diff --git a/.buildinfo b/.buildinfo index 895bd7b6..88ce134a 100644 --- a/.buildinfo +++ b/.buildinfo @@ -1,4 +1,4 @@ # Sphinx build info version 1 # This file hashes the configuration used when building these files. When it is not found, a full rebuild will be done. -config: 7fd5115d475fbca355cfe2b14f6309e1 +config: 2b03fdb29cb7f014b01d408c45b07c8c tags: 645f666f9bcd5a90fca523b33c5a78b7 diff --git a/_modules/index.html b/_modules/index.html index 5c9c305f..f55e13bc 100644 --- a/_modules/index.html +++ b/_modules/index.html @@ -5,14 +5,14 @@
-
__maintainer__ = "Björn Johansson"
__email__ = "bjorn_johansson@bio.uminho.pt"
__status__ = "Development" # "Production" #"Prototype"
-__version__ = "0.0.0-post.1+fd8577c"
+__version__ = "0.0.0-post.1+0f15ccd"
# create config directory
diff --git a/_modules/pydna/amplicon.html b/_modules/pydna/amplicon.html
index a6ca394d..27c8f91c 100644
--- a/_modules/pydna/amplicon.html
+++ b/_modules/pydna/amplicon.html
@@ -5,14 +5,14 @@
- pydna.amplicon — pydna 0.0.0.post1+fd8577c documentation
+ pydna.amplicon — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/amplify.html b/_modules/pydna/amplify.html
index ffb4c8e1..3013c4a1 100644
--- a/_modules/pydna/amplify.html
+++ b/_modules/pydna/amplify.html
@@ -5,14 +5,14 @@
- pydna.amplify — pydna 0.0.0.post1+fd8577c documentation
+ pydna.amplify — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/assembly.html b/_modules/pydna/assembly.html
index 49c5e2a7..a68f9b1a 100644
--- a/_modules/pydna/assembly.html
+++ b/_modules/pydna/assembly.html
@@ -5,14 +5,14 @@
- pydna.assembly — pydna 0.0.0.post1+fd8577c documentation
+ pydna.assembly — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/common_sub_strings.html b/_modules/pydna/common_sub_strings.html
index c0cde5f9..496737c6 100644
--- a/_modules/pydna/common_sub_strings.html
+++ b/_modules/pydna/common_sub_strings.html
@@ -5,14 +5,14 @@
- pydna.common_sub_strings — pydna 0.0.0.post1+fd8577c documentation
+ pydna.common_sub_strings — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/contig.html b/_modules/pydna/contig.html
index d422497b..9041f70b 100644
--- a/_modules/pydna/contig.html
+++ b/_modules/pydna/contig.html
@@ -5,14 +5,14 @@
- pydna.contig — pydna 0.0.0.post1+fd8577c documentation
+ pydna.contig — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/design.html b/_modules/pydna/design.html
index 2029ff0f..f323c45d 100644
--- a/_modules/pydna/design.html
+++ b/_modules/pydna/design.html
@@ -5,14 +5,14 @@
- pydna.design — pydna 0.0.0.post1+fd8577c documentation
+ pydna.design — pydna 0.0.0.post1+0f15ccd documentation
-
+
@@ -310,7 +310,7 @@ Source code for pydna.design
[docs]
-def assembly_fragments(f, overlap=35, maxlink=40):
+def assembly_fragments(f, overlap=35, maxlink=40, circular=False):
"""This function return a list of :mod:`pydna.amplicon.Amplicon` objects where
primers have been modified with tails so that the fragments can be fused in
the order they appear in the list by for example Gibson assembly or homologous
@@ -637,6 +637,9 @@ Source code for pydna.design
maxlink : int, optional
Maximum length of spacer sequences that may be present in f. These will be included in tails for designed primers.
+ circular : bool, optional
+ If True, the assembly is circular. If False, the assembly is linear.
+
Returns
-------
seqs : list of :mod:`pydna.amplicon.Amplicon` and other Dseqrecord like objects :mod:`pydna.amplicon.Amplicon` objects
@@ -694,6 +697,15 @@ Source code for pydna.design
>>>
"""
+
+ # Recursive call for circular assemblies
+ if circular:
+ fragments = assembly_fragments(f + f[0:1], overlap=overlap, maxlink=maxlink, circular=False)
+
+ if hasattr(fragments[0], "template"):
+ fragments[0] = _pcr((fragments[-1].forward_primer, fragments[0].reverse_primer), fragments[0].template)
+ return fragments[:-1]
+
# sanity check for arguments
nf = [item for item in f if len(item) > maxlink]
if not all(hasattr(i[0], "template") or hasattr(i[1], "template") for i in zip(nf, nf[1:])):
@@ -819,11 +831,19 @@ Source code for pydna.design
[docs]
def circular_assembly_fragments(f, overlap=35, maxlink=40):
- fragments = assembly_fragments(f + f[0:1], overlap=overlap, maxlink=maxlink)
+ """
+ Equivalent to `assembly_fragments` with `circular=True`.
- if hasattr(fragments[0], "template"):
- fragments[0] = _pcr((fragments[-1].forward_primer, fragments[0].reverse_primer), fragments[0].template)
- return fragments[:-1]
+ Deprecated, kept for backward compatibility. Use `assembly_fragments` with `circular=True` instead.
+ """
+ import warnings
+
+ warnings.warn(
+ "The circular_assembly_fragments function is deprecated. Use assembly_fragments with circular=True instead.",
+ DeprecationWarning,
+ stacklevel=2,
+ )
+ return assembly_fragments(f, overlap=overlap, maxlink=maxlink, circular=True)
diff --git a/_modules/pydna/dseq.html b/_modules/pydna/dseq.html
index 8f794e27..4ee6672a 100644
--- a/_modules/pydna/dseq.html
+++ b/_modules/pydna/dseq.html
@@ -5,14 +5,14 @@
- pydna.dseq — pydna 0.0.0.post1+fd8577c documentation
+ pydna.dseq — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/dseqrecord.html b/_modules/pydna/dseqrecord.html
index ce8b71d9..263c4f44 100644
--- a/_modules/pydna/dseqrecord.html
+++ b/_modules/pydna/dseqrecord.html
@@ -5,14 +5,14 @@
- pydna.dseqrecord — pydna 0.0.0.post1+fd8577c documentation
+ pydna.dseqrecord — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/editor.html b/_modules/pydna/editor.html
index 3043c604..a98daf47 100644
--- a/_modules/pydna/editor.html
+++ b/_modules/pydna/editor.html
@@ -5,14 +5,14 @@
- pydna.editor — pydna 0.0.0.post1+fd8577c documentation
+ pydna.editor — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/gel.html b/_modules/pydna/gel.html
index 53f26420..ed1e7448 100644
--- a/_modules/pydna/gel.html
+++ b/_modules/pydna/gel.html
@@ -5,14 +5,14 @@
- pydna.gel — pydna 0.0.0.post1+fd8577c documentation
+ pydna.gel — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/genbank.html b/_modules/pydna/genbank.html
index 4eaf17e8..b08cd9a0 100644
--- a/_modules/pydna/genbank.html
+++ b/_modules/pydna/genbank.html
@@ -5,14 +5,14 @@
- pydna.genbank — pydna 0.0.0.post1+fd8577c documentation
+ pydna.genbank — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/genbankfile.html b/_modules/pydna/genbankfile.html
index 96f8d213..c212d7f1 100644
--- a/_modules/pydna/genbankfile.html
+++ b/_modules/pydna/genbankfile.html
@@ -5,14 +5,14 @@
- pydna.genbankfile — pydna 0.0.0.post1+fd8577c documentation
+ pydna.genbankfile — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/genbankfixer.html b/_modules/pydna/genbankfixer.html
index e1ba0d6e..6510d1be 100644
--- a/_modules/pydna/genbankfixer.html
+++ b/_modules/pydna/genbankfixer.html
@@ -5,14 +5,14 @@
- pydna.genbankfixer — pydna 0.0.0.post1+fd8577c documentation
+ pydna.genbankfixer — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/genbankrecord.html b/_modules/pydna/genbankrecord.html
index 3ab78165..ec64e2be 100644
--- a/_modules/pydna/genbankrecord.html
+++ b/_modules/pydna/genbankrecord.html
@@ -5,14 +5,14 @@
- pydna.genbankrecord — pydna 0.0.0.post1+fd8577c documentation
+ pydna.genbankrecord — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/myprimers.html b/_modules/pydna/myprimers.html
index ff43082b..919ad0f9 100644
--- a/_modules/pydna/myprimers.html
+++ b/_modules/pydna/myprimers.html
@@ -5,14 +5,14 @@
- pydna.myprimers — pydna 0.0.0.post1+fd8577c documentation
+ pydna.myprimers — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/parsers.html b/_modules/pydna/parsers.html
index 1304b79b..ea059e60 100644
--- a/_modules/pydna/parsers.html
+++ b/_modules/pydna/parsers.html
@@ -5,14 +5,14 @@
- pydna.parsers — pydna 0.0.0.post1+fd8577c documentation
+ pydna.parsers — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/primer.html b/_modules/pydna/primer.html
index c027b265..09f9c495 100644
--- a/_modules/pydna/primer.html
+++ b/_modules/pydna/primer.html
@@ -5,14 +5,14 @@
- pydna.primer — pydna 0.0.0.post1+fd8577c documentation
+ pydna.primer — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/readers.html b/_modules/pydna/readers.html
index 7e41d7fb..410d3b01 100644
--- a/_modules/pydna/readers.html
+++ b/_modules/pydna/readers.html
@@ -5,14 +5,14 @@
- pydna.readers — pydna 0.0.0.post1+fd8577c documentation
+ pydna.readers — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/seqrecord.html b/_modules/pydna/seqrecord.html
index acee26e7..ac045348 100644
--- a/_modules/pydna/seqrecord.html
+++ b/_modules/pydna/seqrecord.html
@@ -5,14 +5,14 @@
- pydna.seqrecord — pydna 0.0.0.post1+fd8577c documentation
+ pydna.seqrecord — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/threading_timer_decorator_exit.html b/_modules/pydna/threading_timer_decorator_exit.html
index b6f75702..dd2a36a6 100644
--- a/_modules/pydna/threading_timer_decorator_exit.html
+++ b/_modules/pydna/threading_timer_decorator_exit.html
@@ -5,14 +5,14 @@
- pydna.threading_timer_decorator_exit — pydna 0.0.0.post1+fd8577c documentation
+ pydna.threading_timer_decorator_exit — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/tm.html b/_modules/pydna/tm.html
index 55e00fb3..a14ee6c9 100644
--- a/_modules/pydna/tm.html
+++ b/_modules/pydna/tm.html
@@ -5,14 +5,14 @@
- pydna.tm — pydna 0.0.0.post1+fd8577c documentation
+ pydna.tm — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_modules/pydna/utils.html b/_modules/pydna/utils.html
index 133d11ed..967e287e 100644
--- a/_modules/pydna/utils.html
+++ b/_modules/pydna/utils.html
@@ -5,14 +5,14 @@
- pydna.utils — pydna 0.0.0.post1+fd8577c documentation
+ pydna.utils — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/_static/assembly_fragment_slide_circular.png b/_static/assembly_fragment_slide_circular.png
new file mode 100644
index 00000000..fca398b6
Binary files /dev/null and b/_static/assembly_fragment_slide_circular.png differ
diff --git a/_static/assembly_fragment_slide_linear.png b/_static/assembly_fragment_slide_linear.png
new file mode 100644
index 00000000..a0091a08
Binary files /dev/null and b/_static/assembly_fragment_slide_linear.png differ
diff --git a/_static/documentation_options.js b/_static/documentation_options.js
index 59078648..0a57c56b 100644
--- a/_static/documentation_options.js
+++ b/_static/documentation_options.js
@@ -1,5 +1,5 @@
const DOCUMENTATION_OPTIONS = {
- VERSION: '0.0.0.post1+fd8577c',
+ VERSION: '0.0.0.post1+0f15ccd',
LANGUAGE: 'en',
COLLAPSE_INDEX: false,
BUILDER: 'html',
diff --git a/genindex.html b/genindex.html
index b65dd0bb..c38815f4 100644
--- a/genindex.html
+++ b/genindex.html
@@ -5,14 +5,14 @@
- Index — pydna 0.0.0.post1+fd8577c documentation
+ Index — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/index.html b/index.html
index 6a4a134c..d1ac1953 100644
--- a/index.html
+++ b/index.html
@@ -6,14 +6,14 @@
- Welcome to pydna’s documentation! — pydna 0.0.0.post1+fd8577c documentation
+ Welcome to pydna’s documentation! — pydna 0.0.0.post1+0f15ccd documentation
-
+
@@ -3150,7 +3150,7 @@ Examples of pydna in use
-pydna.design.assembly_fragments(f, overlap=35, maxlink=40)[source]
+pydna.design.assembly_fragments(f, overlap=35, maxlink=40, circular=False)[source]
This function return a list of pydna.amplicon.Amplicon
objects where
primers have been modified with tails so that the fragments can be fused in
the order they appear in the list by for example Gibson assembly or homologous
@@ -3419,6 +3419,7 @@
Examples of pydna in usepydna.amplicon.Amplicon
and other Dseqrecord like objects) – list Amplicon and Dseqrecord object for which fusion primers should be constructed.
overlap (int, optional) – Length of required overlap between fragments.
maxlink (int, optional) – Maximum length of spacer sequences that may be present in f. These will be included in tails for designed primers.
