diff --git a/docs/notebooks/CRISPR.ipynb b/docs/notebooks/CRISPR.ipynb index 4ecdfe0d..dfc450ba 100644 --- a/docs/notebooks/CRISPR.ipynb +++ b/docs/notebooks/CRISPR.ipynb @@ -13,9 +13,18 @@ "The `pydna.crispr` module contains the `cas9` class to simulate the biological activites of the Cas9 protein and the guideRNA, which should be imported. In addtion, the `Dseqrecord` class has also been imported to generate an example target_sequence." ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "\n", + " \"Open\n", + "" + ] + }, { "cell_type": "code", - "execution_count": null, + "execution_count": 1, "metadata": {}, "outputs": [], "source": [ @@ -34,15 +43,7 @@ "cell_type": "code", "execution_count": null, "metadata": {}, - "outputs": [ - { - "name": "stdout", - "output_type": "stream", - "text": [ - "[]\n" - ] - } - ], + "outputs": [], "source": [ "# Defining the target sequence\n", "sequence = Dseqrecord(\"GTTACTTTACCCGACGTCCCCGG\")\n", @@ -56,15 +57,7 @@ "cell_type": "code", "execution_count": null, "metadata": {}, - "outputs": [ - { - "name": "stdout", - "output_type": "stream", - "text": [ - "0\n" - ] - } - ], + "outputs": [], "source": [ "# Initializing the Cas9 protein\n", "enzyme = cas9(protospacer=gRNA_sequence[0])\n", @@ -95,7 +88,7 @@ "name": "python", "nbconvert_exporter": "python", "pygments_lexer": "ipython3", - "version": "3.12.4" + "version": "3.11.9" } }, "nbformat": 4, diff --git a/docs/notebooks/Dseq.ipynb b/docs/notebooks/Dseq.ipynb index bb96da49..51cc99ea 100644 --- a/docs/notebooks/Dseq.ipynb +++ b/docs/notebooks/Dseq.ipynb @@ -8,6 +8,15 @@ "> Visit the full library documentation [here](https://bjornfjohansson.github.io/pydna/)" ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "\n", + " \"Open\n", + "" + ] + }, { "cell_type": "markdown", "metadata": {}, diff --git a/docs/notebooks/Dseq_Features.ipynb b/docs/notebooks/Dseq_Features.ipynb index e25158d0..e23af24d 100644 --- a/docs/notebooks/Dseq_Features.ipynb +++ b/docs/notebooks/Dseq_Features.ipynb @@ -15,6 +15,15 @@ "pydna offers many ways to easily view, add, extract, and write features into a Genbank file via the `Dseqrecord` class. After reading a file into a `Dseqrecord` object, we can check out the list of features in the record using the following code. This example uses the sample record [U49845](https://www.ncbi.nlm.nih.gov/genbank/samplerecord/)." ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "\n", + " \"Open\n", + "" + ] + }, { "cell_type": "code", "execution_count": null, diff --git a/docs/notebooks/Example_Gibson.ipynb b/docs/notebooks/Example_Gibson.ipynb index 8c514bf6..972948e9 100644 --- a/docs/notebooks/Example_Gibson.ipynb +++ b/docs/notebooks/Example_Gibson.ipynb @@ -12,9 +12,18 @@ "Source files can be found alongside this notebook, if you would like to follow along. Annotations are made alongside the code to describe key steps.