASTQC as FASTQC_FOR_TRIM } from '../../modules/nf-core/fastqc/main' include { FASTP } from '../../modules/nf-core/fastp/main' include { FASTQC as FASTQC_FOR_FASTP } from '../../modules/nf-core/fastqc/main' @@ -10,20 +8,11 @@ workflow TRIM_WORKFLOW { main: ch_versions = Channel.empty() - ch_reports = Channel.empty() + ch_fastp_html = Channel.empty() + ch_fastp_json = Channel.empty() + ch_fastqc_trimmed = Channel.empty() - if (params.trim) { - - REFORMAT( reads ) - ch_versions = ch_versions.mix(REFORMAT.out.versions) - FASTQC_FOR_TRIM (REFORMAT.out.reads_out) - ch_versions = ch_versions.mix(FASTQC_FOR_TRIM.out.versions) - - ch_reads_all = reads - ch_reads_fusioncatcher = REFORMAT.out.reads_out - ch_reports = FASTQC_FOR_TRIM.out.zip.collect{it[1]}.ifEmpty([]) - } - else if (params.fastp_trim) { + if (params.fastp_trim) { FASTP(reads, params.adapter_fasta, false, false) ch_versions = ch_versions.mix(FASTP.out.versions) @@ -32,11 +21,10 @@ workflow TRIM_WORKFLOW { ch_reads_all = FASTP.out.reads ch_reads_fusioncatcher = ch_reads_all - ch_reports = ch_reports.mix( - FASTQC_FOR_FASTP.out.zip.collect{it[1]}.ifEmpty([]), - FASTP.out.json.collect{meta, json -> json}, - FASTP.out.html.collect{meta, html -> html} - ) + ch_fastp_html = FASTP.out.html + ch_fastp_json = FASTP.out.json + ch_fastqc_trimmed = FASTQC_FOR_FASTP.out.zip + } else { ch_reads_all = reads @@ -46,7 +34,9 @@ workflow TRIM_WORKFLOW { emit: ch_reads_all ch_reads_fusioncatcher - ch_reports - versions = ch_versions.ifEmpty(null) + ch_fastp_html + ch_fastp_json + ch_fastqc_trimmed + versions = ch_versions } diff --git a/tower.yml b/tower.yml new file mode 100644 index 00000000..2edf5a7f --- /dev/null +++ b/tower.yml @@ -0,0 +1,31 @@ +reports: + multiqc_report.html: + display: "MultiQC HTML report" + "**/arriba/*.arriba.fusions.tsv": + display: "Arriba identified fusion TSV report" + "**/arriba_visualisation/*_combined_fusions_arriba_visualisation.pdf": + display: "PDF visualisation of the transcripts involved in predicted fusions" + "**/fastp/*fastp.html": + display: "Post fastp trimming HTML report" + "**/fusioncatcher/*.fusioncatcher.fusion-genes.txt": + display: "FusionCatcher identified fusion TXT report" + "**/fusioninspector/*.FusionInspector.fusions.abridged.tsv": + display: "FusionInspector TSV report" + "**/fusionreport/*/*_fusionreport_index.html": + display: "Fusion-report HTML report" + "**/vcf/*_fusion_data.vcf.gz": + display: "Collected statistics on each fusion fed to FusionInspector in VCF format" + "**/picard/*.MarkDuplicates.metrics.txt": + display: "Picard: Metrics from CollectRnaMetrics" + "**/picard/*_rna_metrics.txt": + display: "GATK4: Metrics from MarkDuplicates" + "**/picard/*insert*size*metrics.txt": + display: "GATK4: Metrics from InsertSizeMetrics" + "**/picard/*pdf": + display: "GATK4: InsertSizeMetrics histogram" + "**/star_for_starfusion/*ReadsPerGene.out.tab": + display: "Number of reads per gene" + "**/starfusion/*.starfusion.fusion_predictions.tsv": + display: "STAR-Fusion