Question about Barcode80 (Barcode01_96_3prime.fa, Barcode01_96_5prime.fa)

[Y-SASAGAWA]

Dear Dr. Liu,

The sequence of the 80th barcode in the files (Barcode01_96_5prime.fa, Barcode01_96_3prime.fa) contains I (Inosine?).

Could you please confirm that this is correct?

If there is another correct sequence, please let me know.

The specific description is as follows.

Thank you in advance.

file: SCAN-seq2/primers/Barcode01_96_3prime.fa
>Barcode80
GATCCGGGATGAACATAGGATAGCGATIC

file: SCAN-seq2/primers/Barcode01_96_5prime.fa
>Barcode80
CGGATGAACATAGGATAGCGATICAAGC

[liuzhenyu-yyy]

Thanks for pointing that out. I appreciate your attention to detail.

The I should be corrected to T, and the accurate 24 bp sequence for barcode 80 is CGGATGAACATAGGATAGCGATTC. I have corrected the barcode sequence in caf5d8e. The additional 4 bp in the FASTA files is manually added to enhance the accuracy of demultiplexing.

If you have any further questions or require additional clarification, please feel free to let me know.

Cheers,
Zhenyu

[Y-SASAGAWA]

Many thanks for your response to Barcode 80.