\n" ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "\n", + " \"Open\n", + "" + ] + }, { "cell_type": "code", - "execution_count": null, + "execution_count": 1, "metadata": {}, "outputs": [], "source": [ @@ -31,169 +40,7 @@ "cell_type": "code", "execution_count": null, "metadata": {}, - "outputs": [ - { - "name": "stdout", - "output_type": "stream", - "text": [ - "LOCUS EU140750 8128 bp DNA circular SYN 15-SEP-2007\n", - "DEFINITION Cloning vector pCC1BAC, complete sequence.\n", - "ACCESSION EU140750\n", - "VERSION EU140750.1\n", - "KEYWORDS .\n", - "SOURCE Cloning vector pCC1BAC\n", - " ORGANISM Cloning vector pCC1BAC\n", - " other sequences; artificial sequences; vectors.\n", - "REFERENCE 1 (bases 1 to 8128)\n", - " AUTHORS EPICENTRE Biotechnologies.\n", - " TITLE Direct Submission\n", - " JOURNAL Submitted (23-AUG-2007) 726 Post Road, Madison, WI 53713, USA\n", - "FEATURES Location/Qualifiers\n", - " source 1..8128\n", - " /organism=\"Cloning vector pCC1BAC\"\n", - " /mol_type=\"other DNA\"\n", - " /db_xref=\"taxon:468515\"\n", - "ORIGIN\n", - " 1 gcggccgcaa ggggttcgcg tcagcgggtg ttggcgggtg tcggggctgg cttaactatg\n", - " 61 cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccacacagat\n", - " 121 gcgtaaggag aaaataccgc atcaggcgcc attcgccatt cagctgcgca actgttggga\n", - " 181 agggcgatcg gtgcgggcct cttcgctatt acgccagctg gcgaaagggg gatgtgctgc\n", - " 241 aaggcgatta agttgggtaa cgccagggtt ttcccagtca cgacgttgta aaacgacggc\n", - " 301 cagtgaattg taatacgact cactataggg cgaattcgag ctcggtaccc ggggatcctc\n", - " 361 tagagtcgac ctgcaggcat gcaagcttga gtattctata gtctcaccta aatagcttgg\n", - " 421 cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca\n", - " 481 acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca\n", - " 541 cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc\n", - " 601 attaatgaat cggccaacgc gaaccccttg cggccgcccg ggccgtcgac caattctcat\n", - " 661 gtttgacagc ttatcatcga atttctgcca ttcatccgct tattatcact tattcaggcg\n", - " 721 tagcaaccag gcgtttaagg gcaccaataa ctgccttaaa aaaattacgc cccgccctgc\n", - " 781 cactcatcgc agtactgttg taattcatta agcattctgc cgacatggaa gccatcacaa\n", - " 841 acggcatgat gaacctgaat cgccagcggc atcagcacct tgtcgccttg cgtataatat\n", - " 901 ttgcccatgg tgaaaacggg ggcgaagaag ttgtccatat tggccacgtt taaatcaaaa\n", - " 961 ctggtgaaac tcacccaggg attggctgag acgaaaaaca tattctcaat aaacccttta\n", - " 1021 gggaaatagg ccaggttttc accgtaacac gccacatctt gcgaatatat gtgtagaaac\n", - " 1081 tgccggaaat cgtcgtggta ttcactccag agcgatgaaa acgtttcagt ttgctcatgg\n", - " 1141 aaaacggtgt aacaagggtg aacactatcc catatcacca gctcaccgtc tttcattgcc\n", - " 1201 atacgaaatt ccggatgagc attcatcagg cgggcaagaa tgtgaataaa ggccggataa\n", - " 1261 aacttgtgct tatttttctt tacggtcttt aaaaaggccg taatatccag ctgaacggtc\n", - " 