+circular (bool, optional) – If True, the assembly is circular. If False, the assembly is linear.
Returns:
@@ -3483,7 +3484,9 @@ Examples of pydna in use
pydna.design.circular_assembly_fragments(f, overlap=35, maxlink=40)[source]
-
+Equivalent to assembly_fragments with circular=True.
+Deprecated, kept for backward compatibility. Use assembly_fragments with circular=True instead.
+
diff --git a/py-modindex.html b/py-modindex.html
index cb839e21..c4aa904d 100644
--- a/py-modindex.html
+++ b/py-modindex.html
@@ -5,14 +5,14 @@
- Python Module Index — pydna 0.0.0.post1+fd8577c documentation
+ Python Module Index — pydna 0.0.0.post1+0f15ccd documentation
-
+
diff --git a/search.html b/search.html
index 2a0e5361..3d86d461 100644
--- a/search.html
+++ b/search.html
@@ -5,7 +5,7 @@
- Search — pydna 0.0.0.post1+fd8577c documentation
+ Search — pydna 0.0.0.post1+0f15ccd documentation
@@ -13,7 +13,7 @@
-
+
diff --git a/searchindex.js b/searchindex.js
index 979729e4..5b463542 100644
--- a/searchindex.js
+++ b/searchindex.js
@@ -1 +1 @@
-Search.setIndex({"alltitles": {"Examples of pydna in use": [[0, "examples-of-pydna-in-use"]], "How to get more help": [[0, "how-to-get-more-help"]], "How to use the documentation": [[0, "how-to-use-the-documentation"]], "Indices and tables": [[0, "indices-and-tables"]], "Module contents": [[0, "module-pydna"]], "Welcome to pydna\u2019s documentation!": [[0, null]], "pydna": [[0, "pydna"]], "pydna package layout": [[0, "pydna-package-layout"]], "pydna source code": [[0, "pydna-source-code"]], "pydna.amplicon module": [[0, "module-pydna.amplicon"]], "pydna.amplify module": [[0, "module-pydna.amplify"]], "pydna.assembly module": [[0, "module-pydna.assembly"]], "pydna.common_sub_strings module": [[0, "module-pydna.common_sub_strings"]], "pydna.contig module": [[0, "module-pydna.contig"]], "pydna.design module": [[0, "module-pydna.design"]], "pydna.download module": [[0, "module-pydna.download"]], "pydna.dseq module": [[0, "module-pydna.dseq"]], "pydna.dseqrecord module": [[0, "module-pydna.dseqrecord"]], "pydna.editor module": [[0, "module-pydna.editor"]], "pydna.gel module": [[0, "module-pydna.gel"]], "pydna.genbank module": [[0, "module-pydna.genbank"]], "pydna.genbankfile module": [[0, "module-pydna.genbankfile"]], "pydna.genbankfixer module": [[0, "module-pydna.genbankfixer"]], "pydna.genbankrecord module": [[0, "module-pydna.genbankrecord"]], "pydna.myprimers module": [[0, "module-pydna.myprimers"]], "pydna.parsers module": [[0, "module-pydna.parsers"]], "pydna.primer module": [[0, "module-pydna.primer"]], "pydna.readers module": [[0, "module-pydna.readers"]], "pydna.seqrecord module": [[0, "module-pydna.seqrecord"]], "pydna.tm module": [[0, "module-pydna.tm"]], "pydna.utils module": [[0, "module-pydna.utils"]]}, "docnames": ["index"], "envversion": {"sphinx": 63, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinx.ext.viewcode": 1}, "filenames": ["index.rst"], "indexentries": {"accessed (pydna.myprimers.primerlist property)": [[0, "pydna.myprimers.PrimerList.accessed", false]], "accession (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.accession", false]], "add_colors_to_features_for_ape() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.add_colors_to_features_for_ape", false]], "add_feature() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.add_feature", false]], "add_feature() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.add_feature", false]], "amplicon (class in pydna.amplicon)": [[0, "pydna.amplicon.Amplicon", false]], "anneal (class in pydna.amplify)": [[0, "pydna.amplify.Anneal", false]], "ape() (in module pydna.editor)": [[0, "pydna.editor.ape", false]], "apply_cut() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.apply_cut", false]], "apply_cut() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.apply_cut", false]], "assemble_circular() (pydna.assembly.assembly method)": [[0, "pydna.assembly.Assembly.assemble_circular", false]], "assemble_linear() (pydna.assembly.assembly method)": [[0, "pydna.assembly.Assembly.assemble_linear", false]], "assembly (class in pydna.assembly)": [[0, "pydna.assembly.Assembly", false]], "assembly_fragments() (in module pydna.design)": [[0, "pydna.design.assembly_fragments", false]], "assign_numbers() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.assign_numbers", false]], "biopython_code() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.biopython_code", false]], "cai() (in module pydna.utils)": [[0, "pydna.utils.cai", false]], "cai() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.cai", false]], "cai() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.cai", false]], "cas9() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cas9", false]], "cas9() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cas9", false]], "check_primer_numbers() (in module pydna.myprimers)": [[0, "pydna.myprimers.check_primer_numbers", false]], "circular (pydna.dseqrecord.dseqrecord property)": [[0, "pydna.dseqrecord.Dseqrecord.circular", false]], "circular_assembly_fragments() (in module pydna.design)": [[0, "pydna.design.circular_assembly_fragments", false]], "code() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.code", false]], "comment() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.comment", false]], "common_sub_strings() (in module pydna.common_sub_strings)": [[0, "pydna.common_sub_strings.common_sub_strings", false]], "complement() (in module pydna.utils)": [[0, "pydna.utils.complement", false]], "concat_dict() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.concat_dict", false]], "contig (class in pydna.contig)": [[0, "pydna.contig.Contig", false]], "copy() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.copy", false]], "copy_fasta_to_clipboard() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.copy_fasta_to_clipboard", false]], "copy_gb_to_clipboard() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.copy_gb_to_clipboard", false]], "cut() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cut", false]], "cut() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cut", false]], "cuts_overlap() (in module pydna.utils)": [[0, "pydna.utils.cuts_overlap", false]], "cutsite_is_valid() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cutsite_is_valid", false]], "cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cutters", false]], "cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cutters", false]], "datefunction() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.datefunction", false]], "dbd_program() (in module pydna.tm)": [[0, "pydna.tm.dbd_program", false]], "dbd_program() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.dbd_program", false]], "definition (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.definition", false]], "detailed_figure() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.detailed_figure", false]], "dseq (class in pydna.dseq)": [[0, "pydna.dseq.Dseq", false]], "dseqrecord (class in pydna.dseqrecord)": [[0, "pydna.dseqrecord.Dseqrecord", false]], "dump() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.dump", false]], "editor (class in pydna.editor)": [[0, "pydna.editor.Editor", false]], "embl_gb_fasta() (in module pydna.parsers)": [[0, "pydna.parsers.embl_gb_fasta", false]], "eq() (in module pydna.utils)": [[0, "pydna.utils.eq", false]], "exo1_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.exo1_end", false]], "exo1_front() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.exo1_front", false]], "express() (in module pydna.utils)": [[0, "pydna.utils.express", false]], "express() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.express", false]], "express() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.express", false]], "extract_feature() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.extract_feature", false]], "extract_feature() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.extract_feature", false]], "extract_from_text() (in module pydna.parsers)": [[0, "pydna.parsers.extract_from_text", false]], "figure() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.figure", false]], "figure() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.figure", false]], "figure() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.figure", false]], "fill_in() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.fill_in", false]], "find() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.find", false]], "find() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find", false]], "find_aa() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find_aa", false]], "find_aminoacids() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find_aminoacids", false]], "find_duplicate_primers() (in module pydna.myprimers)": [[0, "pydna.myprimers.find_duplicate_primers", false]], "five_prime_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.five_prime_end", false]], "flatten() (in module pydna.utils)": [[0, "pydna.utils.flatten", false]], "footprint (pydna.primer.primer property)": [[0, "pydna.primer.Primer.footprint", false]], "format() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.format", false]], "forward_primers (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.forward_primers", false]], "from_bio_seqrecord() (pydna.seqrecord.seqrecord class method)": [[0, "pydna.seqrecord.SeqRecord.from_Bio_SeqRecord", false]], "from_full_sequence_and_overhangs() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_full_sequence_and_overhangs", false]], "from_representation() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_representation", false]], "from_seqrecord() (pydna.amplicon.amplicon class method)": [[0, "pydna.amplicon.Amplicon.from_SeqRecord", false]], "from_seqrecord() (pydna.contig.contig class method)": [[0, "pydna.contig.Contig.from_SeqRecord", false]], "from_seqrecord() (pydna.dseqrecord.dseqrecord class method)": [[0, "pydna.dseqrecord.Dseqrecord.from_SeqRecord", false]], "from_seqrecord() (pydna.genbankfile.genbankfile class method)": [[0, "pydna.genbankfile.GenbankFile.from_SeqRecord", false]], "from_seqrecord() (pydna.genbankrecord.genbankrecord class method)": [[0, "pydna.genbankrecord.GenbankRecord.from_SeqRecord", false]], "from_string() (pydna.contig.contig class method)": [[0, "pydna.contig.Contig.from_string", false]], "from_string() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_string", false]], "from_string() (pydna.dseqrecord.dseqrecord class method)": [[0, "pydna.dseqrecord.Dseqrecord.from_string", false]], "from_string() (pydna.genbankrecord.genbankrecord class method)": [[0, "pydna.genbankrecord.GenbankRecord.from_string", false]], "gbtext_clean() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.gbtext_clean", false]], "gc() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.gc", false]], "gc() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.gc", false]], "gel() (in module pydna.gel)": [[0, "pydna.gel.gel", false]], "genbank (class in pydna.genbank)": [[0, "pydna.genbank.Genbank", false]], "genbank() (in module pydna.genbank)": [[0, "pydna.genbank.genbank", false]], "genbankfile (class in pydna.genbankfile)": [[0, "pydna.genbankfile.GenbankFile", false]], "genbankrecord (class in pydna.genbankrecord)": [[0, "pydna.genbankrecord.GenbankRecord", false]], "get_cut_parameters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cut_parameters", false]], "get_cutsite_pairs() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cutsite_pairs", false]], "get_cutsites() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cutsites", false]], "get_env() (in module pydna)": [[0, "pydna.get_env", false]], "identifier_from_string() (in module pydna.utils)": [[0, "pydna.utils.identifier_from_string", false]], "interpolator() (in module pydna.gel)": [[0, "pydna.gel.interpolator", false]], "isblunt() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.isblunt", false]], "isorf() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.isorf", false]], "isorf() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.isorf", false]], "lcs() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.lcs", false]], "left_end_position() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.left_end_position", false]], "limit (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.limit", false]], "linearize() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.linearize", false]], "list_features() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.list_features", false]], "location_boundaries() (in