flu: update IAV HA datasets after promotion of subclades

data/nextstrain/flu/h1n1pdm/ha/CY121680/CHANGELOG.md

@@ -1,8 +1,13 @@
+## Unreleased
+
+This release adds the subclade D.5 as specified in the (influenza-clade-nomenclature repository)[https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_HA/blob/main/CHANGELOG.md#2024-11-12].
+
 ## 2024-11-05T09:19:52Z
 
  - update reference trees
  - include subclade proposals
 
+
 ## 2024-07-03T08:29:55Z
 
  - add representative samples from early pandemic-era clades including 1, 2, 3, 4, 6C, 7, and 8 to improve clade label annotations for older sequences

data/nextstrain/flu/h1n1pdm/ha/MW626062/CHANGELOG.md

@@ -1,9 +1,14 @@
+## Unreleased
+
+This release adds the subclade D.5 as specified in the (influenza-clade-nomenclature repository)[https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_HA/blob/main/CHANGELOG.md#2024-11-12].
+
 ## 2024-11-05T09:19:52Z
 
  - update reference trees
  - include subclade proposals
 
-## 2024-07-03T08:29:55Z
+
+ ## 2024-07-03T08:29:55Z
 
 Added configuration of current and recent vaccine strains as 'reference nodes' on the reference tree, against which query sequences can be compared. This feature is in addition to the new 'compare to clade founder' feature, allowing to compare each query sequence to the most ancestral node of a clade or lineage.
 

data/nextstrain/flu/h3n2/ha/CY163680/CHANGELOG.md

@@ -1,5 +1,7 @@
-## 2024-11-05T09:19:52Z
+## Unreleased
+This release adds the subclades J.1.1, J.2.1, and J.2.2 as specified in the (influenza-clade-nomenclature repository)[https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_HA/blob/main/CHANGELOG.md#2024-11-12].
 
+## 2024-11-05T09:19:52Z
  - update reference trees
  - include subclade proposals
 

data/nextstrain/flu/h3n2/ha/EPI1857216/CHANGELOG.md

@@ -1,8 +1,11 @@
-## 2024-11-05T09:19:52Z
+## Unreleased
+This release adds the subclades J.1.1, J.2.1, and J.2.2 as specified in the (influenza-clade-nomenclature repository)[https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_HA/blob/main/CHANGELOG.md#2024-11-12].
 
+## 2024-11-05T09:19:52Z
  - update reference trees
  - include subclade proposals
 
+
 ## 2024-08-08T05:08:21Z
 
 Fix numbering of RBD sites it the `pathogen.json`. The relevant positions were indexed 1-based, when they should have been indexed 0-based.