1321 tggttatagg tacattgagc aactgactga aatgcctcaa aatgttcttt acgatgccat\n", - " 1381 tgggatatat caacggtggt atatccagtg atttttttct ccattttagc ttccttagct\n", - " 1441 cctgaaaatc tcgataactc aaaaaatacg cccggtagtg atcttatttc attatggtga\n", - " 1501 aagttggaac ctcttacgtg ccgatcaacg tctcattttc gccaaaagtt ggcccagggc\n", - " 1561 ttcccggtat caacagggac accaggattt atttattctg cgaagtgatc ttccgtcaca\n", - " 1621 ggtatttatt cgcgataagc tcatggagcg gcgtaaccgt cgcacaggaa ggacagagaa\n", - " 1681 agcgcggatc tgggaagtga cggacagaac ggtcaggacc tggattgggg aggcggttgc\n", - " 1741 cgccgctgct gctgacggtg tgacgttctc tgttccggtc acaccacata cgttccgcca\n", - " 1801 ttcctatgcg atgcacatgc tgtatgccgg tataccgctg aaagttctgc aaagcctgat\n", - " 1861 gggacataag tccatcagtt caacggaagt ctacacgaag gtttttgcgc tggatgtggc\n", - " 1921 tgcccggcac cgggtgcagt ttgcgatgcc ggagtctgat gcggttgcga tgctgaaaca\n", - " 1981 attatcctga gaataaatgc cttggccttt atatggaaat gtggaactga gtggatatgc\n", - " 2041 tgtttttgtc tgttaaacag agaagctggc tgttatccac tgagaagcga acgaaacagt\n", - " 2101 cgggaaaatc tcccattatc gtagagatcc gcattattaa tctcaggagc ctgtgtagcg\n", - " 2161 tttataggaa gtagtgttct gtcatgatgc ctgcaagcgg taacgaaaac gatttgaata\n", - " 2221 tgccttcagg aacaatagaa atcttcgtgc ggtgttacgt tgaagtggag cggattatgt\n", - " 2281 cagcaatgga cagaacaacc taatgaacac agaaccatga tgtggtctgt ccttttacag\n", - " 2341 ccagtagtgc tcgccgcagt cgagcgacag ggcgaagccc tcgagctggt tgccctcgcc\n", - " 2401 gctgggctgg cggccgtcta tggccctgca aacgcgccag aaacgccgtc gaagccgtgt\n", - " 2461 gcgagacacc gcggccggcc gccggcgttg tggatacctc gcggaaaact tggccctcac\n", - " 2521 tgacagatga ggggcggacg ttgacacttg aggggccgac tcacccggcg cggcgttgac\n", - " 2581 agatgagggg caggctcgat ttcggccggc gacgtggagc tggccagcct cgcaaatcgg\n", - " 2641 cgaaaacgcc tgattttacg cgagtttccc acagatgatg tggacaagcc tggggataag\n", - " 2701 tgccctgcgg tattgacact tgaggggcgc gactactgac agatgagggg cgcgatcctt\n", - " 2761 gacacttgag gggcagagtg ctgacagatg aggggcgcac ctattgacat ttgaggggct\n", - " 2821 gtccacaggc agaaaatcca gcatttgcaa gggtttccgc ccgtttttcg gccaccgcta\n", - " 2881 acctgtcttt taacctgctt ttaaaccaat atttataaac cttgttttta accagggctg\n", - " 2941 cgccctgtgc gcgtgaccgc gcacgccgaa ggggggtgcc cccccttctc gaaccctccc\n", - " 3001 ggtcgagtga gcgaggaagc accagggaac agcacttata tattctgctt acacacgatg\n", - " 3061 cctgaaaaaa cttcccttgg ggttatccac ttatccacgg ggatattttt ataattattt\n", - " 3121 tttttatagt ttttagatct tcttttttag agcgccttgt aggcctttat ccatgctggt\n", - " 3181 tctagagaag gtgttgtgac aaattgccct ttcagtgtga caaatcaccc tcaaatgaca\n", - " 3241 gtcctgtctg tgacaaattg cccttaaccc tgtgacaaat tgccctcaga agaagctgtt\n", - " 3301 ttttcacaaa gttatccctg cttattgact cttttttatt tagtgtgaca atctaaaaac\n", - " 3361 ttgtcacact tcacatggat ctgtcatggc ggaaacagcg gttatcaatc acaagaaacg\n", - " 3421 taaaaatagc ccgcgaatcg tccagtcaaa cgacctcact