identified fusion TSV report" + "**/stringtie/*/*stringtie.merged.gtf": + display: "Merged GTFs from StringTie with annotations" diff --git a/workflows/build_references.nf b/workflows/build_references.nf index c43ecc84..0ebf3c08 100644 --- a/workflows/build_references.nf +++ b/workflows/build_references.nf @@ -8,6 +8,7 @@ include { ARRIBA_DOWNLOAD } from '../modules/local/arriba/downlo include { ENSEMBL_DOWNLOAD } from '../modules/local/ensembl/main' include { FUSIONCATCHER_DOWNLOAD } from '../modules/local/fusioncatcher/download/main' include { FUSIONREPORT_DOWNLOAD } from '../modules/local/fusionreport/download/main' +include { HGNC_DOWNLOAD } from '../modules/local/hgnc/main' include { STARFUSION_BUILD } from '../modules/local/starfusion/build/main' include { STARFUSION_DOWNLOAD } from '../modules/local/starfusion/download/main' include { GTF_TO_REFFLAT } from '../modules/local/uscs/custom_gtftogenepred/main' @@ -21,7 +22,6 @@ include { CONVERT2BED } from '../modules/local/convert2bed/m include { SAMTOOLS_FAIDX } from '../modules/nf-core/samtools/faidx/main' include { STAR_GENOMEGENERATE } from '../modules/nf-core/star/genomegenerate/main' -include { KALLISTO_INDEX as PIZZLY_INDEX } from '../modules/nf-core/kallisto/index/main' include { GATK4_CREATESEQUENCEDICTIONARY } from '../modules/nf-core/gatk4/createsequencedictionary/main' include { GATK4_BEDTOINTERVALLIST } from '../modules/nf-core/gatk4/bedtointervallist/main' @@ -33,24 +33,22 @@ include { GATK4_BEDTOINTERVALLIST } from '../modules/nf-core/gatk4/bedto workflow BUILD_REFERENCES { - ENSEMBL_DOWNLOAD( params.ensembl_version ) - ENSEMBL_DOWNLOAD.out.fasta - .map { it -> tuple(id:it.baseName, it) } - .set { ch_fasta_w_meta } + def fake_meta = [:] + fake_meta.id = "Homo_sapiens.${params.genome}.${params.ensembl_version}" + ENSEMBL_DOWNLOAD( params.ensembl_version, params.genome, fake_meta ) + HGNC_DOWNLOAD( ) - SAMTOOLS_FAIDX(ch_fasta_w_meta) + + SAMTOOLS_FAIDX(ENSEMBL_DOWNLOAD.out.fasta, [[],[]]) GATK4_CREATESEQUENCEDICTIONARY(ENSEMBL_DOWNLOAD.out.fasta) - ENSEMBL_DOWNLOAD.out.gtf - .map { it -> tuple(id:it.baseName, it) } - .set { ch_gtf_w_meta } - RRNA_TRANSCRIPTS(ch_gtf_w_meta) + RRNA_TRANSCRIPTS(ENSEMBL_DOWNLOAD.out.gtf) CONVERT2BED(RRNA_TRANSCRIPTS.out.rrna_gtf) GATK4_BEDTOINTERVALLIST(CONVERT2BED.out.bed, GATK4_CREATESEQUENCEDICTIONARY.out.dict) - if (params.starindex || params.all || params.starfusion || params.arriba || params.squid ) { + if (params.starindex || params.all || params.starfusion || params.arriba) { STAR_GENOMEGENERATE( ENSEMBL_DOWNLOAD.out.fasta, ENSEMBL_DOWNLOAD.out.gtf ) } @@ -62,10 +60,6 @@ workflow BUILD_REFERENCES { FUSIONCATCHER_DOWNLOAD() } - if (params.pizzly || params.all) { - PIZZLY_INDEX( ENSEMBL_DOWNLOAD.out.transcript ) - } - if (params.starfusion || params.all) { if (params.starfusion_build){ STARFUSION_BUILD( ENSEMBL_DOWNLOAD.out.fasta, ENSEMBL_DOWNLOAD.out.chrgtf ) diff --git a/workflows/rnafusion.nf b/workflows/rnafusion.nf index 45a9e623..992f72fc 100644 --- a/workflows/rnafusion.nf +++ b/workflows/rnafusion.nf @@ -1,50 +1,61 @@ /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - VALIDATE INPUTS + PRINT PARAMS SUMMARY ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -def summary_params = NfcoreSchema.paramsSummaryMap(workflow, params) +include { paramsSummaryLog; paramsSummaryMap } from 'plugin/nf-validation' + +def logo = NfcoreTemplate.logo(workflow, params.monochrome_logs) +def citation = '\n' + WorkflowMain.citation(workflow) + '\n' +def summary_params = paramsSummaryMap(workflow) + +// Print parameter summary log to screen +log.info logo + paramsSummaryLog(workflow) + citation -// Validate input parameters WorkflowRnafusion.initialise(params, log) // Check mandatory parameters if (file(params.input).exists() || params.build_references) { ch_input = file(params.input) } else { exit 1, 'Input samplesheet does not exist or was not specified!' } if (params.fusioninspector_only && !params.fusioninspector_fusions) { exit 1, 'Parameter --fusioninspector_fusions PATH_TO_FUSION_LIST expected with parameter --fusioninspector_only'} - -ch_chrgtf = params.starfusion_build ? file(params.chrgtf) : file("${params.starfusion_ref}/ref_annot.gtf") -ch_starindex_ref = params.starfusion_build ? params.starindex_ref : "${params.starfusion_ref}/ref_genome.fa.star.idx" -ch_starindex_ensembl_ref = params.starindex_ref -ch_refflat = params.starfusion_build ? file(params.refflat) : "${params.ensembl_ref}/ref_annot.gtf.refflat" -ch_rrna_interval = params.starfusion_build ? file(params.rrna_intervals) : "${params.ensembl_ref}/ref_annot.interval_list" - +if (params.tools_cutoff < 1) { exit 1, 'Parameter: --tools_cutoff should be >= 1'} + + +ch_chrgtf = params.starfusion_build ? Channel.fromPath(params.chrgtf).map { it -> [[id:it.Name], it] }.collect() : Channel.fromPath("${params.starfusion_ref}/ref_annot.gtf").map { it -> [[id:it.Name], it] }.collect() +ch_starindex_ref = params.starfusion_build ? Channel.fromPath(params.starindex_ref).map { it -> [[id:it.Name], it] }.collect() : Channel.fromPath("${params.starfusion_ref}/ref_genome.fa.star.idx").map { it -> [[id:it.Name], it] }.collect() +ch_starindex_ensembl_ref = Channel.fromPath(params.starindex_ref).map { it -> [[id:it.Name], it] }.collect() +ch_refflat = params.starfusion_build ? Channel.fromPath(params.refflat).map { it -> [[id:it.Name], it] }.collect() : Channel.fromPath("${params.ensembl_ref}/ref_annot.gtf.refflat").map { it -> [[id:it.Name], it] }.collect() +ch_rrna_interval = params.starfusion_build ? Channel.fromPath(params.rrna_intervals).map { it -> [[id:it.Name], it] }.collect() : Channel.fromPath("${params.ensembl_ref}/ref_annot.interval_list").map { it -> [[id:it.Name], it] }.collect() +ch_fusionreport_ref = Channel.fromPath(params.fusionreport_ref).map { it -> [[id:it.Name], it] }.collect() +ch_arriba_ref_blacklist = Channel.fromPath(params.arriba_ref_blacklist).map { it -> [[id:it.Name], it] }.collect() +ch_arriba_ref_known_fusions = Channel.fromPath(params.arriba_ref_known_fusions).map { it -> [[id:it.Name], it] }.collect() +ch_arriba_ref_protein_domains = Channel.fromPath(params.arriba_ref_protein_domains).map { it -> [[id:it.Name], it] }.collect() +ch_arriba_ref_cytobands = Channel.fromPath(params.arriba_ref_cytobands).map { it -> [[id:it.Name], it] }.collect() +ch_hgnc_ref = Channel.fromPath(params.hgnc_ref).map { it -> [[id:it.Name], it] }.collect() +ch_hgnc_date = Channel.fromPath(params.hgnc_date).map { it -> [[id:it.Name], it] }.collect() +ch_fasta = Channel.fromPath(params.fasta).map { it -> [[id:it.Name], it] }.collect() +ch_gtf = Channel.fromPath(params.gtf).map { it -> [[id:it.Name], it] }.collect() +ch_transcript = Channel.fromPath(params.transcript).map { it -> [[id:it.Name], it] }.collect() +ch_fai = Channel.fromPath(params.fai).map { it -> [[id:it.Name], it] }.collect() def checkPathParamList = [ params.fasta, params.fai, params.gtf, - ch_chrgtf, params.transcript, - ch_refflat, - ch_rrna_interval ] - for (param in checkPathParamList) if ((param) && !params.build_references) file(param, checkIfExists: true) -if (params.fasta[0,1] == "s3") { - log.info "INFO: s3 path detected, check for absolute path and trailing '/' not performed" +def params_fasta_path_uri = params.fasta =~ /^([a-zA-Z0-9]*):\/\/(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*)$/ +// check if params.fasta is a remote uri such as s3://, gs:// or dx:// +if (params_fasta_path_uri){ + log.info "INFO: a remote uri path detected, check for absolute path and trailing '/' not performed" + // log.info "INFO: remote uri path detected (e.g. s3), check for absolute path and trailing '/' not performed" } else { for (param in checkPathParamList) if ((param.toString())!= file(param).toString() && !params.build_references) { exit 1, "Problem with ${param}: ABSOLUTE PATHS are required! Check for trailing '/' at the end of paths too." } } -if ((params.squid || params.all) && params.ensembl_version != 102) { exit 1, 'Ensembl version is not supported by squid' } - -ch_fasta = file(params.fasta) -ch_gtf = file(params.gtf) -ch_transcript = file(params.transcript) -ch_fai = file(params.fai) /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -70,9 +81,7 @@ ch_multiqc_custom_methods_description = params.multiqc_methods_description ? fil include { INPUT_CHECK } from '../subworkflows/local/input_check' include { TRIM_WORKFLOW } from '../subworkflows/local/trim_workflow' include { ARRIBA_WORKFLOW } from '../subworkflows/local/arriba_workflow' -include { PIZZLY_WORKFLOW } from '../subworkflows/local/pizzly_workflow' include { QC_WORKFLOW } from '../subworkflows/local/qc_workflow' -include { SQUID_WORKFLOW } from '../subworkflows/local/squid_workflow' include { STARFUSION_WORKFLOW } from '../subworkflows/local/starfusion_workflow' include { STRINGTIE_WORKFLOW } from '../subworkflows/local/stringtie_workflow' include { FUSIONCATCHER_WORKFLOW } from '../subworkflows/local/fusioncatcher_workflow' @@ -108,11 +117,14 @@ workflow RNAFUSION { ch_versions = Channel.empty() + + + // // SUBWORKFLOW: Read in samplesheet, validate and stage input files // INPUT_CHECK ( - ch_input + file(params.input) ) .reads .map { @@ -137,7 +149,7 @@ workflow RNAFUSION { .reads .mix(ch_fastq.single) .set { ch_cat_fastq } - ch_versions = ch_versions.mix(CAT_FASTQ.out.versions.first().ifEmpty(null)) + ch_versions = ch_versions.mix(CAT_FASTQ.out.versions) // @@ -146,43 +158,26 @@ workflow RNAFUSION { FASTQC ( ch_cat_fastq ) - ch_versions = ch_versions.mix(FASTQC.out.versions.first()) + ch_versions = ch_versions.mix(FASTQC.out.versions) TRIM_WORKFLOW ( ch_cat_fastq ) ch_reads_fusioncatcher = TRIM_WORKFLOW.out.ch_reads_fusioncatcher ch_reads_all = TRIM_WORKFLOW.out.ch_reads_all - + ch_versions = ch_versions.mix(TRIM_WORKFLOW.out.versions) // Run STAR alignment and Arriba ARRIBA_WORKFLOW ( ch_reads_all, ch_gtf, ch_fasta, - ch_starindex_ensembl_ref - ) - ch_versions = ch_versions.mix(ARRIBA_WORKFLOW.out.versions.first().ifEmpty(null)) - - // Run pizzly/kallisto - - PIZZLY_WORKFLOW ( - ch_reads_all, - ch_gtf, - ch_transcript - ) - ch_versions = ch_versions.mix(PIZZLY_WORKFLOW.out.versions.first().ifEmpty(null)) - - -// Run squid - - SQUID_WORKFLOW ( - ch_reads_all, - ch_gtf, ch_starindex_ensembl_ref, - ch_fasta + ch_arriba_ref_blacklist, + ch_arriba_ref_known_fusions, + ch_arriba_ref_protein_domains ) - ch_versions = ch_versions.mix(SQUID_WORKFLOW.out.versions.first().ifEmpty(null)) + ch_versions = ch_versions.mix(ARRIBA_WORKFLOW.out.versions) //Run STAR fusion @@ -192,35 +187,33 @@ workflow RNAFUSION { ch_starindex_ref, ch_fasta ) - ch_versions = ch_versions.mix(STARFUSION_WORKFLOW.out.versions.first().ifEmpty(null)) + ch_versions = ch_versions.mix(STARFUSION_WORKFLOW.out.versions) //Run fusioncatcher FUSIONCATCHER_WORKFLOW ( ch_reads_fusioncatcher ) - ch_versions = ch_versions.mix(FUSIONCATCHER_WORKFLOW.out.versions.first().ifEmpty(null)) + ch_versions = ch_versions.mix(FUSIONCATCHER_WORKFLOW.out.versions) //Run stringtie STRINGTIE_WORKFLOW ( - STARFUSION_WORKFLOW.out.bam_sorted, + STARFUSION_WORKFLOW.out.ch_bam_sorted, ch_chrgtf ) - ch_versions = ch_versions.mix(STRINGTIE_WORKFLOW.out.versions.first().ifEmpty(null)) + ch_versions = ch_versions.mix(STRINGTIE_WORKFLOW.out.versions) //Run fusion-report FUSIONREPORT_WORKFLOW ( ch_reads_all, - params.fusionreport_ref, + ch_fusionreport_ref, ARRIBA_WORKFLOW.out.fusions, - PIZZLY_WORKFLOW.out.fusions, - SQUID_WORKFLOW.out.fusions, STARFUSION_WORKFLOW.out.fusions, FUSIONCATCHER_WORKFLOW.out.fusions ) - ch_versions = ch_versions.mix(FUSIONREPORT_WORKFLOW.out.versions.first().ifEmpty(null)) + ch_versions = ch_versions.mix(FUSIONREPORT_WORKFLOW.out.versions) //Run fusionInpector @@ -229,22 +222,28 @@ workflow RNAFUSION { FUSIONREPORT_WORKFLOW.out.fusion_list, FUSIONREPORT_WORKFLOW.out.fusion_list_filtered, FUSIONREPORT_WORKFLOW.out.report, + FUSIONREPORT_WORKFLOW.out.csv, STARFUSION_WORKFLOW.out.ch_bam_sorted_indexed, - ch_chrgtf + ch_chrgtf, + ch_arriba_ref_protein_domains, + ch_arriba_ref_cytobands, + ch_hgnc_ref, + ch_hgnc_date ) - ch_versions = ch_versions.mix(FUSIONINSPECTOR_WORKFLOW.out.versions.first().ifEmpty(null)) + ch_versions = ch_versions.mix(FUSIONINSPECTOR_WORKFLOW.out.versions) //QC QC_WORKFLOW ( - STARFUSION_WORKFLOW.out.bam_sorted, + STARFUSION_WORKFLOW.out.ch_bam_sorted, + STARFUSION_WORKFLOW.out.ch_bam_sorted_indexed, ch_chrgtf, ch_refflat, ch_fasta, ch_fai, ch_rrna_interval ) - ch_versions = ch_versions.mix(QC_WORKFLOW.out.versions.first().ifEmpty(null)) + ch_versions = ch_versions.mix(QC_WORKFLOW.out.versions) CUSTOM_DUMPSOFTWAREVERSIONS ( ch_versions.unique().collectFile(name: 'collated_versions.yml') @@ -257,7 +256,7 @@ workflow RNAFUSION { workflow_summary = WorkflowRnafusion.paramsSummaryMultiqc(workflow, summary_params) ch_workflow_summary = Channel.value(workflow_summary) - methods_description = WorkflowRnafusion.methodsDescriptionText(workflow, ch_multiqc_custom_methods_description) + methods_description = WorkflowRnafusion.methodsDescriptionText(workflow, ch_multiqc_custom_methods_description, params) ch_methods_description = Channel.value(methods_description) ch_multiqc_files = Channel.empty() @@ -265,11 +264,15 @@ workflow RNAFUSION { ch_multiqc_files = ch_multiqc_files.mix(ch_methods_description.collectFile(name: 'methods_description_mqc.yaml')) ch_multiqc_files = ch_multiqc_files.mix(CUSTOM_DUMPSOFTWAREVERSIONS.out.mqc_yml.collect()) ch_multiqc_files = ch_multiqc_files.mix(FASTQC.out.zip.collect{it[1]}.ifEmpty([])) - ch_multiqc_files = ch_multiqc_files.mix(QC_WORKFLOW.out.qualimap_qc.collect{it[1]}.ifEmpty([])) + ch_multiqc_files = ch_multiqc_files.mix(TRIM_WORKFLOW.out.ch_fastp_html.collect{it[1]}.ifEmpty([])) + ch_multiqc_files = ch_multiqc_files.mix(TRIM_WORKFLOW.out.ch_fastp_json.collect{it[1]}.ifEmpty([])) + ch_multiqc_files = ch_multiqc_files.mix(TRIM_WORKFLOW.out.ch_fastqc_trimmed.collect{it[1]}.ifEmpty([])) ch_multiqc_files = ch_multiqc_files.mix(STARFUSION_WORKFLOW.out.star_stats.collect{it[1]}.ifEmpty([])) + ch_multiqc_files = ch_multiqc_files.mix(STARFUSION_WORKFLOW.out.star_gene_count.collect{it[1]}.ifEmpty([])) ch_multiqc_files = ch_multiqc_files.mix(QC_WORKFLOW.out.rnaseq_metrics.collect{it[1]}.ifEmpty([])) ch_multiqc_files = ch_multiqc_files.mix(QC_WORKFLOW.out.duplicate_metrics.collect{it[1]}.ifEmpty([])) - ch_multiqc_files = ch_multiqc_files.mix(TRIM_WORKFLOW.out.ch_reports.ifEmpty([])) + ch_multiqc_files = ch_multiqc_files.mix(QC_WORKFLOW.out.insertsize_metrics.collect{it[1]}.ifEmpty([])) + ch_multiqc_files = ch_multiqc_files.mix(FUSIONINSPECTOR_WORKFLOW.out.ch_arriba_visualisation.collect{it[1]}.ifEmpty([])) @@ -297,6 +300,7 @@ workflow.onComplete { if (params.email || params.email_on_fail) { NfcoreTemplate.email(workflow, params, summary_params, projectDir, log, multiqc_report) } + NfcoreTemplate.dump_parameters(workflow, params) NfcoreTemplate.summary(workflow, params, log) if (params.hook_url) { NfcoreTemplate.IM_notification(workflow, params, summary_params, projectDir, log)