data_output/index.json

@@ -804,7 +804,7 @@
             "clades": 25,
             "customClades": {
               "short-clade": 16,
-              "subclade": 21,
+              "subclade": 22,
               "proposedSubclade": 22
             },
             "qc": [
@@ -818,6 +818,13 @@
             ]
           },
           "versions": [
+            {
+              "tag": "unreleased",
+              "compatibility": {
+                "cli": "3.0.0-alpha.0",
+                "web": "3.0.0-alpha.0"
+              }
+            },
             {
               "updatedAt": "2024-11-05T09:19:52Z",
               "tag": "2024-11-05--09-19-52Z",
@@ -852,8 +859,7 @@
             }
           ],
           "version": {
-            "updatedAt": "2024-11-05T09:19:52Z",
-            "tag": "2024-11-05--09-19-52Z",
+            "tag": "unreleased",
             "compatibility": {
               "cli": "3.0.0-alpha.0",
               "web": "3.0.0-alpha.0"
@@ -909,7 +915,7 @@
             "clades": 25,
             "customClades": {
               "short-clade": 16,
-              "subclade": 21,
+              "subclade": 22,
               "proposedSubclade": 22
             },
             "qc": [
@@ -923,6 +929,13 @@
             ]
           },
           "versions": [
+            {
+              "tag": "unreleased",
+              "compatibility": {
+                "cli": "3.0.0-alpha.0",
+                "web": "3.0.0-alpha.0"
+              }
+            },
             {
               "updatedAt": "2024-11-05T09:19:52Z",
               "tag": "2024-11-05--09-19-52Z",
@@ -957,8 +970,7 @@
             }
           ],
           "version": {
-            "updatedAt": "2024-11-05T09:19:52Z",
-            "tag": "2024-11-05--09-19-52Z",
+            "tag": "unreleased",
             "compatibility": {
               "cli": "3.0.0-alpha.0",
               "web": "3.0.0-alpha.0"
@@ -1113,7 +1125,7 @@
           "capabilities": {
             "clades": 37,
             "customClades": {
-              "subclade": 42,
+              "subclade": 45,
               "short-clade": 37,
               "proposedSubclade": 45
             },
@@ -1128,6 +1140,13 @@
             ]
           },
           "versions": [
+            {
+              "tag": "unreleased",
+              "compatibility": {
+                "cli": "3.0.0-alpha.0",
+                "web": "3.0.0-alpha.0"
+              }
+            },
             {
               "updatedAt": "2024-11-05T09:19:52Z",
               "tag": "2024-11-05--09-19-52Z",
@@ -1170,8 +1189,7 @@
             }
           ],
           "version": {
-            "updatedAt": "2024-11-05T09:19:52Z",
-            "tag": "2024-11-05--09-19-52Z",
+            "tag": "unreleased",
             "compatibility": {
               "cli": "3.0.0-alpha.0",
               "web": "3.0.0-alpha.0"
@@ -1226,7 +1244,7 @@
           "capabilities": {
             "clades": 34,
             "customClades": {
-              "subclade": 39,
+              "subclade": 42,
               "short-clade": 34,
               "proposedSubclade": 42
             },
@@ -1242,6 +1260,13 @@
             ]
           },
           "versions": [
+            {
+              "tag": "unreleased",
+              "compatibility": {
+                "cli": "3.0.0-alpha.0",
+                "web": "3.0.0-alpha.0"
+              }
+            },
             {
               "updatedAt": "2024-11-05T09:19:52Z",
               "tag": "2024-11-05--09-19-52Z",
@@ -1292,8 +1317,7 @@
             }
           ],
           "version": {
-            "updatedAt": "2024-11-05T09:19:52Z",
-            "tag": "2024-11-05--09-19-52Z",
+            "tag": "unreleased",
             "compatibility": {
               "cli": "3.0.0-alpha.0",
               "web": "3.0.0-alpha.0"

data_output/nextstrain/flu/h1n1pdm/ha/CY121680/unreleased/CHANGELOG.md

@@ -0,0 +1,31 @@
+## Unreleased
+
+This release adds the subclade D.5 as specified in the (influenza-clade-nomenclature repository)[https://github.com/influenza-clade-nomenclature/seasonal_A-H3N2_HA/blob/main/CHANGELOG.md#2024-11-12].
+
+## 2024-11-05T09:19:52Z
+
+ - update reference trees
+ - include subclade proposals
+
+
+## 2024-07-03T08:29:55Z
+
+ - add representative samples from early pandemic-era clades including 1, 2, 3, 4, 6C, 7, and 8 to improve clade label annotations for older sequences
+
+ - added configuration of current and recent vaccine strains as 'reference nodes' on the reference tree, against which query sequences can be compared. This feature is in addition to the new 'compare to clade founder' feature, allowing to compare each query sequence to the most ancestral node of a clade or lineage. See Nextclade documentation for more details about 'relative mutations' functionality.
+
+## 2024-04-19T07:50:39Z
+
+ - aliasing of C.1.1.1 as D
+ - addition of subclades D.1 - D.4: [D.1](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/blob/main/subclades/D.1.yml), [D.2](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/blob/main/subclades/D.2.yml), [D.3](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/blob/main/subclades/D.3.yml), [D.4](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/blob/main/subclades/D.4.yml)
+ - addition of subclades [C.1.8](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/blob/main/subclades/C.1.8.yml) and [C.1.9](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/blob/main/subclades/C.1.9.yml)
+ - addition of subclades [C.1.7.1](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/blob/main/subclades/C.1.7.1.yml) and [C.1.7.2](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/blob/main/subclades/C.1.7.2.yml)
+
+
+## 2024-01-16T20:31:02Z
+
+Initial release for Nextclade v3!
+
+ - addition of subclade [C.1.7](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/blob/main/subclades/C.1.7.yml)
+
+Read more about Nextclade datasets in the documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html

