Fish error; there are no seqlevels of events that match hypothesis

[ddhb]

library(fishHook)
library(gTrack)
library(rtracklayer)

mutations = dt2gr(fread('test_150_maftools.maf'))
genes = gr.sub(import('gencode.v27.annotation.gtf'))
genes = genes %Q% (gene_type == 'protein_coding') %Q% (level<3)
cds = import("gencode.v27.annotation.gtf")
exomecov = import('Z_NSLA_1004_T.bw')

head(mutations[, c('Tumor_Sample_Barcode', 'Variant_Type', 'Variant_Classification', 'Reference_Allele', 'Tumor_Seq_Allele2')])
eligible = exomecov %Q% which(score>0.95)
eligible = reduce(intersect(eligible, cds, ignore.strand = TRUE))
events = mutations %Q% (Variant_Classification != 'Silent')

fish = Fish(hypotheses = genes[, 'gene_name'], events = events, eligible = eligible, idcol = 'Tumor_Sample_Barcode')

Error in .subset2(public_bind_env, "initialize")(...) :
Error: there are no seqlevels of events that match hypotheses
In addition: Warning messages:
1: In .subset2(public_bind_env, "initialize")(...) :
Warning: seqlevels of Hypotheses and Eligible appear to be in different formats
2: In .subset2(public_bind_env, "initialize")(...) :
Warning: seqlevels of Hypotheses and Events appear to be in different formats

[imielinski]

