moncla-lab: add initial IAV h5 datasets

data/community/moncla-lab/iav-h5/2.3.2.1/CHANGELOG.md

@@ -0,0 +1,5 @@
+## Unreleased
+
+Initial release for Nextclade v3!
+
+Read more about Nextclade datasets in the documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html

data/community/moncla-lab/iav-h5/2.3.2.1/README.md

@@ -0,0 +1,47 @@
+# H5Nx clade `2.3.2.1` dataset with A/duck/Vietnam/NCVD-1584/2012 reference
+
+| attribute            | value                                    |
+| -------------------- | ---------------------------------------- |
+| authors              |[Jordan Ort](https://lmoncla.github.io/monclalab/team/JordanOrt/), [Louise Moncla](https://lmoncla.github.io/monclalab/team/LouiseMoncla/)|
+| dataset name         | H5Nx clade `2.3.2.1` (provisional)         |
+| reference strain     | A/duck/Vietnam/NCVD-1584/2012(H5N1)      |
+| reference accession  | EPI424984                                |
+
+
+## Authors and contacts
+
+Maintained by: [Jordan Ort](https://lmoncla.github.io/monclalab/team/JordanOrt/)
+
+With the help from: [Louise Moncla](https://lmoncla.github.io/monclalab/team/LouiseMoncla/), Todd Davis, Tommy Lam, Samuel Shephard, Richard Neher
+
+## Scope of this dataset
+This dataset uses a current H5 candidate vaccine virus (CVV) from clade `2.3.2.1` (A/duck/Vietnam/NCVD-1584/2012) as a reference and is suitable for the analysis of H5 sequences belonging to clade `2.3.2.1` and its sub-clades `2.3.2.1a` through `2.3.2.1g`. Sequences belonging to other clades cannot be annotated by this dataset and will be left `unassigned`.
+
+## Features
+This dataset supports
+
+ * Assignment to clades and subclades based on the provisional nomenclature defined by the WHO/FAO/WOAH H5 Nomenclature Working Group
+ * Sequence quality control (QC)
+ * Phylogenetic placement
+ * Annotations for glycosylation sties, HA cleavage site sequence, and presence/absence of a polybasic cleavage site
+
+## Clades of H5Nx avian influenza viruses
+
+The WHO/FAO/WOAH H5 Nomenclature Working Group define "clades" using HA gene seguences, and define clades as genetically distinct, monophyletic groups of viruses. Viruses falling into a given clade share a common ancestor with significant bootstrap support and have low levels of within-clade diversity. [Past nomenclature updates](https://onlinelibrary.wiley.com/doi/10.1111/irv.12324) have required viruses in the same clade to be monophyletic with bootstrap suppor of at least 60%, with within-clade pairwise distances of less than 1.5%. These requirements are sometimes relaxed, and clades are periodically updated to account for expanding viral diversity. 
+
+Clade `2.3.2.1` viruses and their descendants have circulated since 2007 and are endemic in Southeast Asia. These viruses have diversified into eight additional sub-clades, named `2.3.2.1a` through `2.3.2.1g` due to high circulating diversity within the clade.
+This Nextclade dataset incorporates these provisional `2.3.2.1` sub-clades.
+
+## Alternative, and complementary approaches for H5 clade assignment
+Two additional tools exist for assigning clades to H5 viruses that accommodate the recent `2.3.2.1` clade splits. 
+
+1. [LABEL](https://wonder.cdc.gov/amd/flu/label/): this command-line tool is built and maintained by Sam Shepard, and performs clade assignment for all current `2.3.4.4` and `2.3.2.1` clade splits. 
+2. [BVBRC Subspecies Classification Tool](https://www.bv-brc.org/app/SubspeciesClassification): this is a drag and drop tool that classifies a variety of viruses, including influenza A H1N1, H3N2, and H5N1. 
+
+The clade assignments in this Nextclade dataset were validated against LABEL assignments and shown to be generally well-matched across subclades. The figure below shows a direct comparison of assignments for 1671 HA sequences from GISAID, performed using LABEL and this NextClade dataset for clade `2.3.2.1` and its subclades.
+
+![Figure 1: Comparison between LABEL and Nextclade for 2.3.2.1 assignments](https://github.com/moncla-lab/h5nx-Clades/blob/main/jordan-h5-clades/testing-nextclade-datasets/2321/files/20240430_2321.png)
+
+## What is Nextclade dataset
+
+Read more about Nextclade datasets in Nextclade documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html