data_output/nextstrain/flu/h1n1pdm/ha/CY121680/unreleased/README.md

@@ -0,0 +1,40 @@
+# Influenza A(H1N1pdm) HA based on reference "A/California/07/2009"
+
+| Key                  | Value                |
+| -------------------- | -------------------- |
+| authors                | [Richard Neher](https://neherlab.org), [Nextstrain](https://nextstrain.org)                         |
+| name                 | Influenza A(H1N1pdm) HA                      |
+| reference            | A/California/07/2009                      |
+| dataset path         | flu/h1n1pdm/ha/CY121680                     |
+| reference accession  | CY121680   |
+| clade definitions  |  [github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/)  |
+
+
+## Scope of this dataset
+This dataset uses an older reference sequence (A/California/07/2009) and recent sequences will differ at a large number of positions from this reference.
+For the analysis of currently circulating viruses, the dataset using A/Wisconsin/588/2019 as reference might be more appropriate.
+
+## Features
+This dataset supports
+
+ * Assignment to clades and subclades based on the nomenclature defined in [github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/)
+ * Identification of glycosilation motifs
+ * Sequence QC
+ * Phylogenetic placement
+
+## Clades of seasonal influenza viruses
+
+The WHO Collaborating centers define "clades" as genetic groups of viruses with signature mutations to facilitate discussion of circulating diversity of the viruses.
+Clade demarcation do not always coincide with significantly different antigenic properties of the viruses.
+Clade names are structured as _Number-Letter_ binomials separated by periods as in `6B.1A.5a.2a.1`. These sometimes get shortened by omission of leading binomials like `5a.2a.1`.
+
+In addition to these clades, "subclades" are defined to break down diversity at higher resolution and allow following the spread of different viral groups.
+These follow a Pango-like nomenclature consisting of a letter followed by a numbers separated by periods as in `C.1.2`.
+The leading letter is an alias of a previous name.
+Details of the nomenclature system can be found at [github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/](https://github.com/influenza-clade-nomenclature/seasonal_A-H1N1pdm_HA/).
+
+
+
+## What is Nextclade dataset
+
+Read more about Nextclade datasets in Nextclade documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html

data_output/nextstrain/flu/h1n1pdm/ha/CY121680/unreleased/genome_annotation.gff3

@@ -0,0 +1,5 @@
+##gff-version 3
+##sequence-region CY121680.1 1 1752
+CY121680.1	feature	gene	21	71	.	+	.	gene_name="SigPep"
+CY121680.1	feature	gene	72	1052	.	+	.	gene_name="HA1"
+CY121680.1	feature	gene	1053	1718	.	+	.	gene_name="HA2"