gaggcggcat atagtctctc\n", - " 3481 ccgggatcaa aaacgtatgc tgtatctgtt cgttgaccag atcagaaaat ctgatggcac\n", - " 3541 cctacaggaa catgacggta tctgcgagat ccatgttgct aaatatgctg aaatattcgg\n", - " 3601 attgacctct gcggaagcca gtaaggatat acggcaggca ttgaagagtt tcgcggggaa\n", - " 3661 ggaagtggtt ttttatcgcc ctgaagagga tgccggcgat gaaaaaggct atgaatcttt\n", - " 3721 tccttggttt atcaaacgtg cgcacagtcc atccagaggg ctttacagtg tacatatcaa\n", - " 3781 cccatatctc attcccttct ttatcgggtt acagaaccgg tttacgcagt ttcggcttag\n", - " 3841 tgaaacaaaa gaaatcacca atccgtatgc catgcgttta tacgaatccc tgtgtcagta\n", - " 3901 tcgtaagccg gatggctcag gcatcgtctc tctgaaaatc gactggatca tagagcgtta\n", - " 3961 ccagctgcct caaagttacc agcgtatgcc tgacttccgc cgccgcttcc tgcaggtctg\n", - " 4021 tgttaatgag atcaacagca gaactccaat gcgcctctca tacattgaga aaaagaaagg\n", - " 4081 ccgccagacg actcatatcg tattttcctt ccgcgatatc acttccatga cgacaggata\n", - " 4141 gtctgagggt tatctgtcac agatttgagg gtggttcgtc acatttgttc tgacctactg\n", - " 4201 agggtaattt gtcacagttt tgctgtttcc ttcagcctgc atggattttc tcatactttt\n", - " 4261 tgaactgtaa tttttaagga agccaaattt gagggcagtt tgtcacagtt gatttccttc\n", - " 4321 tctttccctt cgtcatgtga cctgatatcg ggggttagtt cgtcatcatt gatgagggtt\n", - " 4381 gattatcaca gtttattact ctgaattggc tatccgcgtg tgtacctcta cctggagttt\n", - " 4441 ttcccacggt ggatatttct tcttgcgctg agcgtaagag ctatctgaca gaacagttct\n", - " 4501 tctttgcttc ctcgccagtt cgctcgctat gctcggttac acggctgcgg cgagcgctag\n", - " 4561 tgataataag tgactgaggt atgtgctctt cttatctcct tttgtagtgt tgctcttatt\n", - " 4621 ttaaacaact ttgcggtttt ttgatgactt tgcgattttg ttgttgcttt gcagtaaatt\n", - " 4681 gcaagattta ataaaaaaac gcaaagcaat gattaaagga tgttcagaat gaaactcatg\n", - " 4741 gaaacactta accagtgcat aaacgctggt catgaaatga cgaaggctat cgccattgca\n", - " 4801 cagtttaatg atgacagccc ggaagcgagg aaaataaccc ggcgctggag aataggtgaa\n", - " 4861 gcagcggatt tagttggggt ttcttctcag gctatcagag atgccgagaa agcagggcga\n", - " 4921 ctaccgcacc cggatatgga aattcgagga cgggttgagc aacgtgttgg ttatacaatt\n", - " 4981 gaacaaatta atcatatgcg tgatgtgttt ggtacgcgat tgcgacgtgc tgaagacgta\n", - " 5041 tttccaccgg tgatcggggt tgctgcccat aaaggtggcg tttacaaaac ctcagtttct\n", - " 5101 gttcatcttg ctcaggatct ggctctgaag gggctacgtg ttttgctcgt ggaaggtaac\n", - " 5161 gacccccagg gaacagcctc aatgtatcac ggatgggtac cagatcttca tattcatgca\n", - " 5221 gaagacactc tcctgccttt ctatcttggg gaaaaggacg atgtcactta tgcaataaag\n", - " 5281 cccacttgct ggccggggct tgacattatt ccttcctgtc tggctctgca ccgtattgaa\n", - " 5341 actgagttaa tgggcaaatt tgatgaaggt aaactgccca ccgatccaca cctgatgctc\n", - " 5401 cgactggcca ttgaaactgt tgctcatgac tatgatgtca tagttattga cagcgcgcct\n", - " 5461 aacctgggta tcggcacgat taatgtcgta tgtgctgctg atgtgctgat tgttcccacg\n", - " 5521 cctgctgagt tgtttgacta cacctccgca ctgcagtttt tcgatatgct tcgtgatctg\n", - " 5581 ctcaagaacg ttgatcttaa