module pydna.utils)": [[0, "pydna.utils.location_boundaries", false]], "locations_overlap() (in module pydna.utils)": [[0, "pydna.utils.locations_overlap", false]], "locstr() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.locstr", false]], "locus (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.locus", false]], "logo() (in module pydna)": [[0, "pydna.logo", false]], "looped() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.looped", false]], "looped() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.looped", false]], "lower() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.lower", false]], "lower() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.lower", false]], "m() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.m", false]], "map_trace_files() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.map_trace_files", false]], "memorize() (in module pydna.utils)": [[0, "pydna.utils.memorize", false]], "module": [[0, "module-pydna", false], [0, "module-pydna.amplicon", false], [0, "module-pydna.amplify", false], [0, "module-pydna.assembly", false], [0, "module-pydna.common_sub_strings", false], [0, "module-pydna.contig", false], [0, "module-pydna.design", false], [0, "module-pydna.download", false], [0, "module-pydna.dseq", false], [0, "module-pydna.dseqrecord", false], [0, "module-pydna.editor", false], [0, "module-pydna.gel", false], [0, "module-pydna.genbank", false], [0, "module-pydna.genbankfile", false], [0, "module-pydna.genbankfixer", false], [0, "module-pydna.genbankrecord", false], [0, "module-pydna.myprimers", false], [0, "module-pydna.parsers", false], [0, "module-pydna.primer", false], [0, "module-pydna.readers", false], [0, "module-pydna.seqrecord", false], [0, "module-pydna.tm", false], [0, "module-pydna.utils", false]], "mung() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.mung", false]], "mw() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.mw", false]], "n_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.n_cutters", false]], "n_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.n_cutters", false]], "no_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.no_cutters", false]], "no_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.no_cutters", false]], "nucleotide() (pydna.genbank.genbank method)": [[0, "pydna.genbank.Genbank.nucleotide", false]], "number_of_cuts() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.number_of_cuts", false]], "once_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.once_cutters", false]], "once_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.once_cutters", false]], "open() (pydna.editor.editor method)": [[0, "pydna.editor.Editor.open", false]], "open_cache_folder() (in module pydna)": [[0, "pydna.open_cache_folder", false]], "open_config_folder() (in module pydna)": [[0, "pydna.open_config_folder", false]], "open_current_folder() (in module pydna)": [[0, "pydna.open_current_folder", false]], "open_folder() (in module pydna.utils)": [[0, "pydna.utils.open_folder", false]], "open_folder() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.open_folder", false]], "open_log_folder() (in module pydna)": [[0, "pydna.open_log_folder", false]], "orfs() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.orfs", false]], "orfs_to_features() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.orfs_to_features", false]], "originstr() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.originstr", false]], "parse() (in module pydna.parsers)": [[0, "pydna.parsers.parse", false]], "parse_primers() (in module pydna.parsers)": [[0, "pydna.parsers.parse_primers", false]], "parsegbloc() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.parseGBLoc", false]], "pcr() (in module pydna.amplify)": [[0, "pydna.amplify.pcr", false]], "pfu_sso7d_program() (in module pydna.tm)": [[0, "pydna.tm.pfu_sso7d_program", false]], "primer (class in pydna.primer)": [[0, "pydna.primer.Primer", false]], "primer_design() (in module pydna.design)": [[0, "pydna.design.primer_design", false]], "primerlist (class in pydna.myprimers)": [[0, "pydna.myprimers.PrimerList", false]], "primers() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.primers", false]], "products (pydna.amplify.anneal property)": [[0, "pydna.amplify.Anneal.products", false]], "program() (in module pydna.tm)": [[0, "pydna.tm.program", false]], "program() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.program", false]], "proteinseqrecord (class in pydna.seqrecord)": [[0, "pydna.seqrecord.ProteinSeqRecord", false]], "pydna": [[0, "module-pydna", false]], "pydna.amplicon": [[0, "module-pydna.amplicon", false]], "pydna.amplify": [[0, "module-pydna.amplify", false]], "pydna.assembly": [[0, "module-pydna.assembly", false]], "pydna.common_sub_strings": [[0, "module-pydna.common_sub_strings", false]], "pydna.contig": [[0, "module-pydna.contig", false]], "pydna.design": [[0, "module-pydna.design", false]], "pydna.download": [[0, "module-pydna.download", false]], "pydna.dseq": [[0, "module-pydna.dseq", false]], "pydna.dseqrecord": [[0, "module-pydna.dseqrecord", false]], "pydna.editor": [[0, "module-pydna.editor", false]], "pydna.gel": [[0, "module-pydna.gel", false]], "pydna.genbank": [[0, "module-pydna.genbank", false]], "pydna.genbankfile": [[0, "module-pydna.genbankfile", false]], "pydna.genbankfixer": [[0, "module-pydna.genbankfixer", false]], "pydna.genbankrecord": [[0, "module-pydna.genbankrecord", false]], "pydna.myprimers": [[0, "module-pydna.myprimers", false]], "pydna.parsers": [[0, "module-pydna.parsers", false]], "pydna.primer": [[0, "module-pydna.primer", false]], "pydna.readers": [[0, "module-pydna.readers", false]], "pydna.seqrecord": [[0, "module-pydna.seqrecord", false]], "pydna.tm": [[0, "module-pydna.tm", false]], "pydna.utils": [[0, "module-pydna.utils", false]], "pydna_code() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.pydna_code", false]], "pydna_code_from_list() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.pydna_code_from_list", false]], "q5() (in module pydna.tm)": [[0, "pydna.tm.Q5", false]], "quick() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.quick", false]], "randomdna() (in module pydna.utils)": [[0, "pydna.utils.randomDNA", false]], "randomorf() (in module pydna.utils)": [[0, "pydna.utils.randomORF", false]], "randomprot() (in module pydna.utils)": [[0, "pydna.utils.randomprot", false]], "randomrna() (in module pydna.utils)": [[0, "pydna.utils.randomRNA", false]], "rarecodons() (in module pydna.utils)": [[0, "pydna.utils.rarecodons", false]], "rarecodons() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.rarecodons", false]], "rarecodons() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.rarecodons", false]], "rc() (in module pydna.utils)": [[0, "pydna.utils.rc", false]], "rc() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.rc", false]], "rc() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.rc", false]], "rc() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.rc", false]], "rc() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.rc", false]], "rc() (pydna.genbankfile.genbankfile method)": [[0, "pydna.genbankfile.GenbankFile.rc", false]], "rc() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.rc", false]], "rc() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.rc", false]], "rc() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.rc", false]], "read() (in module pydna.readers)": [[0, "pydna.readers.read", false]], "read_primer() (in module pydna.readers)": [[0, "pydna.readers.read_primer", false]], "report() (pydna.amplify.anneal method)": [[0, "pydna.amplify.Anneal.report", false]], "reverse_complement() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.reverse_complement", false]], "reverse_complement() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.reverse_complement", false]], "reverse_complement() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.reverse_complement", false]], "reverse_complement() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.reverse_complement", false]], "reverse_complement() (pydna.genbankfile.genbankfile method)": [[0, "pydna.genbankfile.GenbankFile.reverse_complement", false]], "reverse_complement() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.reverse_complement", false]], "reverse_complement() (pydna.primer.primer method)": [[0, "pydna.primer.Primer.reverse_complement", false]], "reverse_complement() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.reverse_complement", false]], "reverse_complement() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.reverse_complement", false]], "reverse_primers (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.reverse_primers", false]], "right_end_position() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.right_end_position", false]], "seguid() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.seguid", false]], "seguid() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.seguid", false]], "seguid() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.seguid", false]], "seq31() (in module pydna.utils)": [[0, "pydna.utils.seq31", false]], "seqrecord (class in pydna.seqrecord)": [[0, "pydna.seqrecord.SeqRecord", false]], "set_forward_primer_footprint() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.set_forward_primer_footprint", false]], "set_reverse_primer_footprint() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.set_reverse_primer_footprint", false]], "shift_feature() (in module pydna.utils)": [[0, "pydna.utils.shift_feature", false]], "shift_location() (in module pydna.utils)": [[0, "pydna.utils.shift_location", false]], "shifted() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.shifted", false]], "shifted() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.shifted", false]], "smallest_rotation() (in module pydna.utils)": [[0, "pydna.utils.smallest_rotation", false]], "sorted_features() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.sorted_features", false]], "stamp() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.stamp", false]], "startcodon() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.startcodon", false]], "startcodon() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.startcodon", false]], "stopcodon() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.stopcodon", false]], "stopcodon() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.stopcodon", false]], "strip_indent() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.strip_indent", false]], "strip_multiline() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.strip_multiline", false]], "synced() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.synced", false]], "t4() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.T4", false], [0, "pydna.dseq.Dseq.t4", false]], "ta_dbd() (in module pydna.tm)": [[0, "pydna.tm.ta_dbd", false]], "ta_default() (in module pydna.tm)": [[0, "pydna.tm.ta_default", false]], "tail (pydna.primer.primer property)": [[0, "pydna.primer.Primer.tail", false]], "taq_program() (in module pydna.tm)": [[0, "pydna.tm.taq_program", false]], "template (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.template", false]], "terminal_overlap() (in module pydna.common_sub_strings)": [[0, "pydna.common_sub_strings.terminal_overlap", false]], "terminal_transferase() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.terminal_transferase", false]], "terminal_transferase() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.terminal_transferase", false]], "three_frame_orfs() (in module pydna.utils)": [[0, "pydna.utils.three_frame_orfs", false]], "three_prime_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.three_prime_end", false]], "tm_dbd() (in module pydna.tm)": [[0, "pydna.tm.tm_dbd", false]], "tm_default() (in module pydna.tm)": [[0, "pydna.tm.tm_default", false]], "tm_neb() (in module pydna.tm)": [[0, "pydna.tm.tm_neb", false]], "tm_product() (in module pydna.tm)": [[0, "pydna.tm.tm_product", false]], "tmbresluc() (in module pydna.tm)": [[0, "pydna.tm.tmbresluc", false]], "togb() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toGB", false]], "toint() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toInt", false]], "tojson() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toJSON", false]], "tolinear() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.tolinear", false]], "tolinear() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.tolinear", false]], "transcribe() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.transcribe", false]], "translate() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.translate", false]], "translate() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.translate", false]], "trunc (pydna.dseq.dseq attribute)": [[0, "pydna.dseq.Dseq.trunc", false]], "twice_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.twice_cutters", false]], "twice_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.twice_cutters", false]], "undefined_sequence() (in module pydna.myprimers)": [[0, "pydna.myprimers.undefined_sequence", false]], "unique_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.unique_cutters", false]], "unique_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.unique_cutters", false]], "upper() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.upper", false]], "upper() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.upper", false]], "watson_ovhg() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.watson_ovhg", false]], "wrapstring() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.wrapstring", false]], "write() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.write", false]]}, "objects": {"": [[0, 0, 0, "-", "pydna"]], "pydna": [[0, 0, 0, "-", "amplicon"], [0, 0, 0, "-", "amplify"], [0, 0, 0, "-", "assembly"], [0, 0, 0, "-", "common_sub_strings"], [0, 0, 0, "-", "contig"], [0, 0, 0, "-", "design"], [0, 0, 0, "-", "download"], [0, 0, 0, "-", "dseq"], [0, 0, 0, "-", "dseqrecord"], [0, 0, 0, "-", "editor"], [0, 0, 0, "-", "gel"], [0, 0, 0, "-", "genbank"], [0, 0, 0, "-", "genbankfile"], [0, 0, 0, "-", "genbankfixer"], [0, 0, 0, "-", "genbankrecord"], [0, 5, 1, "", "get_env"], [0, 5, 1, "", "logo"], [0, 0, 0, "-", "myprimers"], [0, 5, 1, "", "open_cache_folder"], [0, 5, 1, "", "open_config_folder"], [0, 5, 1, "", "open_current_folder"], [0, 5, 1, "", "open_log_folder"], [0, 0, 0, "-", "parsers"], [0, 0, 0, "-", "primer"], [0, 0, 0, "-", "readers"], [0, 0, 0, "-", "seqrecord"], [0, 0, 0, "-", "tm"], [0, 0, 0, "-", "utils"]], "pydna.amplicon": [[0, 1, 1, "", "Amplicon"]], "pydna.amplicon.Amplicon": [[0, 2, 1, "", "dbd_program"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "primers"], [0, 2, 1, "", "program"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "set_forward_primer_footprint"], [0, 2, 1, "", "set_reverse_primer_footprint"]], "pydna.amplify": [[0, 1, 1, "", "Anneal"], [0, 5, 1, "", "pcr"]], "pydna.amplify.Anneal": [[0, 3, 1, "", "forward_primers"], [0, 3, 1, "", "limit"], [0, 4, 1, "", "products"], [0, 2, 1, "", "report"], [0, 3, 1, "", "reverse_primers"], [0, 3, 1, "", "template"]], "pydna.assembly": [[0, 1, 1, "", "Assembly"]], "pydna.assembly.Assembly": [[0, 2, 1, "", "assemble_circular"], [0, 2, 1, "", "assemble_linear"]], "pydna.common_sub_strings": [[0, 5, 1, "", "common_sub_strings"], [0, 5, 1, "", "terminal_overlap"]], "pydna.contig": [[0, 1, 1, "", "Contig"]], "pydna.contig.Contig": [[0, 2, 1, "", "detailed_figure"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.design": [[0, 5, 1, "", "assembly_fragments"], [0, 5, 1, "", "circular_assembly_fragments"], [0, 5, 1, "", "primer_design"]], "pydna.dseq": [[0, 1, 1, "", "Dseq"]], "pydna.dseq.Dseq": [[0, 2, 1, "", "T4"], [0, 2, 1, "", "apply_cut"], [0, 2, 1, "", "cas9"], [0, 2, 1, "", "cut"], [0, 2, 1, "", "cutsite_is_valid"], [0, 2, 1, "", "cutters"], [0, 2, 1, "", "exo1_end"], [0, 2, 1, "", "exo1_front"], [0, 2, 1, "", "fill_in"], [0, 2, 1, "", "find"], [0, 2, 1, "", "five_prime_end"], [0, 2, 1, "", "from_full_sequence_and_overhangs"], [0, 2, 1, "", "from_representation"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "get_cut_parameters"], [0, 2, 1, "", "get_cutsite_pairs"], [0, 2, 1, "", "get_cutsites"], [0, 2, 1, "", "isblunt"], [0, 2, 1, "", "left_end_position"], [0, 2, 1, "", "looped"], [0, 2, 1, "", "lower"], [0, 2, 1, "", "mung"], [0, 2, 1, "", "mw"], [0, 2, 1, "", "n_cutters"], [0, 2, 1, "", "no_cutters"], [0, 2, 1, "", "once_cutters"], [0, 2, 1, "", "quick"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "right_end_position"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "shifted"], [0, 2, 1, "", "t4"], [0, 2, 1, "", "terminal_transferase"], [0, 2, 1, "", "three_prime_end"], [0, 2, 1, "", "tolinear"], [0, 2, 1, "", "transcribe"], [0, 2, 1, "", "translate"], [0, 3, 1, "", "trunc"], [0, 2, 1, "", "twice_cutters"], [0, 2, 1, "", "unique_cutters"], [0, 2, 1, "", "upper"], [0, 2, 1, "", "watson_ovhg"]], "pydna.dseqrecord": [[0, 1, 1, "", "Dseqrecord"]], "pydna.dseqrecord.Dseqrecord": [[0, 2, 1, "", "add_feature"], [0, 2, 1, "", "apply_cut"], [0, 2, 1, "", "cas9"], [0, 4, 1, "", "circular"], [0, 2, 1, "", "copy_fasta_to_clipboard"], [0, 2, 1, "", "copy_gb_to_clipboard"], [0, 2, 1, "", "cut"], [0, 2, 1, "", "cutters"], [0, 2, 1, "", "extract_feature"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "find"], [0, 2, 1, "", "find_aa"], [0, 2, 1, "", "find_aminoacids"], [0, 2, 1, "", "format"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "linearize"], [0, 2, 1, "", "looped"], [0, 2, 1, "", "lower"], [0, 2, 1, "", "m"], [0, 2, 1, "", "map_trace_files"], [0, 2, 1, "", "n_cutters"], [0, 2, 1, "", "no_cutters"], [0, 2, 1, "", "number_of_cuts"], [0, 2, 1, "", "once_cutters"], [0, 2, 1, "", "orfs"], [0, 2, 1, "", "orfs_to_features"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "shifted"], [0, 2, 1, "", "synced"], [0, 2, 1, "", "terminal_transferase"], [0, 2, 1, "", "tolinear"], [0, 2, 1, "", "twice_cutters"], [0, 2, 1, "", "unique_cutters"], [0, 2, 1, "", "upper"], [0, 2, 1, "", "write"]], "pydna.editor": [[0, 1, 1, "", "Editor"], [0, 5, 1, "", "ape"]], "pydna.editor.Editor": [[0, 2, 1, "", "open"]], "pydna.gel": [[0, 5, 1, "", "gel"], [0, 5, 1, "", "interpolator"]], "pydna.genbank": [[0, 1, 1, "", "Genbank"], [0, 5, 1, "", "genbank"]], "pydna.genbank.Genbank": [[0, 2, 1, "", "nucleotide"]], "pydna.genbankfile": [[0, 1, 1, "", "GenbankFile"]], "pydna.genbankfile.GenbankFile": [[0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.genbankfixer": [[0, 5, 1, "", "concat_dict"], [0, 5, 1, "", "gbtext_clean"], [0, 5, 1, "", "locstr"], [0, 5, 1, "", "originstr"], [0, 5, 1, "", "parseGBLoc"], [0, 5, 1, "", "strip_indent"], [0, 5, 1, "", "strip_multiline"], [0, 5, 1, "", "toGB"], [0, 5, 1, "", "toInt"], [0, 5, 1, "", "toJSON"], [0, 5, 1, "", "wrapstring"]], "pydna.genbankrecord": [[0, 1, 1, "", "GenbankRecord"]], "pydna.genbankrecord.GenbankRecord": [[0, 2, 1, "", "biopython_code"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "pydna_code"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.myprimers": [[0, 1, 1, "", "PrimerList"], [0, 5, 1, "", "check_primer_numbers"], [0, 5, 1, "", "find_duplicate_primers"], [0, 5, 1, "", "undefined_sequence"]], "pydna.myprimers.PrimerList": [[0, 4, 1, "", "accessed"], [0, 2, 1, "", "assign_numbers"], [0, 2, 1, "", "code"], [0, 2, 1, "", "open_folder"], [0, 2, 1, "", "pydna_code_from_list"]], "pydna.parsers": [[0, 5, 1, "", "embl_gb_fasta"], [0, 5, 1, "", "extract_from_text"], [0, 5, 1, "", "parse"], [0, 5, 1, "", "parse_primers"]], "pydna.primer": [[0, 1, 1, "", "Primer"]], "pydna.primer.Primer": [[0, 4, 1, "", "footprint"], [0, 2, 1, "", "reverse_complement"], [0, 4, 1, "", "tail"]], "pydna.readers": [[0, 5, 1, "", "read"], [0, 5, 1, "", "read_primer"]], "pydna.seqrecord": [[0, 1, 1, "", "ProteinSeqRecord"], [0, 1, 1, "", "SeqRecord"]], "pydna.seqrecord.ProteinSeqRecord": [[0, 2, 1, "", "cai"], [0, 2, 1, "", "express"], [0, 2, 1, "", "gc"], [0, 2, 1, "", "isorf"], [0, 2, 1, "", "rarecodons"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "startcodon"], [0, 2, 1, "", "stopcodon"]], "pydna.seqrecord.SeqRecord": [[0, 4, 1, "", "accession"], [0, 2, 1, "", "add_colors_to_features_for_ape"], [0, 2, 1, "", "add_feature"], [0, 2, 1, "", "cai"], [0, 2, 1, "", "comment"], [0, 2, 1, "", "copy"], [0, 2, 1, "", "datefunction"], [0, 4, 1, "", "definition"], [0, 2, 1, "", "dump"], [0, 2, 1, "", "express"], [0, 2, 1, "", "extract_feature"], [0, 2, 1, "", "from_Bio_SeqRecord"], [0, 2, 1, "", "gc"], [0, 2, 1, "", "isorf"], [0, 2, 1, "", "lcs"], [0, 2, 1, "", "list_features"], [0, 4, 1, "", "locus"], [0, 2, 1, "", "rarecodons"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "sorted_features"], [0, 2, 1, "", "stamp"], [0, 2, 1, "", "startcodon"], [0, 2, 1, "", "stopcodon"], [0, 2, 1, "", "translate"]], "pydna.tm": [[0, 5, 1, "", "Q5"], [0, 5, 1, "", "dbd_program"], [0, 5, 1, "", "pfu_sso7d_program"], [0, 5, 1, "", "program"], [0, 5, 1, "", "ta_dbd"], [0, 5, 1, "", "ta_default"], [0, 5, 1, "", "taq_program"], [0, 5, 1, "", "tm_dbd"], [0, 5, 1, "", "tm_default"], [0, 5, 1, "", "tm_neb"], [0, 5, 1, "", "tm_product"], [0, 5, 1, "", "tmbresluc"]], "pydna.utils": [[0, 5, 1, "", "cai"], [0, 5, 1, "", "complement"], [0, 5, 1, "", "cuts_overlap"], [0, 5, 1, "", "eq"], [0, 5, 1, "", "express"], [0, 5, 1, "", "flatten"], [0, 5, 1, "", "identifier_from_string"], [0, 5, 1, "", "location_boundaries"], [0, 5, 1, "", "locations_overlap"], [0, 5, 1, "", "memorize"], [0, 5, 1, "", "open_folder"], [0, 5, 1, "", "randomDNA"], [0, 5, 1, "", "randomORF"], [0, 5, 1, "", "randomRNA"], [0, 5, 1, "", "randomprot"], [0, 5, 1, "", "rarecodons"], [0, 5, 1, "", "rc"], [0, 5, 1, "", "seq31"], [0, 5, 1, "", "shift_feature"], [0, 5, 1, "", "shift_location"], [0, 5, 1, "", "smallest_rotation"], [0, 5, 1, "", "three_frame_orfs"]]}, "objnames": {"0": ["py", "module", "Python module"], "1": ["py", "class", "Python class"], "2": ["py", "method", "Python method"], "3": ["py", "attribute", "Python attribute"], "4": ["py", "property", "Python property"], "5": ["py", "function", "Python function"]}, "objtypes": {"0": "py:module", "1": "py:class", "2": "py:method", "3": "py:attribute", "4": "py:property", "5": "py:function"}, "terms": {"0": 0, "01": 0, "02": 0, "050": 0, "0_first_prim": 0, "0m": 0, "1": 0, "10": 0, "100": 0, "100bp": 0, "101": 0, "101bp": 0, "102": 0, "102bp": 0, "1051bp": 0, "11": 0, "11m": 0, "12": 0, "13": 0, "1388": 0, "14": 0, "14bp": 0, "15": 0, "15058bp": 0, "166": 0, "169": 0, "17": 0, "18": 0, "19": 0, "1950267": 0, "1983": 0, "1990": 0, "1_second_prim": 0, "1c": 0, "1st": 0, "2": 0, "2007": 0, "2007025016": 0, "2011": 0, "2013": 0, "2023": 0, "2243783": 0, "23": 0, "231": 0, "2389": 0, "24": 0, "25": 0, "250": 0, "2577": 0, "27": 0, "289": 0, "2_third_prim": 0, "3": 0, "30": 0, "300": 0, "304": 0, "308": 0, "313": 0, "32": 0, "32630": 0, "329": 0, "33bp": 0, "34bp": 0, "35": 0, "357": 0, "35bp": 0, "36": 0, "363": 0, "381": 0, "3atgtgagtggcagatagtaatag": 0, "3c": 0, "3gcaagctttgaatgctac5": 0, "3gcaagctttgaatgctaccctagg5": 0, "3gctgacatagtagactatcgtg5": 0, "3min": 0, "3tactgacgattgggaag": 0, "4": 0, "40": 0, "41": 0, "42": 0, "45": 0, "48": 0, "5": 0, "50": 0, "500": 0, "51": 0, "52": 0, "53": 0, "54": 0, "55": 0, "557": 0, "5681": 0, "57": 0, "59": 0, "5atgactgctaacccttc": 0, "5atgactgctaacccttc3": 0, "5e": 0, "5ggatccatgactgctaacccttc3": 0, "5min": 0, "5tacactcaccgtctatcattatc": 0, "5tacactcaccgtctatcattatc3": 0, "6": 0, "60": 0, "600": 0, "61": 0, "64": 0, "7": 0, "72": 0, "72c": 0, "75": 0, "79": 0, "8": 0, "82": 0, "84": 0, "85t6tfcvwav0wnxeib": 0, "9": 0, "95": 0, "98": 0, "A": 0, "AND": 0, "As": 0, "At": 0, "By": 0, "For": 0, "If": 0, "In": 0, "It": 0, "NOT": 0, "No": 0, "One": 0, "The": 0, "Then": 0, "There": 0, "These": 0, "To": 0, "_": 0, "____": 0, "_____": 0, "______": 0, "________": 0, "_________": 0, "__________": 0, "____________": 0, "___________________": 0, "______________________": 0, "__init__": 0, "_abstractcut": 0, "_klenow_frag": 0, "_mt": 0, "_mwstd": 0, "_new": 0, "_pretty_str": 0, "_restrictionbatch": 0, "_seqabstractbaseclass": 0, "_sy": 0, "_tm_default": 0, "_weight": 0, "a1": 0, "aa": 0, "aaa": 0, "aaaa": 0, "aaaaaa": 0, "aaac": 0, "aaacccc": 0, "aaagcccta": 0, "aaagcctag": 0, "aaagttct": 0, "aaat": 0, "aaatatagcgtactgagaagaaa": 0, "aaatg": 0, "aag": 0, "aagaattcaa": 0, "aagaattcaagaattc": 0, "aagaattcaagaattcaa": 0, "aat": 0, "aata": 0, "aattcaa": 0, "aattcaag": 0, "aattcc": 0, "about": 0, "abov": 0, "absolut": 0, "accept": 0, "access": 0, "accompani": 0, "accord": 0, "acg": 0, "acgatgctatactg": 0, "acgatgctatactgccccctgtgctgtgctcta": 0, "acgatgctatactgccccctgtgctgtgctctattttttattctggctgtatcgggggt": 0, "acid": 0, "acitivti": 0, "actgt": 0, "activ": 0, "actta": 0, "ad": 0, "adapt": 0, "add": 0, "add_colors_to_features_for_ap": 0, "add_featur": 0, "addition": 0, "address": 0, "adjac": 0, "advanc": 