Looks like a “chr” issue? Your mutations are chr1, chr2 etc while your genes are 1, 2, 3 From: ddhb <[email protected]> Reply-To: mskilab/fishHook <[email protected]> Date: Friday, December 6, 2019 at 12:42 AM To: mskilab/fishHook <[email protected]> Cc: Subscribed <[email protected]> Subject: Re: [mskilab/fishHook] Fish error; there are no seqlevels of events that match hypothesis (#7) head(mutations) `GRanges object with 6 ranges and 22 metadata columns: seqnames ranges strand | Tumor_Sample_Barcode Reference_Allele Tumor_Seq_Allele2 Hugo_Symbol | [1] chr1 43145251 * | NSLA_1001 G A FAM183A [2] chr2 200981649 * | NSLA_1001 - G FAM126B [3] chr3 3056129 * | NSLA_1001 C A CNTN4 [4] chr3 47122435-47122458 * | NSLA_1001 CATCCAAGTCTTTTTCTTTGCAC - SETD2 [5] chr5 7826864 * | NSLA_1001 C A ADCY2 [6] chr5 80065463 * | NSLA_1001 - GC THBS4 Variant_Classification tx exon txChange aaChange Variant_Type Func.refGene Gene.refGene [1] Missense_Mutation SNP exonic FAM183A [2] Frame_Shift_Ins ENST00000418596.7 exon12 c.1213dup p.R405Pfs10 INS exonic FAM126B [3] Missense_Mutation ENST00000397461.5 exon24 c.2990C>A p.A997E SNP exonic CNTN4 [4] Frame_Shift_Del ENST00000409792.3 exon3 c.2178_2200del p.RCKEKDLDD726Rfs7 DEL exonic SETD2 [5] Missense_Mutation ENST00000338316.8 exon25 c.3269C>A p.A1090E SNP exonic ADCY2 [6] Frame_Shift_Ins ENST00000350881.6 exon9 c.1182_1183dup p.C394Cfs23 INS exonic THBS4 GeneDetail.refGene ExonicFunc.refGene AAChange.refGene SIFT_pred [1] . nonsynonymous SNV ENSG00000186973:ENST00000335282.5:NA:: D [2] . frameshift insertion ENSG00000155744:ENST00000418596.7:exon12:c.1213dup:p.R405Pfs10 . [3] . nonsynonymous SNV ENSG00000144619:ENST00000397461.5:exon24:c.2990C>A:p.A997E T [4] . frameshift deletion ENSG00000181555:ENST00000409792.3:exon3:c.2178_2200del:p.RCKEKDLDD726Rfs7 . [5] . nonsynonymous SNV ENSG00000078295:ENST00000338316.8:exon25:c.3269C>A:p.A1090E D [6] . frameshift insertion ENSG00000113296:ENST00000350881.6:exon9:c.1182_1183dup:p.C394Cfs23 . SIFT_score Polyphen2_HVAR_pred Polyphen2_HVAR_score MutationAssessor_pred MutationAssessor_score Tumor.Allele.Frequency [1] 0.0 . . . . 0.128 [2] . . . . . 0.364 [3] 0.067 P 0.748 L 1.21 0.091 [4] . . . . . 0.063 [5] 0.018 B 0.051 N 0 0.08 [6] . . . . . 0.146 seqinfo: 24 sequences from an unspecified genome head(test_mutations) Error in head(test_mutations) : object 'test_mutations' not found head(mutations) GRanges object with 6 ranges and 22 metadata columns: seqnames ranges strand | Tumor_Sample_Barcode Reference_Allele Tumor_Seq_Allele2 Hugo_Symbol | [1] chr1 43145251 * | NSLA_1001 G A FAM183A [2] chr2 200981649 * | NSLA_1001 - G FAM126B [3] chr3 3056129 * | NSLA_1001 C A CNTN4 [4] chr3 47122435-47122458 * | NSLA_1001 CATCCAAGTCTTTTTCTTTGCAC - SETD2 [5] chr5 7826864 * | NSLA_1001 C A ADCY2 [6] chr5 80065463 * | NSLA_1001 - GC THBS4 Variant_Classification tx exon txChange aaChange Variant_Type Func.refGene Gene.refGene [1] Missense_Mutation SNP exonic FAM183A [2] Frame_Shift_Ins ENST00000418596.7 exon12 c.1213dup p.R405Pfs10 INS exonic FAM126B [3] Missense_Mutation ENST00000397461.5 exon24 c.2990C>A p.A997E SNP exonic CNTN4 [4] Frame_Shift_Del ENST00000409792.3 exon3 c.2178_2200del p.RCKEKDLDD726Rfs7 DEL exonic SETD2 [5] Missense_Mutation ENST00000338316.8 exon25 c.3269C>A p.A1090E SNP exonic ADCY2 [6] Frame_Shift_Ins ENST00000350881.6 exon9 c.1182_1183dup p.C394Cfs23 INS exonic THBS4 GeneDetail.refGene ExonicFunc.refGene AAChange.refGene SIFT_pred [1] . nonsynonymous SNV ENSG00000186973:ENST00000335282.5:NA:: D [2] . frameshift insertion ENSG00000155744:ENST00000418596.7:exon12:c.1213dup:p.R405Pfs10 . [3] . nonsynonymous SNV ENSG00000144619:ENST00000397461.5:exon24:c.2990C>A:p.A997E T [4] . frameshift deletion ENSG00000181555:ENST00000409792.3:exon3:c.2178_2200del:p.RCKEKDLDD726Rfs7 . [5] . nonsynonymous SNV ENSG00000078295:ENST00000338316.8:exon25:c.3269C>A:p.A1090E D [6] . frameshift insertion ENSG00000113296:ENST00000350881.6:exon9:c.1182_1183dup:p.C394Cfs23 . SIFT_score Polyphen2_HVAR_pred Polyphen2_HVAR_score MutationAssessor_pred MutationAssessor_score Tumor.Allele.Frequency [1] 0.0 . . . . 0.128 [2] . . . . . 0.364 [3] 0.067 P 0.748 L 1.21 0.091 [4] . . . . . 0.063 [5] 0.018 B 0.051 N 0 0.08 [6] . . . . . 0.146