agggttcgag cctgatgtac gtattttgct taccaaatac\n", - " 5641 agcaatagca atggctctca gtccccgtgg atggaggagc aaattcggga tgcctgggga\n", - " 5701 agcatggttc taaaaaatgt tgtacgtgaa acggatgaag ttggtaaagg tcagatccgg\n", - " 5761 atgagaactg tttttgaaca ggccattgat caacgctctt caactggtgc ctggagaaat\n", - " 5821 gctctttcta tttgggaacc tgtctgcaat gaaattttcg atcgtctgat taaaccacgc\n", - " 5881 tgggagatta gataatgaag cgtgcgcctg ttattccaaa acatacgctc aatactcaac\n", - " 5941 cggttgaaga tacttcgtta tcgacaccag ctgccccgat ggtggattcg ttaattgcgc\n", - " 6001 gcgtaggagt aatggctcgc ggtaatgcca ttactttgcc tgtatgtggt cgggatgtga\n", - " 6061 agtttactct tgaagtgctc cggggtgata gtgttgagaa gacctctcgg gtatggtcag\n", - " 6121 gtaatgaacg tgaccaggag ctgcttactg aggacgcact ggatgatctc atcccttctt\n", - " 6181 ttctactgac tggtcaacag acaccggcgt tcggtcgaag agtatctggt gtcatagaaa\n", - " 6241 ttgccgatgg gagtcgccgt cgtaaagctg ctgcacttac cgaaagtgat tatcgtgttc\n", - " 6301 tggttggcga gctggatgat gagcagatgg ctgcattatc cagattgggt aacgattatc\n", - " 6361 gcccaacaag tgcttatgaa cgtggtcagc gttatgcaag ccgattgcag aatgaatttg\n", - " 6421 ctggaaatat ttctgcgctg gctgatgcgg aaaatatttc acgtaagatt attacccgct\n", - " 6481 gtatcaacac cgccaaattg cctaaatcag ttgttgctct tttttctcac cccggtgaac\n", - " 6541 tatctgcccg gtcaggtgat gcacttcaaa aagcctttac agataaagag gaattactta\n", - " 6601 agcagcaggc atctaacctt catgagcaga aaaaagctgg ggtgatattt gaagctgaag\n", - " 6661 aagttatcac tcttttaact tctgtgctta aaacgtcatc tgcatcaaga actagtttaa\n", - " 6721 gctcacgaca tcagtttgct cctggagcga cagtattgta taagggcgat aaaatggtgc\n", - " 6781 ttaacctgga caggtctcgt gttccaactg agtgtataga gaaaattgag gccattctta\n", - " 6841 aggaacttga aaagccagca ccctgatgcg accacgtttt agtctacgtt tatctgtctt\n", - " 6901 tacttaatgt cctttgttac aggccagaaa gcataactgg cctgaatatt ctctctgggc\n", - " 6961 ccactgttcc acttgtatcg tcggtctgat aatcagactg ggaccacggt cccactcgta\n", - " 7021 tcgtcggtct gattattagt ctgggaccac ggtcccactc gtatcgtcgg tctgattatt\n", - " 7081 agtctgggac cacggtccca ctcgtatcgt cggtctgata atcagactgg gaccacggtc\n", - " 7141 ccactcgtat cgtcggtctg attattagtc tgggaccatg gtcccactcg tatcgtcggt\n", - " 7201 ctgattatta gtctgggacc acggtcccac tcgtatcgtc ggtctgatta ttagtctgga\n", - " 7261 accacggtcc cactcgtatc gtcggtctga ttattagtct gggaccacgg tcccactcgt\n", - " 7321 atcgtcggtc tgattattag tctgggacca cgatcccact cgtgttgtcg gtctgattat\n", - " 7381 cggtctggga ccacggtccc acttgtattg tcgatcagac tatcagcgtg agactacgat\n", - " 7441 tccatcaatg cctgtcaagg gcaagtattg acatgtcgtc gtaacctgta gaacggagta\n", - " 7501 acctcggtgt gcggttgtat gcctgctgtg gattgctgct gtgtcctgct tatccacaac\n", - " 7561 attttgcgca cggttatgtg gacaaaatac ctggttaccc aggccgtgcc ggcacgttaa\n", - " 7621 ccgggctgca tccgatgcaa gtgtgtcgct gtcgacgagc tcgcgagctc ggacatgagg\n", - " 7681 ttgccccgta ttcagtgtcg ctgatttgta ttgtctgaag ttgtttttac gttaagttga\n", - " 7741 