0, "after": 0, "agaaa": 0, "agaattcaa": 0, "agaros": 0, "agcct": 0, "agcctatcatcttggtctctgca": 0, "agcctatcatcttggtctctgcatttatat": 0, "agcctatcatcttggtctctgcatttatatcgcatgactcttcttt": 0, "agctag": 0, "agctatgtatcttgcatcgta": 0, "aggcct": 0, "agt": 0, "ala": 0, "algorithm": 0, "alia": 0, "all": 0, "allow": 0, "almost": 0, "alon": 0, "alphabet": 0, "alreadi": 0, "also": 0, "altern": 0, "alwai": 0, "ambigu": 0, "amino": 0, "amount": 0, "ampl": 0, "amplicon1": 0, "amplicon1amplicon2amplicon3": 0, "amplicon1amplicon2amplicon3amplicon4": 0, "amplicon1dseqrecd1amplicon2dseqrecd2": 0, "amplicon2": 0, "amplicon3": 0, "amplicon4": 0, "amplif": 0, "amplify_ann": 0, "an": 0, "anaconda3": 0, "analysi": 0, "analyz": 0, "ani": 0, "anneal": 0, "annot": 0, "anoth": 0, "anselm": 0, "antisens": 0, "ap": 0, "apeextractor": 0, "apeinfo": 0, "api": 0, "app": 0, "appear": 0, "apply_cut": 0, "appmain": 0, "aptam": 0, "ar": 0, "arg": 0, "argument": 0, "around": 0, "art": 0, "artifici": 0, "ascii": 0, "assembl": 0, "assemble_circular": 0, "assemble_linear": 0, "assembly_assembli": 0, "assembly_frag": 0, "assemblyobj": 0, "assign": 0, "assign_numb": 0, "assign_numbers_to_new_prim": 0, "associ": 0, "assum": 0, "asterisk": 0, "asx": 0, "ataa": 0, "atc": 0, "atcg": 0, "atcgactgacgtgtt": 0, "atcgtgt": 0, "atcgtgtactgtcatattc": 0, "atg": 0, "atga": 0, "atgaaa": 0, "atgaccc": 0, "atgactgctaaccct": 0, "atgactgctaacccttc": 0, "atgactgctaacccttccttggtgttg": 0, "atgactgctaacccttccttggtgttgaacaagatcgacgacatttcgttcgaaacttacgatg": 0, "atggccattgtaatgggccgctgaaagggtgcccgatag": 0, "atgtaa": 0, "atgtacgatcgtatgctggttatattttag": 0, "atgttcctac": 0, "attca": 0, "attempt": 0, "attribut": 0, "atttaa": 0, "auggccauuguaaugggccgcugaaagggugcccgauag": 0, "author": 0, "automat": 0, "automaticli": 0, "avail": 0, "b": 0, "back": 0, "bamhi": 0, "base": 0, "base64": 0, "basic": 0, "batch": 0, "bean": 0, "becaus": 0, "becom": 0, "been": 0, "befor": 0, "begin": 0, "behav": 0, "below": 0, "best": 0, "beta": 0, "between": 0, "bind": 0, "bio": 0, "biojson": 0, "biolog": 0, "biologi": 0, "biologylab": 0, "biopython": 0, "biopython_cod": 0, "biopythonparserwarn": 0, "bjorn": 0, "bjorn36": 0, "bjornjobb": 0, "bj\u00f6rn": 0, "bkgnebmkia5kng": 0, "blunt": 0, "bool": 0, "both": 0, "bp": 0, "bring": 0, "brixtel": 0, "broken": 0, "bug": 0, "built": 0, "byte": 0, "bytearrai": 0, "c": 0, "c_seq": 0, "ca": 0, "caaa": 0, "caaag": 0, "cach": 0, "cached_func": 0, "cai": 0, "calcul": 0, "call": 0, "callabl": 0, "can": 0, "cannot": 0, "capabl": 0, "capac": 0, "capit": 0, "care": 0, "carefulli": 0, "cas9": 0, "case": 0, "catattc": 0, "catattcaaagttct": 0, "catcga": 0, "catcgat": 0, "catcgatc": 0, "catcgtaagtttcga": 0, "catcgtaagtttcgaacg": 0, "catgatctacgt": 0, "catgatctacgtatcgtgt": 0, "cation": 0, "ccaaacccaccaggtaccttatgtaagtacttcaagtcgccagaagacttcttggtcaagttgcc": 0, "ccc": 0, "ccccaaa": 0, "ccccc": 0, "ccccttt": 0, "ccgga": 0, "cctag": 0, "cctagg": 0, "cctaggnnncttaag": 0, "ccttaa": 0, "cd": 0, "cdseguid": 0, "cgactgtatcatctgatagcac": 0, "cgactgtatcatctgatagcac3": 0, "cgi": 0, "cgtatgctg": 0, "cgttcgaaacttacgatg3": 0, "chang": 0, "charact": 0, "check": 0, "check_primer_numb": 0, "checksum": 0, "chew": 0, "christophchamp": 0, "circular": 0, "circular_assembly_frag": 0, "class": 0, "classmethod": 0, "clean": 0, "clone": 0, "closest": 0, "coding_dna": 0, "coerc": 0, "collect": 0, "color": 0, "com": 0, "combin": 0, "combo": 0, "comma": 0, "command": 0, "comment": 0, "common": 0, "compact": 0, "compar": 0, "comparison": 0, "compat": 0, "complement": 0, "complet": 0, "compoundloc": 0, "comput": 0, "conc": 0, "concat_dict": 0, "concaten": 0, "concentr": 0, "concept": 0, "configpars": 0, "configur": 0, "connect": 0, "consid": 0, "considi": 0, "construct": 0, "contact": 0, "contain": 0, "control": 0, "conveni": 0, "convens": 0, "convent": 0, "copi": 0, "copy_fasta_to_clipboard": 0, "copy_gb_to_clipboard": 0, "copyright": 0, "correct": 0, "correctli": 0, "cottenoir": 0, "could": 0, "cover": 0, "creat": 0, "creation": 0, "crick": 0, "crick_ovhg": 0, "cs570233": 0, "cseguid": 0, "cta": 0, "ctag": 0, "ctagctac": 0, "ctagctag": 0, "ctagg": 0, "ctaggatcgtagatctagctg": 0, "ctaggg": 0, "ctctgcatttatat": 0, "ctctgcatttatatcgcatgactcttcttt": 0, "ctg": 0, "ctgggta": 0, "ctrl": 0, "ctta": 0, "cttt": 0, "cttta": 0, "current": 0, "cursor": 0, "custom": 0, "cut": 0, "cut_crick": 0, "cut_watson": 0, "cuts_overlap": 0, "cutsit": 0, "cutsite_is_valid": 0, "cutter": 0, "d": 0, "data": 0, "data_dir": 0, "date": 0, "datefunct": 0, "david": 0, "db_xref": 0, "dbd_program": 0, "dbxref": 0, "de_tabl": 0, "deal": 0, "debug": 0, "decemb": 0, "deduc": 0, "default": 0, "defin": 0, "definit": 0, "depict": 0, "deprec": 0, "describ": 0, "descript": 0, "detail": 0, "detailed_figur": 0, "detect": 0, "determin": 0, "develop": 0, "dict": 0, "differ": 0, "difficult": 0, "digest": 0, "dir": 0, "direct": 0, "directli": 0, "directori": 0, "dist": 0, "dlist": 0, "dna": 0, "dna_nn3": 0, "dna_nn4": 0, "dnac1": 0, "dnac2": 0, "dntp": 0, "do": 0, "doc": 0, "docstr": 0, "doctr": 0, "doe": 0, "domain": 0, "done": 0, "doubl": 0, "down": 0, "download_text": 0, "dropbox": 0, "dsdna": 0, "dseqr": 0, "dseqrecd1": 0, "dseqrecd1amplicon1amplicon2": 0, "dseqrecd1amplicon1dseqrecd2amplicon2": 0, "dseqrecd2": 0, "dseqrecord_frag": 0, "dseqrecord_sync": 0, "dseqtyp": 0, "dump": 0, "duplic": 0, "dure": 0, "duval": 0, "dvberkel": 0, "e": 0, "each": 0, "earlier": 0, "easier": 0, "easiest": 0, "ecori": 0, "edg": 0, "edit": 0, "edu": 0, "effect": 0, "either": 0, "element": 0, "els": 0, "email": 0, "embl": 0, "embl_gb_fasta": 0, "empti": 0, "en": 0, "encod": 0, "end": 0, "engin": 0, "enough": 0, "ensur": 0, "enter": 0, "entir": 0, "entri": 0, "env": 0, "environ": 0, "environment": 0, "enz": 0, "enzym": 0, "enzymestyp": 0, "eppstein": 0, "eq": 0, "equal": 0, "equival": 0, "especi": 0, "estim": 0, "estimate_funct": 0, "even": 0, "everi": 0, "exactposit": 0, "excactli": 0, "excel": 0, "except": 0, "exist": 0, "exo": 0, "exo1_end": 0, "exo1_front": 0, "exonucleas": 0, "expect": 0, "explan": 0, "explicitli": 0, "explor": 0, "express": 0, "extern": 0, "extra": 0, "extract": 0, "extract_featur": 0, "extract_from_text": 0, "f": 0, "f64": 0, "fa": 0, "fa1": 0, "fa2": 0, "facilit": 0, "factor": 0, "fall": 0, "fals": 0, "fasta": 0, "faster": 0, "fb": 0, "fc": 0, "featur": 0, "feb": 0, "field": 0, "figur": 0, "file": 0, "filenam": 0, "fill": 0, "fill_in": 0, "final": 0, "find": 0, "find_aa": 0, "find_aminoacid": 0, "find_duplicate_prim": 0, "first": 0, "fit": 0, "five": 0, "five_prime_end": 0, "fix": 0, "flank": 0, "flatten": 0, "flexibl": 0, "float": 0, "folder": 0, "follow": 0, "footprint": 0, "fore": 0, "form": 0, "format": 0, "formula": 0, "forward": 0, "forward_prim": 0, "found": 0, "four": 0, "fp": 0, "fr": 0, "frag": 0, "frag1": 0, "frag14": 0, "frag2": 0, "frag20": 0, "frag23": 0, "fragment": 0, "frame": 0, "fring": 0, "from": 0, "from_bio_seqrecord": 0, "from_full_sequence_and_overhang": 0, "from_represent": 0, "from_seqrecord": 0, "from_str": 0, "ft": 0, "ft2": 0, "full": 0, "full_sequ": 0, "func": 0, "function": 0, "funtion": 0, "further": 0, "fuse": 0, "fusion": 0, "fwd": 0, "g": 0, "gaaat": 0, "gaat": 0, "gaattc": 0, "gac": 0, "gacccat": 0, "gacgt": 0, "gagacgtaaatata": 0, "gagacgtaaatatagcgtactgagaagaaa": 0, "gap": 0, "gat": 0, "gatc": 0, "gatcc": 0, "gatccnnngaattc": 0, "gatccttt": 0, "gatcg": 0, "gatcga": 0, "gatcgat": 0, "gatcgatc": 0, "gatcgatg": 0, "gattaca": 0, "gb": 0, "gbkstring": 0, "gbtext": 0, "gbtext_clean": 0, "gbw0jp907tg_yx3jngs4qqwttj": 0, "gbw0jp907tg_yx3jngs4qqwttju": 0, "gc": 0, "gcaagctttgaatgctac5": 0, "gcatacgac": 0, "gcatcgtagtctatttgcttac": 0, "gcta": 0, "gctag": 0, "gctgacatagtagactatcgtg5": 0, "gel_length": 0, "genbank_nucleotid": 0, "gener": 0, "get_cut_paramet": 0, "get_cutsit": 0, "get_cutsite_pair": 0, "get_env": 0, "getcwd": 0, "gf7iorxmniu": 0, "ggaatt": 0, "ggatc": 0, "ggatcc": 0, "ggatcca": 0, "ggatccatgactgct": 0, "ggatccatgactgctaacccttccttggtgttgaacaagatcgacgacatttcgttcgaaacttacgatgggatcc": 0, "ggatcccatcgtaag": 0, "ggatccnnngaattc": 0, "ggcct": 0, "gggaaat": 0, "ggggtttcccc": 0, "gibson": 0, "gip0": 0, "gist": 0, "github": 0, "given": 0, "gmail": 0, "gnnncttaag": 0, "googl": 0, "gov": 0, "govern": 0, "gram": 0, "graph": 0, "greater": 0, "greedi": 0, "greedili": 0, "greyc": 0, "group": 0, "gt": 0, "gtagcta": 0, "gtagctag": 0, "gtt": 0, "gttcttaa": 0, "gttt": 0, "gtttc": 0, "guess": 0, "ha": 0, "half": 0, "handl": 0, "happen": 0, "have": 0, "helix": 0, "high": 0, "highlight": 0, "hold": 0, "home": 0, "homolog": 0, "homologi": 0, "http": 0, "i": 0, "id": 0, "ident": 0, "identifi": 0, "identifier_from_str": 0, "ignor": 0, "imm_tabl": 0, "immedi": 0, "immut": 0, "implement": 0, "import": 0, "includ": 0, "incorpor": 0, "index": 0, "indexerror": 0, "inform": 0, "ing": 0, "inhibit": 0, "inhibitor": 0, "ini": 0, "initi": 0, "initlist": 0, "inplac": 0, "input": 0, "insensit": 0, "insert": 0, "inspect": 0, "instanc": 0, "instanti": 0, "instead": 0, "instread": 0, "int": 0, "integ": 0, "intermedi": 0, "interpol": 0, "interpret": 0, "introspect": 0, "invers": 0, "involv": 0, "ipython": 0, "is_left": 0, "isblunt": 0, "isorf": 0, "issu": 0, "item": 0, "iter": 0, "its": 0, "itself": 0, "iupac": 0, "j": 0, "j2": 0, "jean": 0, "johansson": 0, "join": 0, "jorgensen": 0, "journal": 0, "jseq": 0, "json": 0, "jun": 0, "junction": 0, "just": 0, "k": 0, "kb": 0, "keep": 0, "kei": 0, "keyword": 0, "klenow": 0, "klenow_frag": 0, "kwarg": 0, "l": 0, "l_": 0, "label": 0, "lactamas": 0, "larger": 0, "last": 0, "lc": 0, "ldseguid": 0, "least": 0, "left": 0, "left_cut": 0, "left_end_posit": 0, "len": 0, "lenght": 0, "length": 0, "length1": 0, "length2": 0, "less": 0, "letter": 0, "levskaya": 0, "lib": 0, "licenc": 0, "licens": 0, "lift": 0, "like": 0, "lim": 0, "limit": 0, "line": 0, "linear": 0, "link": 0, "linux": 0, "list": 0, "list_featur": 0, "lkutrl4": 0, "lkynqhtivh": 0, "loc": 0, "loc1": 0, "loc2": 0, "local": 0, "locat": 0, "location_boundari": 0, "locations_overlap": 0, "locstr": 0, "locu": 0, "log": 0, "log_dir": 0, "loglevel": 0, "logo": 0, "logotyp": 0, "long": 0, "longer": 0, "longest": 0, "look": 0, "loop": 0, "lost": 0, "lower": 0, "lowercas": 0, "lp002422": 0, "lseguid": 0, "lsseguid": 0, "lst": 0, "lyndon": 0, "m": 0, "made": 0, "mai": 0, "main": 0, "maivmgrt": 0, "maivmgru": 0, "maivmgrwkgar": 0, "make": 0, "malform": 0, "manag": 0, "mani": 0, "manual": 0, "map": 0, "map_trace_fil": 0, "mar": 0, "margin": 0, "mass": 0, "match": 0, "max": 0, "max_nod": 0, "maximum": 0, "maxlength": 0, "maxlink": 0, "maxsiz": 0, "mean": 0, "meant": 0, "melt": 0, "memor": 0, "mention": 0, "mer": 0, "merg": 0, "meta": 0, "metalailevalmetglyargtrplysglyalaargt": 0, "metallo": 0, "method": 0, "methyl": 0, "mg": 0, "might": 0, "minimum": 0, "minsiz": 0, "misc": 0, "miscellan": 0, "mit": 0, "mix": 0, "mixtur": 0, "mm": 0, "mmm": 0, "mode": 0, "modif": 0, "modifi": 0, "mol": 0, "mol_typ": 0, "molecul": 0, "molecular": 0, "molecule_typ": 0, "monoval": 0, "most": 0, "mostli": 0, "move": 0, "mung": 0, "mung_bean_nucleas": 0, "must": 0, "mutableseq": 0, "mw": 0, "mwstd": 0, "my_protein": 0, "my_seq": 0, "mydrmlvif": 0, "myemail": 0, "n": 0, "n_cutter": 0, "na": 0, "name": 0, "ncbi": 0, "neb": 0, "nebswebsit": 0, "necessari": 0, "need": 0, "neg": 0, "networkx": 0, "new": 0, "new_dna": 0, "newcom": 0, "next": 0, "nicer": 0, "nih": 0, "nlm": 0, "nm": 0, "nn_tabl": 0, "nnn": 0, "nnnn": 0, "nnnnn": 0, "no_cutt": 0, "node": 0, "nodemap": 0, "non": 0, "none": 0, "normal": 0, "note": 0, "noth": 0, "notion": 0, "now": 0, "nucleas": 0, "nucleotid": 0, "nuclotid": 0, "number": 0, "number_of_cut": 0, "numer": 0, "o": 0, "o3": 0, "o4": 0, "o59": 0, "o6": 0, "o7": 0, "o8": 0, "obj": 0, "object": 0, "obtain": 0, "occur": 0, "occurr": 0, "off": 0, "old": 0, "oligonuceotid": 0, "onc": 0, "once_cutt": 0, "one": 0, "onli": 0, "onlin": 0, "open": 0, "open_cache_fold": 0, "open_config_fold": 0, "open_current_fold": 0, "open_fold": 0, "open_log_fold": 0, "optim": 0, "option": 0, "order": 0, "orf": 0, "orfs_to_featur": 0, "org": 0, "organ": 0, "orient": 0, "origin": 0, "original_loc": 0, "originstr": 0, "other": 0, "otherwis": 0, "out": 0, "output": 0, "outsid": 0, "over": 0, "overhang": 0, "overlap": 0, "ovhg": 0, "own": 0, "p": 0, "p1": 0, "p2": 0, "p3": 0, "pad": 0, "padfirst": 0, "page": 0, "pair": 0, "param": 0, "parament": 0, "paramet": 0, "pars": 0, "parse_prim": 0, "parsegbloc": 0, "part": 0, "part_nam": 0, "pass": 