data_output/nextstrain/flu/h1n1pdm/ha/CY121680/unreleased/pathogen.json

@@ -0,0 +1,126 @@
+{
+  "schemaVersion": "3.0.0",
+  "alignmentParams": {
+    "excessBandwidth": 9,
+    "terminalBandwidth": 100,
+    "allowedMismatches": 4,
+    "gapAlignmentSide": "right",
+    "minSeedCover": 0.1
+  },
+  "compatibility": {
+    "cli": "3.0.0-alpha.0",
+    "web": "3.0.0-alpha.0"
+  },
+  "defaultCds": "HA1",
+  "files": {
+    "changelog": "CHANGELOG.md",
+    "examples": "sequences.fasta",
+    "genomeAnnotation": "genome_annotation.gff3",
+    "pathogenJson": "pathogen.json",
+    "readme": "README.md",
+    "reference": "reference.fasta",
+    "treeJson": "tree.json"
+  },
+  "qc": {
+    "privateMutations": {
+      "enabled": true,
+      "typical": 5,
+      "cutoff": 15,
+      "weightLabeledSubstitutions": 2,
+      "weightReversionSubstitutions": 1,
+      "weightUnlabeledSubstitutions": 1
+    },
+    "missingData": {
+      "enabled": false,
+      "missingDataThreshold": 100,
+      "scoreBias": 10
+    },
+    "snpClusters": {
+      "enabled": false,
+      "windowSize": 100,
+      "clusterCutOff": 5,
+      "scoreWeight": 50
+    },
+    "mixedSites": {
+      "enabled": true,
+      "mixedSitesThreshold": 4
+    },
+    "frameShifts": {
+      "enabled": true
+    },
+    "stopCodons": {
+      "enabled": true,
+      "ignoredStopCodons": []
+    }
+  },
+  "cdsOrderPreference": [
+    "HA1",
+    "HA2"
+  ],
+  "maintenance": {
+    "website": [
+      "https://nextstrain.org",
+      "https://clades.nextstrain.org"
+    ],
+    "documentation": [
+      "https://github.com/nextstrain/seasonal-flu"
+    ],
+    "source code": [
+      "https://github.com/nextstrain/seasonal_flu"
+    ],
+    "issues": [
+      "https://github.com/nextstrain/seasonal_flu/issues"
+    ],
+    "organizations": [
+      "Nextstrain"
+    ],
+    "authors": [
+      "Nextstrain team <https://nextstrain.org>"
+    ]
+  },
+  "nucMutLabelMap": {},
+  "nucMutLabelMapReverse": {},
+  "shortcuts": [
+    "flu_h1n1pdm_ha_broad",
+    "nextstrain/flu/h1n1pdm/ha/california-7-2009"
+  ],
+  "aaMotifs": [
+    {
+      "name": "glycosylation",
+      "nameShort": "Glyc.",
+      "nameFriendly": "Glycosylation",
+      "description": "N-linked glycosylation motifs (N-X-S/T with X any amino acid other than P)",
+      "includeCdses": [
+        {
+          "cds": "HA1",
+          "ranges": []
+        },
+        {
+          "cds": "HA2",
+          "ranges": [
+            {
+              "begin": 0,
+              "end": 186
+            }
+          ]
+        }
+      ],
+      "motifs": [
+        "N[^P][ST]"
+      ]
+    }
+  ],
+  "attributes": {
+    "name": "Influenza A H1N1pdm HA",
+    "segment": "ha",
+    "reference accession": "CY121680",
+    "reference name": "A/California/7/2009-egg"
+  },
+  "version": {
+    "tag": "unreleased",
+    "compatibility": {
+      "cli": "3.0.0-alpha.0",
+      "web": "3.0.0-alpha.0"
+    }
+  }
+}

data_output/nextstrain/flu/h1n1pdm/ha/CY121680/unreleased/reference.fasta

@@ -0,0 +1,2 @@
+>CY121680.1 Influenza A virus (A/California/07/2009(H1N1)) hemagglutinin (HA) gene, complete cds
+GGAAAACAAAAGCAACAAAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGTTAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGTCCTACATTGTGGAAACACCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAAATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGTCATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGGATCGAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAAACACCCAAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAATATCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATTGCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGCAGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAATTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGAATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGGTTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAGAAGCCAGCTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAACACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAAGCAAAATTAAACAGAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAACTGTCGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTAATGGGTCTCTACAGTGTAGAATATGTATTTAACATTAGGATTTCAGAAGCATGAGAAAAACAC