data/community/moncla-lab/iav-h5/2.3.2.1/genome_annotation.gff3

@@ -0,0 +1,3 @@
+##gff-version 3
+##sequence-region EPI424984 1 1704
+EPI424984	feature	gene	1	1704	.	+	.	gene_name="HA"

data/community/moncla-lab/iav-h5/2.3.2.1/pathogen.json

@@ -0,0 +1,114 @@
+{
+  "alignmentParams": {
+    "excessBandwidth": 9,
+    "terminalBandwidth": 100,
+    "allowedMismatches": 4,
+    "gapAlignmentSide": "right",
+    "minSeedCover": 0.1
+  },
+  "attributes": {
+    "name": "H5Nx clade 2.3.2.1",
+    "refAccession": "EPI424984",
+    "refName": "A/duck/Vietnam/NCVD-1584/2012(H5N1)",
+    "experimental": true
+  },
+  "compatibility": {
+    "cli": "3.0.0-alpha.0",
+    "web": "3.0.0-alpha.0"
+  },
+  "defaultCds": "HA",
+  "deprecated": false,
+  "experimental": true,
+  "files": {
+    "changelog": "CHANGELOG.md",
+    "genomeAnnotation": "genome_annotation.gff3",
+    "pathogenJson": "pathogen.json",
+    "readme": "README.md",
+    "reference": "reference.fasta",
+    "treeJson": "tree.json",
+    "examples": "example_sequences.fasta"
+  },
+  "meta": {
+    "bugs": "https://github.com/nextstrain/nextclade_data/issues",
+    "source code": "https://github.com/nextstrain/nextclade_data"
+  },
+  "qc": {
+    "frameShifts": {
+      "enabled": true
+    },
+    "missingData": {
+      "enabled": false,
+      "missingDataThreshold": 100,
+      "scoreBias": 10
+    },
+    "mixedSites": {
+      "enabled": true,
+      "mixedSitesThreshold": 4
+    },
+    "privateMutations": {
+      "cutoff": 25,
+      "enabled": true,
+      "typical": 5
+    },
+    "snpClusters": {
+      "clusterCutOff": 5,
+      "enabled": false,
+      "scoreWeight": 50,
+      "windowSize": 100
+    },
+    "stopCodons": {
+      "enabled": true
+    }
+  },
+  "aaMotifs": [
+    {
+      "name": "glycosylation",
+      "nameShort": "Glyc.",
+      "nameFriendly": "Glycosylation",
+      "description": "N-linked glycosylation motifs (N-X-S/T with X any amino acid other than P)",
+      "includeCdses": [
+        {
+          "cds":"HA",
+          "ranges":[{"begin":0, "end":532}]
+        }
+      ],
+      "motifs": [
+        "N[^P][ST]"
+      ]
+    },
+    {
+      "name": "cleavage_site",
+      "nameShort": "CS",
+      "nameFriendly": "CleavageSite",
+      "description": "Cleavage site of HA",
+      "includeCdses": [
+        {
+          "cds":"HA",
+          "ranges":[{"begin":340, "end":345}]
+        }
+      ],
+      "motifs": [
+        "[A-Z-]{5}"
+      ]
+    },
+    {
+      "name": "polybasic_cleavage_site",
+      "nameShort": "PBCS",
+      "nameFriendly": "PolybasicCleavageSite",
+      "description": "Polybasic cleavage site of HA",
+      "includeCdses": [
+        {
+          "cds":"HA",
+          "ranges":[{"begin":340, "end":345}]
+        }
+      ],
+      "motifs": [
+        "^([A-Z-]*[RK][A-Z-]*){4}$"
+      ]
+    }
+  ],
+  "schemaVersion": "3.0.0",
+  "version": {
+    "tag": "unreleased"
+  }
+}