0, "past": 0, "pat": 0, "patent": 0, "path": 0, "pathlib": 0, "pcr": 0, "pcr_prod": 0, "perform": 0, "permanantli": 0, "permut": 0, "pf": 0, "pfu": 0, "pfu_sso7d_program": 0, "php": 0, "phusion": 0, "pierr": 0, "pl": 0, "place": 0, "plain": 0, "plasmid": 0, "plausibl": 0, "pleas": 0, "plu": 0, "po": 0, "point": 0, "polymeras": 0, "pop": 0, "posit": 0, "possibl": 0, "power": 0, "pr": 0, "practic": 0, "preceed": 0, "prefer": 0, "presenc": 0, "present": 0, "press": 0, "pretty_str": 0, "previou": 0, "prime": 0, "primer1": 0, "primer_design": 0, "primerc": 0, "primerdict": 0, "primerlist": 0, "prinmer": 0, "print": 0, "probabl": 0, "process": 0, "prodcod": 0, "produc": 0, "product": 0, "productcod": 0, "program": 0, "properti": 0, "protein": 0, "proteinseqrecord": 0, "protocol": 0, "protrud": 0, "provid": 0, "pth": 0, "pubm": 0, "purpos": 0, "put": 0, "py": 0, "pydna_": 0, "pydna_cached_func": 0, "pydna_cod": 0, "pydna_code_from_list": 0, "pydna_config_dir": 0, "pydna_data_dir": 0, "pydna_email": 0, "pydna_prim": 0, "pydnaseqrecord": 0, "pyl": 0, "pypars": 0, "python": 0, "python2": 0, "python3": 0, "python_packag": 0, "q5": 0, "qht": 0, "qualifi": 0, "quick": 0, "quicker": 0, "quit": 0, "r": 0, "r64": 0, "rais": 0, "randomdna": 0, "randomorf": 0, "randomprot": 0, "randomrna": 0, "rarecodon": 0, "ration": 0, "rbrixtel_at_gmail_dot_com": 0, "rc": 0, "reaction": 0, "read": 0, "read_prim": 0, "readabl": 0, "reason": 0, "rec": 0, "recent": 0, "recognit": 0, "recombin": 0, "record": 0, "ref": 0, "refer": 0, "reflect": 0, "region": 0, "relat": 0, "reli": 0, "rememb": 0, "remov": 0, "render": 0, "repeat": 0, "replac": 0, "report": 0, "repositori": 0, "repr": 0, "repres": 0, "represent": 0, "requir": 0, "resect": 0, "reserv": 0, "respect": 0, "restrict": 0, "restrictionbatch": 0, "restrictionenzym": 0, "result": 0, "return": 0, "retwingl": 0, "rev": 0, "revers": 0, "reverse_compl": 0, "reverse_prim": 0, "rhoad": 0, "right": 0, "right_cut": 0, "right_end_posit": 0, "rml": 0, "rna": 0, "romain": 0, "rotat": 0, "roundtrip": 0, "rowend": 0, "rowstart": 0, "rp": 0, "rstr": 0, "rule": 0, "rychlik": 0, "s2": 0, "s3": 0, "safe": 0, "salt": 0, "saltc": 0, "saltcorr": 0, "same": 0, "sampl": 0, "scanner": 0, "sce": 0, "search": 0, "second": 0, "section": 0, "see": 0, "seguid": 0, "sel": 0, "selenocystein": 0, "self": 0, "selfcomp": 0, "sens": 0, "sensit": 0, "separ": 0, "seq": 0, "seq3": 0, "seq31": 0, "seq_len": 0, "seq_to_open": 0, "seqenc": 0, "seqfeatur": 0, "seqio": 0, "sequec": 0, "sequenc": 0, "sequtil": 0, "set": 0, "set_forward_primer_footprint": 0, "set_reverse_primer_footprint": 0, "sever": 0, "shape": 0, "share": 0, "shaw": 0, "shell": 0, "shell_command_for_editor": 0, "shift": 0, "shift_featur": 0, "shift_loc": 0, "short": 0, "shortest": 0, "should": 0, "show": 0, "side": 0, "sign": 0, "similar": 0, "simpl": 0, "simpleloc": 0, "simpler": 0, "simplifi": 0, "simul": 0, "sinc": 0, "singl": 0, "site": 0, "size": 0, "slc": 0, "slice": 0, "slightli": 0, "slow": 0, "smallest": 0, "smallest_rot": 0, "snippet": 0, "so": 0, "softwar": 0, "some": 0, "someon": 0, "sort": 0, "sorted_featur": 0, "spacer": 0, "specif": 0, "specifi": 0, "spencer": 0, "split": 0, "spyder": 0, "sr": 0, "sso7d": 0, "sta": 0, "stagger": 0, "stamp": 0, "standard": 0, "start": 0, "startcodon": 0, "startposit": 0, "startx1": 0, "startx2": 0, "starty1": 0, "starty2": 0, "stdin": 0, "stdout": 0, "sticki": 0, "sticky3": 0, "sticky5": 0, "stop": 0, "stop_symbol": 0, "stopcodon": 0, "store": 0, "str": 0, "str_": 0, "strand": 0, "stretch": 0, "strict": 0, "string": 0, "stringi": 0, "stringx": 0, "strip_ind": 0, "strip_multilin": 0, "strorbyt": 0, "structur": 0, "stuff": 0, "sub": 0, "subclass": 0, "subfrag": 0, "sublcass": 0, "subsequ": 0, "substitut": 0, "substr": 0, "suggest": 0, "suppli": 0, "support": 0, "surviv": 0, "switch": 0, "symbol": 0, "syn": 0, "sync": 0, "synhtes": 0, "synthet": 0, "system": 0, "t": 0, "t4": 0, "ta": 0, "ta_dbd": 0, "ta_default": 0, "taa": 0, "taaa": 0, "tab": 0, "tac": 0, "tacactcaccgtctatcattatc": 0, "tacactcaccgtctatcattatctactatcgactgtatcatctgatagcac": 0, "tact": 0, "tactggg": 0, "tag": 0, "tagctag": 0, "tagctgactgcacaa": 0, "tail": 0, "take": 0, "taq": 0, "taq_program": 0, "target": 0, "target_tm": 0, "tattctggctgtatc": 0, "tattctggctgtatcgggggtacgatgctatactg": 0, "taxon": 0, "taxonomi": 0, "tccgga": 0, "tcctag": 0, "tcgcatgactcttcttt": 0, "tcggatagtagaacca": 0, "tcggatagtagaaccagagacgt": 0, "tcggatagtagaaccagagacgtaaatata": 0, "tcggatagtagaaccagagacgtaaatatagcgtactgagaagaaa": 0, "tcl": 0, "tclsh": 0, "tclsh8": 0, "tcttggtctctgcatttatat": 0, "tech": 0, "techniqu": 0, "technologi": 0, "tell": 0, "temp": 0, "temperatur": 0, "templat": 0, "temprari": 0, "ter": 0, "term": 0, "termin": 0, "terminal_overlap": 0, "terminal_transferas": 0, "test": 0, "tewydy0ugvgxh3vjnvwgtxoydqa": 0, "texa": 0, "text": 0, "tga": 0, "tgagtagtcgtagtcgtcgtat": 0, "tgatcgtcatgctgactatactat": 0, "tggatcc": 0, "tgtactggtgctgaaccttgtatcaagttgggtgttgacgccattgccccaggtggtcgtttcgtt": 0, "tgtgctgtgctcta": 0, "tgtgctgtgctctattttttattctggctgtatc": 0, "than": 0, "the_exo": 0, "thei": 0, "them": 0, "thermodynam": 0, "thi": 0, "thing": 0, "those": 0, "three": 0, "three_frame_orf": 0, "three_prime_end": 0, "threonin": 0, "through": 0, "throw": 0, "thrown": 0, "time": 0, "titl": 0, "tm_dbd": 0, "tm_default": 0, "tm_func": 0, "tm_neb": 0, "tm_nn": 0, "tm_product": 0, "tmapi": 0, "tmbresluc": 0, "tmf": 0, "tmm_tabl": 0, "tmpdir": 0, "tmr": 0, "to_stop": 0, "togb": 0, "togeth": 0, "toint": 0, "tojson": 0, "tolinear": 0, "tool": 0, "top": 0, "topologi": 0, "tp2jzecm2e3w4yxtrrx09cmka_8": 0, "trace": 0, "traceback": 0, "track": 0, "transcrib": 0, "translat": 0, "treatment": 0, "tri": 0, "trick": 0, "true": 0, "trunc": 0, "try": 0, "tt": 0, "ttaagg": 0, "ttat": 0, "ttc": 0, "ttcaagaa": 0, "ttcttaa": 0, "ttcttaagtt": 0, "ttg": 0, "ttt": 0, "ttta": 0, "tttac": 0, "tttat": 0, "tttatatcgcatgactcttcttt": 0, "tttc": 0, "tttcccc": 0, "tttg": 0, "tttt": 0, "tttttt": 0, "tupl": 0, "turn": 0, "tweak": 0, "twice": 0, "twice_cutt": 0, "two": 0, "txt": 0, "type": 0, "type3": 0, "type5": 0, "type_": 0, "typeerror": 0, "typic": 0, "u": 0, "unassign": 0, "undefined_sequ": 0, "underli": 0, "union": 0, "unique_cutt": 0, "univers": 0, "unk": 0, "unknown": 0, "up": 0, "upper": 0, "uppercas": 0, "url": 0, "urlsaf": 0, "usag": 0, "user": 0, "userlist": 0, "users_email": 0, "usr": 0, "usual": 0, "utah": 0, "v": 0, "val": 0, "valid": 0, "valu": 0, "valueerror": 0, "variabl": 0, "variou": 0, "vector": 0, "veri": 0, "version": 0, "vf": 0, "view": 0, "visual": 0, "vitro": 0, "vivo": 0, "w": 0, "wa": 0, "wai": 0, "watson": 0, "watson_ovhg": 0, "wayn": 0, "we": 0, "weight": 0, "well": 0, "when": 0, "where": 0, "which": 0, "while": 0, "who": 0, "whole": 0, "whose": 0, "wiki": 0, "wikidata": 0, "wikipedia": 0, "window": 0, "without": 0, "wo": 0, "wo2007025016": 0, "word": 0, "work": 0, "would": 0, "wprintgc": 0, "wrap": 0, "wrapstr": 0, "write": 0, "written": 0, "www": 0, "x": 0, "x1b": 0, "xaa": 0, "xle": 0, "xxx": 0, "y": 0, "yet": 0, "you": 0, "z": 0}, "titles": ["Welcome to pydna\u2019s documentation!"], "titleterms": {"": 0, "amplicon": 0, "amplifi": 0, "assembli": 0, "code": 0, "common_sub_str": 0, "content": 0, "contig": 0, "design": 0, "document": 0, "download": 0, "dseq": 0, "dseqrecord": 0, "editor": 0, "exampl": 0, "gel": 0, "genbank": 0, "genbankfil": 0, "genbankfix": 0, "genbankrecord": 0, "get": 0, "help": 0, "how": 0, "indic": 0, "layout": 0, "modul": 0, "more": 0, "myprim": 0, "packag": 0, "parser": 0, "primer": 0, "pydna": 0, "reader": 0, "seqrecord": 0, "sourc": 0, "tabl": 0, "tm": 0, "us": 0, "util": 0, "welcom": 0}})
\ No newline at end of file
+Search.setIndex({"alltitles": {"Examples of pydna in use": [[0, "examples-of-pydna-in-use"]], "How to get more help": [[0, "how-to-get-more-help"]], "How to use the documentation": [[0, "how-to-use-the-documentation"]], "Indices and tables": [[0, "indices-and-tables"]], "Module contents": [[0, "module-pydna"]], "Welcome to pydna\u2019s documentation!": [[0, null]], "pydna": [[0, "pydna"]], "pydna package layout": [[0, "pydna-package-layout"]], "pydna source code": [[0, "pydna-source-code"]], "pydna.amplicon module": [[0, "module-pydna.amplicon"]], "pydna.amplify module": [[0, "module-pydna.amplify"]], "pydna.assembly module": [[0, "module-pydna.assembly"]], "pydna.common_sub_strings module": [[0, "module-pydna.common_sub_strings"]], "pydna.contig module": [[0, "module-pydna.contig"]], "pydna.design module": [[0, "module-pydna.design"]], "pydna.download module": [[0, "module-pydna.download"]], "pydna.dseq module": [[0, "module-pydna.dseq"]], "pydna.dseqrecord module": [[0, "module-pydna.dseqrecord"]], "pydna.editor module": [[0, "module-pydna.editor"]], "pydna.gel module": [[0, "module-pydna.gel"]], "pydna.genbank module": [[0, "module-pydna.genbank"]], "pydna.genbankfile module": [[0, "module-pydna.genbankfile"]], "pydna.genbankfixer module": [[0, "module-pydna.genbankfixer"]], "pydna.genbankrecord module": [[0, "module-pydna.genbankrecord"]], "pydna.myprimers module": [[0, "module-pydna.myprimers"]], "pydna.parsers module": [[0, "module-pydna.parsers"]], "pydna.primer module": [[0, "module-pydna.primer"]], "pydna.readers module": [[0, "module-pydna.readers"]], "pydna.seqrecord module": [[0, "module-pydna.seqrecord"]], "pydna.tm module": [[0, "module-pydna.tm"]], "pydna.utils module": [[0, "module-pydna.utils"]]}, "docnames": ["index"], "envversion": {"sphinx": 63, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinx.ext.viewcode": 1}, "filenames": ["index.rst"], "indexentries": {"accessed (pydna.myprimers.primerlist property)": [[0, "pydna.myprimers.PrimerList.accessed", false]], "accession (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.accession", false]], "add_colors_to_features_for_ape() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.add_colors_to_features_for_ape", false]], "add_feature() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.add_feature", false]], "add_feature() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.add_feature", false]], "amplicon (class in pydna.amplicon)": [[0, "pydna.amplicon.Amplicon", false]], "anneal (class in pydna.amplify)": [[0, "pydna.amplify.Anneal", false]], "ape() (in module pydna.editor)": [[0, "pydna.editor.ape", false]], "apply_cut() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.apply_cut", false]], "apply_cut() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.apply_cut", false]], "assemble_circular() (pydna.assembly.assembly method)": [[0, "pydna.assembly.Assembly.assemble_circular", false]], "assemble_linear() (pydna.assembly.assembly method)": [[0, "pydna.assembly.Assembly.assemble_linear", false]], "assembly (class in pydna.assembly)": [[0, "pydna.assembly.Assembly", false]], "assembly_fragments() (in module pydna.design)": [[0, "pydna.design.assembly_fragments", false]], "assign_numbers() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.assign_numbers", false]], "biopython_code() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.biopython_code", false]], "cai() (in module pydna.utils)": [[0, "pydna.utils.cai", false]], "cai() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.cai", false]], "cai() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.cai", false]], "cas9() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cas9", false]], "cas9() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cas9", false]], "check_primer_numbers() (in module pydna.myprimers)": [[0, "pydna.myprimers.check_primer_numbers", false]], "circular (pydna.dseqrecord.dseqrecord property)": [[0, "pydna.dseqrecord.Dseqrecord.circular", false]], "circular_assembly_fragments() (in module pydna.design)": [[0, "pydna.design.circular_assembly_fragments", false]], "code() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.code", false]], "comment() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.comment", false]], "common_sub_strings() (in module pydna.common_sub_strings)": [[0, "pydna.common_sub_strings.common_sub_strings", false]], "complement() (in module pydna.utils)": [[0, "pydna.utils.complement", false]], "concat_dict() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.concat_dict", false]], "contig (class in