…

________________________________ seqinfo: 24 sequences from an unspecified genome` `> head(genes) GRanges object with 6 ranges and 20 metadata columns: seqnames ranges strand | source type score phase gene_id gene_type gene_name level | [1] 1 65419-71585 + | HAVANA gene ENSG00000186092.5 protein_coding OR4F5 2 [2] 1 65419-71585 + | HAVANA transcript ENSG00000186092.5 protein_coding OR4F5 2 [3] 1 65419-65433 + | HAVANA exon ENSG00000186092.5 protein_coding OR4F5 2 [4] 1 65520-65573 + | HAVANA exon ENSG00000186092.5 protein_coding OR4F5 2 [5] 1 69037-71585 + | HAVANA exon ENSG00000186092.5 protein_coding OR4F5 2 [6] 1 69091-70005 + | HAVANA CDS 0 ENSG00000186092.5 protein_coding OR4F5 2 havana_gene transcript_id transcript_type transcript_name transcript_support_level tag [1] OTTHUMG00000001094.3 [2] OTTHUMG00000001094.3 ENST00000641515.1 protein_coding OR4F5-202 appris_principal_1 [3] OTTHUMG00000001094.3 ENST00000641515.1 protein_coding OR4F5-202 appris_principal_1 [4] OTTHUMG00000001094.3 ENST00000641515.1 protein_coding OR4F5-202 appris_principal_1 [5] OTTHUMG00000001094.3 ENST00000641515.1 protein_coding OR4F5-202 appris_principal_1 [6] OTTHUMG00000001094.3 ENST00000641515.1 protein_coding OR4F5-202 appris_principal_1 havana_transcript exon_number exon_id ont protein_id ccdsid [1] [2] OTTHUMT00000003223.3 ENSP00000493376.1 [3] OTTHUMT00000003223.3 1 ENSE00003812156.1 ENSP00000493376.1 [4] OTTHUMT00000003223.3 2 ENSE00003813641.1 ENSP00000493376.1 [5] OTTHUMT00000003223.3 3 ENSE00003813949.1 ENSP00000493376.1 [6] OTTHUMT00000003223.3 3 ENSE00003813949.1 ENSP00000493376.1 seqinfo: 25 sequences from an unspecified genome; no seqlengths` — You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub<https://urldefense.proofpoint.com/v2/url?u=https-3A__github.com_mskilab_fishHook_issues_7-3Femail-5Fsource-3Dnotifications-26email-5Ftoken-3DABFUFY243LSU2FTKWIG57CTQXHQ5JA5CNFSM4JWL4JHKYY3PNVWWK3TUL52HS4DFVREXG43VMVBW63LNMVXHJKTDN5WW2ZLOORPWSZGOEGDCUQQ-23issuecomment-2D562440770&d=DwMCaQ&c=C9X8xNkG_lwP_-eFHTGejw&r=keZBxH6JuK9p4-nb6vzTlgDQy-idI21QN_zgWo2_gR0&m=4TWp3zbpiJN9OwU-lxokkhssYPrBHT8DrAMrk2Xcy2I&s=UY5Q8yuaz1nUAmwuTWR8Jf3VyjlR8I1JUIqLrHfIdXg&e=>, or unsubscribe<https://urldefense.proofpoint.com/v2/url?u=https-3A__github.com_notifications_unsubscribe-2Dauth_ABFUFY7FCRAM4OKCBZFB2ELQXHQ5JANCNFSM4JWL4JHA&d=DwMCaQ&c=C9X8xNkG_lwP_-eFHTGejw&r=keZBxH6JuK9p4-nb6vzTlgDQy-idI21QN_zgWo2_gR0&m=4TWp3zbpiJN9OwU-lxokkhssYPrBHT8DrAMrk2Xcy2I&s=ZbWQR50n_Q11ozpcRi3dODWmWli5bOJrfWFn_VT2pps&e=>.

________________________________ This message is for the recipient’s use only, and may contain confidential, privileged or protected information. Any unauthorized use or dissemination of this communication is prohibited. If you received this message in error, please immediately notify the sender and destroy all copies of this message. The recipient should check this email and any attachments for the presence of viruses, as we accept no liability for any damage caused by any virus transmitted by this email.

[a00101]

Oops. I totally missed it. Thanks.