data/community/moncla-lab/iav-h5/2.3.2.1/reference.fasta

@@ -0,0 +1,30 @@
+>EPI424984 Influenza A virus (A/duck/Vietnam/NCVD-1584/2012(H5N1)) segment 4 hemagglutinin (HA) gene, complete cds
+ATGGAGAAAATAGTTCTTCTCTTTGCAACAATCAGCCTTGTCAAAAGCGATCATATTTGC
+ATTGGTTATCATGCAAATAACTCGACAGAGCAGGTTGACACAATAATGGAAAAGAACGTT
+ACTGTTACACATGCCCAAGACATACTGGAAAAGACACACAACGGGAAGCTCTGCGATCTA
+AATGGAGTGAAGCCTCTGATTTTAAAAGATTGTAGTGTAGCAGGATGGCTCCTCGGAAAT
+CCATTGTGTGACGAATTCACCAATGTGCCAGAATGGTCTTACATAGTAGAGAAGGCCAAT
+CCAGCCAATGACCTCTGTTACCCAGGGAATTTCAACGATTATGAAGAATTGAAACACCTA
+TTGAGCAGGATAAACCATTTTGAGAAAATACAGATCATCCCCAAAGATTCTTGGTCAGAT
+CATGAAGCCTCATTGGGGGTGAGTGCAGCATGTTCATACCAGGGAAATTCCTCCTTCTTC
+AGAAATGTGGTGTGGCTTATCAAAAAGGACAATGCATACCCAACAATAAAGAAAGGCTAC
+AATAATACCAACCGAGAAGATCTCTTGATACTGTGGGGGATCCACCATCCTAATGATGAG
+GCAGAGCAGACAAGGCTCTACCAAAACCCAACTACCTATATTTCCATTGGGACTTCAACA
+CTAAACCAGAGATTGGTACCAAAAATAGCCACTAGATCCAAAATAAACGGGCAAAGCGGC
+AGGATAGATTTCTTCTGGACAATTTTAAAACCGAATGACGCAATCCACTTCGAGAGTAAT
+GGAAATTTCATTGCTCCAGAATATGCATACAAAATTGTCAAGAAGGGAGACTCCACAATC
+ATGAGAAGTGAAGTGGAATATGGTAACTGCAACACCAGGTGTCAGACTCCAATAGGGGCG
+ATAAACTCTAGTATGCCATTCCACAACATACACCCTCTCACCATCGGAGAATGTCCCAAA
+TATGTGAAATCAAACAAATTAGTCCTTGCAACTGGGCTCAGAAATAGTCCTCAAAGAGAG
+AGAAGAAGAAAAAGAGGACTGTTTGGAGCTATAGCAGGTTTTATAGAGGGAGGATGGCAG
+GGAATGGTAGATGGTTGGTATGGGTACCACCACAGCAATGAACAGGGGAGTGGTTACGCT
+GCAGACAAAGAATCTACTCAAAAGGCGATAGACGGAGTCACCAATAAGGTCAATTCGATC
+ATTGACAAAATGAACACTCAGTTTGAGGCTGTAGGAAGGGAATTTAATAACTTAGAGAGG
+AGAATAGAAAATTTAAACAAGAAGATGGAAGACGGATTCCTAGATGTCTGGACTTATAAT
+GCTGAACTTCTGGTTCTCATGGAGAATGAGAGAACTCTAGACTTCCATGACTCAAATGTC
+AAGAACCTTTACGATAAGGTCCGACTACAGCTTAAGGATAATGCAAAAGAGCTGGGAAAC
+GGTTGTTTCGAGTTCTATCACAAATGTAATAATGAATGTATGGAAAGTGTAAGAAACGGG
+ACGTATGACTACCCGCAGTATTCAGAAGAAGCAAGATTAAAAAGAGAGGAAATAAGTGGA
+GTAAAACTGGAATCAATAGGAATCTACCAAATACTGTCAATTTATTCAACAGTGGCGAGT
+TCCCTAGTGCTGGCAATCATGATGGCTGGTCTATCTTTATGGATGTGTTCCAACGGGTCG
+TTACAGTGCAGAATTTGCATTTAA