pydna.contig)": [[0, "pydna.contig.Contig", false]], "copy() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.copy", false]], "copy_fasta_to_clipboard() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.copy_fasta_to_clipboard", false]], "copy_gb_to_clipboard() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.copy_gb_to_clipboard", false]], "cut() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cut", false]], "cut() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cut", false]], "cuts_overlap() (in module pydna.utils)": [[0, "pydna.utils.cuts_overlap", false]], "cutsite_is_valid() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cutsite_is_valid", false]], "cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cutters", false]], "cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cutters", false]], "datefunction() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.datefunction", false]], "dbd_program() (in module pydna.tm)": [[0, "pydna.tm.dbd_program", false]], "dbd_program() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.dbd_program", false]], "definition (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.definition", false]], "detailed_figure() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.detailed_figure", false]], "dseq (class in pydna.dseq)": [[0, "pydna.dseq.Dseq", false]], "dseqrecord (class in pydna.dseqrecord)": [[0, "pydna.dseqrecord.Dseqrecord", false]], "dump() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.dump", false]], "editor (class in pydna.editor)": [[0, "pydna.editor.Editor", false]], "embl_gb_fasta() (in module pydna.parsers)": [[0, "pydna.parsers.embl_gb_fasta", false]], "eq() (in module pydna.utils)": [[0, "pydna.utils.eq", false]], "exo1_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.exo1_end", false]], "exo1_front() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.exo1_front", false]], "express() (in module pydna.utils)": [[0, "pydna.utils.express", false]], "express() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.express", false]], "express() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.express", false]], "extract_feature() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.extract_feature", false]], "extract_feature() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.extract_feature", false]], "extract_from_text() (in module pydna.parsers)": [[0, "pydna.parsers.extract_from_text", false]], "figure() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.figure", false]], "figure() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.figure", false]], "figure() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.figure", false]], "fill_in() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.fill_in", false]], "find() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.find", false]], "find() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find", false]], "find_aa() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find_aa", false]], "find_aminoacids() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find_aminoacids", false]], "find_duplicate_primers() (in module pydna.myprimers)": [[0, "pydna.myprimers.find_duplicate_primers", false]], "five_prime_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.five_prime_end", false]], "flatten() (in module pydna.utils)": [[0, "pydna.utils.flatten", false]], "footprint (pydna.primer.primer property)": [[0, "pydna.primer.Primer.footprint", false]], "format() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.format", false]], "forward_primers (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.forward_primers", false]], "from_bio_seqrecord() (pydna.seqrecord.seqrecord class method)": [[0, "pydna.seqrecord.SeqRecord.from_Bio_SeqRecord", false]], "from_full_sequence_and_overhangs() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_full_sequence_and_overhangs", false]], "from_representation() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_representation", false]], "from_seqrecord() (pydna.amplicon.amplicon class method)": [[0, "pydna.amplicon.Amplicon.from_SeqRecord", false]], "from_seqrecord() (pydna.contig.contig class method)": [[0, "pydna.contig.Contig.from_SeqRecord", false]], "from_seqrecord() (pydna.dseqrecord.dseqrecord class method)": [[0, "pydna.dseqrecord.Dseqrecord.from_SeqRecord", false]], "from_seqrecord() (pydna.genbankfile.genbankfile class method)": [[0, "pydna.genbankfile.GenbankFile.from_SeqRecord", false]], "from_seqrecord() (pydna.genbankrecord.genbankrecord class method)": [[0, "pydna.genbankrecord.GenbankRecord.from_SeqRecord", false]], "from_string() (pydna.contig.contig class method)": [[0, "pydna.contig.Contig.from_string", false]], "from_string() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_string", false]], "from_string() (pydna.dseqrecord.dseqrecord class method)": [[0, "pydna.dseqrecord.Dseqrecord.from_string", false]], "from_string() (pydna.genbankrecord.genbankrecord class method)": [[0, "pydna.genbankrecord.GenbankRecord.from_string", false]], "gbtext_clean() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.gbtext_clean", false]], "gc() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.gc", false]], "gc() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.gc", false]], "gel() (in module pydna.gel)": [[0, "pydna.gel.gel", false]], "genbank (class in pydna.genbank)": [[0, "pydna.genbank.Genbank", false]], "genbank() (in module pydna.genbank)": [[0, "pydna.genbank.genbank", false]], "genbankfile (class in pydna.genbankfile)": [[0, "pydna.genbankfile.GenbankFile", false]], "genbankrecord (class in pydna.genbankrecord)": [[0, "pydna.genbankrecord.GenbankRecord", false]], "get_cut_parameters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cut_parameters", false]], "get_cutsite_pairs() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cutsite_pairs", false]], "get_cutsites() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cutsites", false]], "get_env() (in module pydna)": [[0, "pydna.get_env", false]], "identifier_from_string() (in module pydna.utils)": [[0, "pydna.utils.identifier_from_string", false]], "interpolator() (in module pydna.gel)": [[0, "pydna.gel.interpolator", false]], "isblunt() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.isblunt", false]], "isorf() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.isorf", false]], "isorf() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.isorf", false]], "lcs() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.lcs", false]], "left_end_position() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.left_end_position", false]], "limit (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.limit", false]], "linearize() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.linearize", false]], "list_features() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.list_features", false]], "location_boundaries() (in module pydna.utils)": [[0, "pydna.utils.location_boundaries", false]], "locations_overlap() (in module pydna.utils)": [[0, "pydna.utils.locations_overlap", false]], "locstr() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.locstr", false]], "locus (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.locus", false]], "logo() (in module pydna)": [[0, "pydna.logo", false]], "looped() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.looped", false]], "looped() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.looped", false]], "lower() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.lower", false]], "lower() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.lower", false]], "m() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.m", false]], "map_trace_files() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.map_trace_files", false]], "memorize() (in module pydna.utils)": [[0, "pydna.utils.memorize", false]], "module": [[0, "module-pydna", false], [0, "module-pydna.amplicon", false], [0, "module-pydna.amplify", false], [0, "module-pydna.assembly", false], [0, "module-pydna.common_sub_strings", false], [0, "module-pydna.contig", false], [0, "module-pydna.design", false], [0, "module-pydna.download", false], [0, "module-pydna.dseq", false], [0, "module-pydna.dseqrecord", false], [0, "module-pydna.editor", false], [0, "module-pydna.gel", false], [0, "module-pydna.genbank", false], [0, "module-pydna.genbankfile", false], [0, "module-pydna.genbankfixer", false], [0, "module-pydna.genbankrecord", false], [0, "module-pydna.myprimers", false], [0, "module-pydna.parsers", false], [0, "module-pydna.primer", false], [0, "module-pydna.readers", false], [0, "module-pydna.seqrecord", false], [0, "module-pydna.tm", false], [0, "module-pydna.utils", false]], "mung() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.mung", false]], "mw() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.mw", false]], "n_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.n_cutters", false]], "n_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.n_cutters", false]], "no_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.no_cutters", false]], "no_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.no_cutters", false]], "nucleotide() (pydna.genbank.genbank method)": [[0, "pydna.genbank.Genbank.nucleotide", false]], "number_of_cuts() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.number_of_cuts", false]], "once_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.once_cutters", false]], "once_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.once_cutters", false]], "open() (pydna.editor.editor method)": [[0, "pydna.editor.Editor.open", false]], "open_cache_folder() (in module pydna)": [[0, "pydna.open_cache_folder", false]], "open_config_folder() (in module pydna)": [[0, "pydna.open_config_folder", false]], "open_current_folder() (in module pydna)": [[0, "pydna.open_current_folder", false]], "open_folder() (in module pydna.utils)": [[0, "pydna.utils.open_folder", false]], "open_folder() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.open_folder", false]], "open_log_folder() (in module pydna)": [[0, "pydna.open_log_folder", false]], "orfs() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.orfs", false]], "orfs_to_features() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.orfs_to_features", false]], "originstr() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.originstr", false]], "parse() (in module pydna.parsers)": [[0, "pydna.parsers.parse", false]], "parse_primers() (in module pydna.parsers)": [[0, "pydna.parsers.parse_primers", false]], "parsegbloc() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.parseGBLoc", false]], "pcr() (in module pydna.amplify)": [[0, "pydna.amplify.pcr", false]], "pfu_sso7d_program() (in module pydna.tm)": [[0, "pydna.tm.pfu_sso7d_program", false]], "primer (class in pydna.primer)": [[0, "pydna.primer.Primer", false]], "primer_design() (in module pydna.design)": [[0, "pydna.design.primer_design", false]], "primerlist (class in pydna.myprimers)": [[0, "pydna.myprimers.PrimerList", false]], "primers() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.primers", false]], "products (pydna.amplify.anneal property)": [[0, "pydna.amplify.Anneal.products", false]], "program() (in module pydna.tm)": [[0, "pydna.tm.program", false]], "program() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.program", false]], "proteinseqrecord (class in pydna.seqrecord)": [[0, "pydna.seqrecord.ProteinSeqRecord", false]], "pydna": [[0, "module-pydna", false]], "pydna.amplicon": [[0, "module-pydna.amplicon", false]], "pydna.amplify": [[0, "module-pydna.amplify", false]], "pydna.assembly": [[0, "module-pydna.assembly", false]], "pydna.common_sub_strings": [[0, "module-pydna.common_sub_strings", false]], "pydna.contig": [[0, "module-pydna.contig", false]], "pydna.design": [[0, "module-pydna.design", false]], "pydna.download": [[0, "module-pydna.download", false]], "pydna.dseq": [[0, "module-pydna.dseq", false]], "pydna.dseqrecord": [[0, "module-pydna.dseqrecord", false]], "pydna.editor": [[0, "module-pydna.editor", false]], "pydna.gel": [[0, "module-pydna.gel", false]], "pydna.genbank": [[0, "module-pydna.genbank", false]], "pydna.genbankfile": [[0, "module-pydna.genbankfile", false]], "pydna.genbankfixer": [[0, "module-pydna.genbankfixer", false]], "pydna.genbankrecord": [[0, "module-pydna.genbankrecord", false]], "pydna.myprimers": [[0, "module-pydna.myprimers", false]], "pydna.parsers": [[0, "module-pydna.parsers", false]], "pydna.primer": [[0, "module-pydna.primer", false]], "pydna.readers": [[0, "module-pydna.readers", false]], "pydna.seqrecord": [[0, "module-pydna.seqrecord", false]], "pydna.tm": [[0, "module-pydna.tm", false]], "pydna.utils": [[0, "module-pydna.utils", false]], "pydna_code() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.pydna_code", false]], "pydna_code_from_list() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.pydna_code_from_list", false]], "q5() (in