tgcagatcaa ttaatacgat acctgcgtca taattgatta tttgacgtgg tttgatggcc\n", - " 7801 tccacgcacg ttgtgatatg tagatgataa tcattatcac tttacgggtc ctttccggtg\n", - " 7861 atccgacagg ttacggggcg gcgacctcgc gggttttcgc tatttatgaa aattttccgg\n", - " 7921 tttaaggcgt ttccgttctt cttcgtcata acttaatgtt tttatttaaa ataccctctg\n", - " 7981 aaaagaaagg aaacgacagg tgctgaaagc gagctttttg gcctctgtcg tttcctttct\n", - " 8041 ctgtttttgt ccgtggaatg aacaatggaa gtccgagctc atcgctaata acttcgtata\n", - " 8101 gcatacatta tacgaagtta tattcgat\n", - "//\n" - ] - } - ], + "outputs": [], "source": [ "# Parsing the files\n", "\n", @@ -210,7 +57,7 @@ }, { "cell_type": "code", - "execution_count": null, + "execution_count": 3, "metadata": {}, "outputs": [], "source": [ @@ -230,16 +77,7 @@ "cell_type": "code", "execution_count": null, "metadata": {}, - "outputs": [ - { - "name": "stdout", - "output_type": "stream", - "text": [ - "76.10205760701717\n", - "72.57935286927591\n" - ] - } - ], + "outputs": [], "source": [ "# (Optional) Checking that the primer Tm are matching\n", "\n", @@ -251,20 +89,7 @@ "cell_type": "code", "execution_count": null, "metadata": {}, - "outputs": [ - { - "ename": "ValueError", - "evalue": "No PCR product! Template EU140750 8128 bp circular limit=69:\nNo forward primers anneal...\nNo reverse primers anneal...", - "output_type": "error", - "traceback": [ - "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m", - "\u001b[0;31mValueError\u001b[0m Traceback (most recent call last)", - "Cell \u001b[0;32mIn[5], line 6\u001b[0m\n\u001b[1;32m 4\u001b[0m pcr_product_F2 \u001b[38;5;241m=\u001b[39m pcr(F2_For, F2_Rev, gene_docs[\u001b[38;5;241m0\u001b[39m], limit\u001b[38;5;241m=\u001b[39m\u001b[38;5;241m40\u001b[39m)\n\u001b[1;32m 5\u001b[0m pcr_product_F3 \u001b[38;5;241m=\u001b[39m pcr(F3_For, F3_Rev, gene_docs[\u001b[38;5;241m0\u001b[39m], limit\u001b[38;5;241m=\u001b[39m\u001b[38;5;241m40\u001b[39m)\n\u001b[0;32m----> 6\u001b[0m pcr_product_BAC \u001b[38;5;241m=\u001b[39m \u001b[43mpcr\u001b[49m\u001b[43m(\u001b[49m\u001b[43mBACF1_For\u001b[49m\u001b[43m,\u001b[49m\u001b[43m \u001b[49m\u001b[43mBACF3_Rev\u001b[49m\u001b[43m,\u001b[49m\u001b[43m \u001b[49m\u001b[43mpCC1BAC_docs\u001b[49m\u001b[43m[\u001b[49m\u001b[38;5;241;43m0\u001b[39;49m\u001b[43m]\u001b[49m\u001b[43m,\u001b[49m\u001b[43m \u001b[49m\u001b[43mlimit\u001b[49m\u001b[38;5;241;43m=\u001b[39;49m\u001b[38;5;241;43m69\u001b[39;49m\u001b[43m)\u001b[49m\n\u001b[1;32m 8\u001b[0m \u001b[38;5;66;03m# Printing out the PCR results\u001b[39;00m\n\u001b[1;32m 10\u001b[0m \u001b[38;5;28mprint\u001b[39m(pcr_product_F1\u001b[38;5;241m.\u001b[39mformat(\u001b[38;5;124m\"\u001b[39m\u001b[38;5;124mgb\u001b[39m\u001b[38;5;124m\"\u001b[39m))\n", - "File \u001b[0;32m~/Documents/OpenSource/summer_internship_2024/pydna/src/pydna/amplify.py:523\u001b[0m, in \u001b[0;36mpcr\u001b[0;34m(*args, **kwargs)\u001b[0m\n\u001b[1;32m 521\u001b[0m \u001b[38;5;28;01mreturn\u001b[39;00m anneal_primers\u001b[38;5;241m.