nucleic.text

\section{Nucleic acid preparation}
The DNA sequence used for the SCP was taken directly from the originally published sequence of SCP1 (Juven-Gershon et al., 2006):
GTACTTATATAAGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCGAGCAGACGTGCCTACGGACCG
For SCP(-66), the following sequence was added immediately upstream of the SCP sequence:
CTCGCGCCACCTCTGTTTTCCCAGTCACGA
Mutant promoter sequences were taken directly from previous mutational analysis of SCP1 (Juven-Gershon et al., 2006).
All DNA oligonucleotides were ordered through Integrated DNA Technologies (IDT) and were annealed in 10 mM Tris-HCl pH = 8.0.  For 1.4 nm-monomaleiomido-Nanogold (Nanoprobes Inc.) labeling experiments, SCP oligonucleotides were ordered with a 5’ or 3’ six carbon linked thiol functional group.  Prior to incubating DNA with Nanogold, DNA was incubated in buffer containing 1 mM TCEP for 15 minutes at room temperature to ensure that the thiol functional groups were fully reduced.  The DNA was added to a 50-fold molar excess of Nanogold that was previously solubilized in 0.2 mL distilled water and incubated for 2 hours at room temperature.  Prior to purification, the sample was concentrated using a 10 MWCO spin-column concentrator (Sartorius) from 200 μl to ~30 μl.  The concentrated sample was added to a S200 size exclusion column (GE Healthcare) that was previously equilibrated in running buffer (0.02 M sodium phosphate, 150 mM NaCl pH = 7.4).  After purification of a labeled DNA-Nanogold complex, comparison of A420/A260 signal indicated that the sample was labeled with a ~70% labeling efficiency.  Before the Nanogold-DNA sample could be added to TFIID, the sample was concentrated 5-fold and then used immediately for cryo-EM grid preparation. \\