From f060730dba18acef8ac43b8f638497358bab01ef Mon Sep 17 00:00:00 2001
From: Manuel Lera-Ramirez <manulera14@gmail.com>
Date: Thu, 7 Nov 2024 12:14:52 +0000
Subject: [PATCH] closes #262 (#326)

---
 src/pydna/amplify.py         |  2 +-
 tests/test_module_amplify.py | 28 ++++++++++++++++++++++++++++
 2 files changed, 29 insertions(+), 1 deletion(-)

diff --git a/src/pydna/amplify.py b/src/pydna/amplify.py
index 09ff68e5..907a5b20 100644
--- a/src/pydna/amplify.py
+++ b/src/pydna/amplify.py
@@ -344,9 +344,9 @@ def products(self):
                 if self.template.circular:
                     shift = fp.position - fp._fp
                     tpl = self.template.shifted(shift)  # shift template so that it starts where the fp starts anneling
-                    feats = tpl[: rp.position + rp._fp].features
                     fp.position = fp._fp  # New position of fp becomes the footprint length
                     rp.position = (rp.position - shift) % len(self.template)  # Shift the rp position as well
+                    feats = tpl[: rp.position + rp._fp].features
                 elif fp.position <= rp.position:  # pcr products only formed if fp anneals forward of rp
                     feats = self.template[
                         fp.position - fp._fp : rp.position + rp._fp
diff --git a/tests/test_module_amplify.py b/tests/test_module_amplify.py
index 8aa869d0..0fa15014 100644
--- a/tests/test_module_amplify.py
+++ b/tests/test_module_amplify.py
@@ -788,6 +788,7 @@ def test_annotation():
     """
     from pydna.amplify import pcr
     from pydna.dseqrecord import Dseqrecord
+    from pydna.primer import Primer
 
     dsr = Dseqrecord("ATGCAAACAGTAATGATGGATGACATTCAAAGCACTGATTCTATTGCTGAAAAAGATAAT")
     dsr.add_feature(x=0, y=60, type="gene", label="my_gene")  # We add a feature to highlight the sequence as a gene
@@ -804,6 +805,33 @@ def test_annotation():
     pcr_product_circ = pcr(forward_primer, reverse_primer, dsr_circ)
     assert str(pcr_product_circ.features[0].location.extract(pcr_product_circ).seq) == str(dsr_circ.seq)
 
+    # Check that annotations are transmitted properly if the PCR product spans
+    # the origin in a circular sequence
+
+    vector = Dseqrecord(
+        "ATGCAAACAGTAATGATGGATGACACCAGCTTCATGAAATGGAACAGTGCCAGAAAAAACTTGAAGATGTTCAAAGCACTGATTCTATTGCTGAAAAAGATAAT",
+        circular=True,
+    )
+
+    vector.add_feature(17, 40, type_="test", label=["left"])
+    vector.add_feature(41, 90, type_="test", label=["right"])
+    vector.add_feature(17, 90, type_="test", label=["all"])
+    vector.add_feature(30, 60, type_="test", label=["middle"])
+
+    feature_seqs = set(str(f.location.extract(vector).seq) for f in vector.features)
+
+    for shift in range(len(vector)):
+        shifted_vector = vector.shifted(shift)
+
+        primer_f = Primer("acgtGGATGACACCAGCTTCAT")
+        primer_r = Primer("attacCAATAGAATCAGTGCTTTGAACA")
+
+        product = pcr(primer_f, primer_r, shifted_vector)
+
+        product_seqs = set(str(f.location.extract(product).seq) for f in product.features if f.type == "test")
+
+        assert product_seqs == feature_seqs, f"Shift {shift}"
+
 
 if __name__ == "__main__":
     pytest.main([__file__, "-vv", "-s"])