\u001b[39mproducts[\u001b[38;5;241m0\u001b[39m]\n\u001b[1;32m 522\u001b[0m \u001b[38;5;28;01melif\u001b[39;00m \u001b[38;5;28mlen\u001b[39m(anneal_primers\u001b[38;5;241m.\u001b[39mproducts) \u001b[38;5;241m==\u001b[39m \u001b[38;5;241m0\u001b[39m:\n\u001b[0;32m--> 523\u001b[0m \u001b[38;5;28;01mraise\u001b[39;00m \u001b[38;5;167;01mValueError\u001b[39;00m(\u001b[38;5;124mf\u001b[39m\u001b[38;5;124m\"\u001b[39m\u001b[38;5;124mNo PCR product! \u001b[39m\u001b[38;5;132;01m{\u001b[39;00manneal_primers\u001b[38;5;241m.\u001b[39mreport()\u001b[38;5;132;01m}\u001b[39;00m\u001b[38;5;124m\"\u001b[39m)\n\u001b[1;32m 524\u001b[0m \u001b[38;5;28;01mraise\u001b[39;00m \u001b[38;5;167;01mValueError\u001b[39;00m(\u001b[38;5;124mf\u001b[39m\u001b[38;5;124m\"\u001b[39m\u001b[38;5;124mPCR not specific! \u001b[39m\u001b[38;5;132;01m{\u001b[39;00m\u001b[38;5;28mformat\u001b[39m(anneal_primers\u001b[38;5;241m.\u001b[39mreport())\u001b[38;5;132;01m}\u001b[39;00m\u001b[38;5;124m\"\u001b[39m)\n", - "\u001b[0;31mValueError\u001b[0m: No PCR product! Template EU140750 8128 bp circular limit=69:\nNo forward primers anneal...\nNo reverse primers anneal..." - ] - } - ], + "outputs": [], "source": [ "# Checking primer specificity using the pcr function. An error message is returned if otherwise.\n", "\n", @@ -285,19 +110,7 @@ "cell_type": "code", "execution_count": null, "metadata": {}, - "outputs": [ - { - "ename": "IndexError", - "evalue": "list index out of range", - "output_type": "error", - "traceback": [ - "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m", - "\u001b[0;31mIndexError\u001b[0m Traceback (most recent call last)", - "Cell \u001b[0;32mIn[7], line 7\u001b[0m\n\u001b[1;32m 4\u001b[0m assembled_circ \u001b[38;5;241m=\u001b[39m assembled\u001b[38;5;241m.\u001b[39massemble_circular()\n\u001b[1;32m 6\u001b[0m \u001b[38;5;66;03m# Printing out the Gibson Assembly product\u001b[39;00m\n\u001b[0;32m----> 7\u001b[0m \u001b[38;5;28mprint\u001b[39m(\u001b[43massembled_circ\u001b[49m\u001b[43m[\u001b[49m\u001b[38;5;241;43m0\u001b[39;49m\u001b[43m]\u001b[49m)\n", - "\u001b[0;31mIndexError\u001b[0m: list index out of range" - ] - } - ], + "outputs": [], "source": [ "# Performing the Gibson Assembly. Note that the assembly class parameters should be given as a list.\n", "\n", @@ -325,7 +138,7 @@ "name": "python", "nbconvert_exporter": "python", "pygments_lexer": "ipython3", - "version": "3.12.5" + "version": "3.11.9" } }, "nbformat": 4, diff --git a/docs/notebooks/Example_Restriction.ipynb b/docs/notebooks/Example_Restriction.ipynb old mode 100644 new mode 100755 index 800f64fb..eb6d0db8 --- a/docs/notebooks/Example_Restriction.ipynb +++ b/docs/notebooks/Example_Restriction.ipynb @@ -16,6 +16,15 @@ "Source files can be found alongside this notebook, if you would like to follow along. Annotations are made alongside the code to describe key steps." ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "\n", + " \"Open\n", + "" + ] + }, { "cell_type": "code", "execution_count": null, diff --git a/docs/notebooks/Gibson.ipynb b/docs/notebooks/Gibson.ipynb index d0bc9a8a..8d7c6e4a 100644 --- a/docs/notebooks/Gibson.ipynb +++ b/docs/notebooks/Gibson.ipynb @@ -17,6 +17,15 @@ " * `algorithm`: the function used to find homology regions between DNA fragments. For Gibson Assembly, we use the `terminal_overlap` function, which finds homology regions only at the terminal regions. By default, the `Assembly` class uses the `common_sub_strings` function to find homology regions, which finds homology anywhere, as it could happen in a homologous recombination event.\n" ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "\n", + " \"Open\n", + "" + ] + }, { "cell_type": "code", "execution_count": null, diff --git a/docs/notebooks/Importing_Seqs.ipynb b/docs/notebooks/Importing_Seqs.ipynb old mode 100644 new mode 100755 index 153f3738..c2a7e7b1 --- a/docs/notebooks/Importing_Seqs.ipynb +++ b/docs/notebooks/Importing_Seqs.ipynb @@ -19,6 +19,15 @@ "The following code shows an example of how to use the `parse` function to import a FASTA file." ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "\n", + " \"Open\n", + "" + ] + }, { "cell_type": "code", "execution_count": null, diff --git a/docs/notebooks/PCR.ipynb b/docs/notebooks/PCR.ipynb old mode 100644 new mode 100755 index e26ac651..1081dd8d --- a/docs/notebooks/PCR.ipynb +++ b/docs/notebooks/PCR.ipynb @@ -17,6 +17,15 @@ "The following example uses a 300+ bp custom sample circular DNA, containing an example gene that we would like to clone. 18 bp forward and reverse primers have been provided. " ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "\n", + " \"Open\n", + "" + ] + }, { "cell_type": "code", "execution_count": null, diff --git a/docs/notebooks/Restrict_Ligate_Cloning.ipynb b/docs/notebooks/Restrict_Ligate_Cloning.ipynb index be8d8f90..4addd6ff 100644 --- a/docs/notebooks/Restrict_Ligate_Cloning.ipynb +++ b/docs/notebooks/Restrict_Ligate_Cloning.ipynb @@ -14,6 +14,15 @@ "Restriction enzymes recognise specific DNA sequences and cut them, leaving sticky ends or blunt ends. To cut a sequence using `pydna`, we can use the `cut` method on a `Dseqrecord` object. Here is an example showing how to use the `cut` method to genenrate EcoRI restriction digests. The record includes a 338bp circular sequence, with an example gene feature." ] }, + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "\n", + " \"Open\n", + "" + ] + }, { "cell_type": "code", "execution_count": null,