module pydna.tm)": [[0, "pydna.tm.Q5", false]], "quick() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.quick", false]], "randomdna() (in module pydna.utils)": [[0, "pydna.utils.randomDNA", false]], "randomorf() (in module pydna.utils)": [[0, "pydna.utils.randomORF", false]], "randomprot() (in module pydna.utils)": [[0, "pydna.utils.randomprot", false]], "randomrna() (in module pydna.utils)": [[0, "pydna.utils.randomRNA", false]], "rarecodons() (in module pydna.utils)": [[0, "pydna.utils.rarecodons", false]], "rarecodons() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.rarecodons", false]], "rarecodons() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.rarecodons", false]], "rc() (in module pydna.utils)": [[0, "pydna.utils.rc", false]], "rc() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.rc", false]], "rc() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.rc", false]], "rc() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.rc", false]], "rc() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.rc", false]], "rc() (pydna.genbankfile.genbankfile method)": [[0, "pydna.genbankfile.GenbankFile.rc", false]], "rc() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.rc", false]], "rc() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.rc", false]], "rc() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.rc", false]], "read() (in module pydna.readers)": [[0, "pydna.readers.read", false]], "read_primer() (in module pydna.readers)": [[0, "pydna.readers.read_primer", false]], "report() (pydna.amplify.anneal method)": [[0, "pydna.amplify.Anneal.report", false]], "reverse_complement() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.reverse_complement", false]], "reverse_complement() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.reverse_complement", false]], "reverse_complement() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.reverse_complement", false]], "reverse_complement() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.reverse_complement", false]], "reverse_complement() (pydna.genbankfile.genbankfile method)": [[0, "pydna.genbankfile.GenbankFile.reverse_complement", false]], "reverse_complement() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.reverse_complement", false]], "reverse_complement() (pydna.primer.primer method)": [[0, "pydna.primer.Primer.reverse_complement", false]], "reverse_complement() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.reverse_complement", false]], "reverse_complement() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.reverse_complement", false]], "reverse_primers (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.reverse_primers", false]], "right_end_position() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.right_end_position", false]], "seguid() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.seguid", false]], "seguid() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.seguid", false]], "seguid() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.seguid", false]], "seq31() (in module pydna.utils)": [[0, "pydna.utils.seq31", false]], "seqrecord (class in pydna.seqrecord)": [[0, "pydna.seqrecord.SeqRecord", false]], "set_forward_primer_footprint() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.set_forward_primer_footprint", false]], "set_reverse_primer_footprint() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.set_reverse_primer_footprint", false]], "shift_feature() (in module pydna.utils)": [[0, "pydna.utils.shift_feature", false]], "shift_location() (in module pydna.utils)": [[0, "pydna.utils.shift_location", false]], "shifted() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.shifted", false]], "shifted() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.shifted", false]], "smallest_rotation() (in module pydna.utils)": [[0, "pydna.utils.smallest_rotation", false]], "sorted_features() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.sorted_features", false]], "stamp() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.stamp", false]], "startcodon() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.startcodon", false]], "startcodon() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.startcodon", false]], "stopcodon() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.stopcodon", false]], "stopcodon() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.stopcodon", false]], "strip_indent() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.strip_indent", false]], "strip_multiline() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.strip_multiline", false]], "synced() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.synced", false]], "t4() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.T4", false], [0, "pydna.dseq.Dseq.t4", false]], "ta_dbd() (in module pydna.tm)": [[0, "pydna.tm.ta_dbd", false]], "ta_default() (in module pydna.tm)": [[0, "pydna.tm.ta_default", false]], "tail (pydna.primer.primer property)": [[0, "pydna.primer.Primer.tail", false]], "taq_program() (in module pydna.tm)": [[0, "pydna.tm.taq_program", false]], "template (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.template", false]], "terminal_overlap() (in module pydna.common_sub_strings)": [[0, "pydna.common_sub_strings.terminal_overlap", false]], "terminal_transferase() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.terminal_transferase", false]], "terminal_transferase() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.terminal_transferase", false]], "three_frame_orfs() (in module pydna.utils)": [[0, "pydna.utils.three_frame_orfs", false]], "three_prime_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.three_prime_end", false]], "tm_dbd() (in module pydna.tm)": [[0, "pydna.tm.tm_dbd", false]], "tm_default() (in module pydna.tm)": [[0, "pydna.tm.tm_default", false]], "tm_neb() (in module pydna.tm)": [[0, "pydna.tm.tm_neb", false]], "tm_product() (in module pydna.tm)": [[0, "pydna.tm.tm_product", false]], "tmbresluc() (in module pydna.tm)": [[0, "pydna.tm.tmbresluc", false]], "togb() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toGB", false]], "toint() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toInt", false]], "tojson() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toJSON", false]], "tolinear() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.tolinear", false]], "tolinear() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.tolinear", false]], "transcribe() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.transcribe", false]], "translate() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.translate", false]], "translate() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.translate", false]], "trunc (pydna.dseq.dseq attribute)": [[0, "pydna.dseq.Dseq.trunc", false]], "twice_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.twice_cutters", false]], "twice_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.twice_cutters", false]], "undefined_sequence() (in module pydna.myprimers)": [[0, "pydna.myprimers.undefined_sequence", false]], "unique_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.unique_cutters", false]], "unique_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.unique_cutters", false]], "upper() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.upper", false]], "upper() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.upper", false]], "watson_ovhg() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.watson_ovhg", false]], "wrapstring() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.wrapstring", false]], "write() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.write", false]]}, "objects": {"": [[0, 0, 0, "-", "pydna"]], "pydna": [[0, 0, 0, "-", "amplicon"], [0, 0, 0, "-", "amplify"], [0, 0, 0, "-", "assembly"], [0, 0, 0, "-", "common_sub_strings"], [0, 0, 0, "-", "contig"], [0, 0, 0, "-", "design"], [0, 0, 0, "-", "download"], [0, 0, 0, "-", "dseq"], [0, 0, 0, "-", "dseqrecord"], [0, 0, 0, "-", "editor"], [0, 0, 0, "-", "gel"], [0, 0, 0, "-", "genbank"], [0, 0, 0, "-", "genbankfile"], [0, 0, 0, "-", "genbankfixer"], [0, 0, 0, "-", "genbankrecord"], [0, 5, 1, "", "get_env"], [0, 5, 1, "", "logo"], [0, 0, 0, "-", "myprimers"], [0, 5, 1, "", "open_cache_folder"], [0, 5, 1, "", "open_config_folder"], [0, 5, 1, "", "open_current_folder"], [0, 5, 1, "", "open_log_folder"], [0, 0, 0, "-", "parsers"], [0, 0, 0, "-", "primer"], [0, 0, 0, "-", "readers"], [0, 0, 0, "-", "seqrecord"], [0, 0, 0, "-", "tm"], [0, 0, 0, "-", "utils"]], "pydna.amplicon": [[0, 1, 1, "", "Amplicon"]], "pydna.amplicon.Amplicon": [[0, 2, 1, "", "dbd_program"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "primers"], [0, 2, 1, "", "program"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "set_forward_primer_footprint"], [0, 2, 1, "", "set_reverse_primer_footprint"]], "pydna.amplify": [[0, 1, 1, "", "Anneal"], [0, 5, 1, "", "pcr"]], "pydna.amplify.Anneal": [[0, 3, 1, "", "forward_primers"], [0, 3, 1, "", "limit"], [0, 4, 1, "", "products"], [0, 2, 1, "", "report"], [0, 3, 1, "", "reverse_primers"], [0, 3, 1, "", "template"]], "pydna.assembly": [[0, 1, 1, "", "Assembly"]], "pydna.assembly.Assembly": [[0, 2, 1, "", "assemble_circular"], [0, 2, 1, "", "assemble_linear"]], "pydna.common_sub_strings": [[0, 5, 1, "", "common_sub_strings"], [0, 5, 1, "", "terminal_overlap"]], "pydna.contig": [[0, 1, 1, "", "Contig"]], "pydna.contig.Contig": [[0, 2, 1, "", "detailed_figure"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.design": [[0, 5, 1, "", "assembly_fragments"], [0, 5, 1, "", "circular_assembly_fragments"], [0, 5, 1, "", "primer_design"]], "pydna.dseq": [[0, 1, 1, "", "Dseq"]], "pydna.dseq.Dseq": [[0, 2, 1, "", "T4"], [0, 2, 1, "", "apply_cut"], [0, 2, 1, "", "cas9"], [0, 2, 1, "", "cut"], [0, 2, 1, "", "cutsite_is_valid"], [0, 2, 1, "", "cutters"], [0, 2, 1, "", "exo1_end"], [0, 2, 1, "", "exo1_front"], [0, 2, 1, "", "fill_in"], [0, 2, 1, "", "find"], [0, 2, 1, "", "five_prime_end"], [0, 2, 1, "", "from_full_sequence_and_overhangs"], [0, 2, 1, "", "from_representation"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "get_cut_parameters"], [0, 2, 1, "", "get_cutsite_pairs"], [0, 2, 1, "", "get_cutsites"], [0, 2, 1, "", "isblunt"], [0, 2, 1, "", "left_end_position"], [0, 2, 1, "", "looped"], [0, 2, 1, "", "lower"], [0, 2, 1, "", "mung"], [0, 2, 1, "", "mw"], [0, 2, 1, "", "n_cutters"], [0, 2, 1, "", "no_cutters"], [0, 2, 1, "", "once_cutters"], [0, 2, 1, "", "quick"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "right_end_position"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "shifted"], [0, 2, 1, "", "t4"], [0, 2, 1, "", "terminal_transferase"], [0, 2, 1, "", "three_prime_end"], [0, 2, 1, "", "tolinear"], [0, 2, 1, "", "transcribe"], [0, 2, 1, "", "translate"], [0, 3, 1, "", "trunc"], [0, 2, 1, "", "twice_cutters"], [0, 2, 1, "", "unique_cutters"], [0, 2, 1, "", "upper"], [0, 2, 1, "", "watson_ovhg"]], "pydna.dseqrecord": [[0, 1, 1, "", "Dseqrecord"]], "pydna.dseqrecord.Dseqrecord": [[0, 2, 1, "", "add_feature"], [0, 2, 1, "", "apply_cut"], [0, 2, 1, "", "cas9"], [0, 4, 1, "", "circular"], [0, 2, 1, "", "copy_fasta_to_clipboard"], [0, 2, 1, "", "copy_gb_to_clipboard"], [0, 2, 1, "", "cut"], [0, 2, 1, "", "cutters"], [0, 2, 1, "", "extract_feature"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "find"], [0, 2, 1, "", "find_aa"], [0, 2, 1, "", "find_aminoacids"], [0, 2, 1, "", "format"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "linearize"], [0, 2, 1, "", "looped"], [0, 2, 1, "", "lower"], [0, 2, 1, "", "m"], [0, 2, 1, "", "map_trace_files"], [0, 2, 1, "", "n_cutters"], [0, 2, 1, "", "no_cutters"], [0, 2, 1, "", "number_of_cuts"], [0, 2, 1, "", "once_cutters"], [0, 2, 1, "", "orfs"], [0, 2, 1, "", "orfs_to_features"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "shifted"], [0, 2, 1, "", "synced"], [0, 2, 1, "", "terminal_transferase"], [0, 2, 1, "", "tolinear"], [0, 2, 1, "", "twice_cutters"], [0, 2, 1, "", "unique_cutters"], [0, 2, 1, "", "upper"], [0, 2, 1, "", "write"]], "pydna.editor": [[0, 1, 1, "", "Editor"], [0, 5, 1, "", "ape"]], "pydna.editor.Editor": [[0, 2, 1, "", "open"]], "pydna.gel": [[0, 5, 1, "", "gel"], [0, 5, 1, "", "interpolator"]], "pydna.genbank": [[0, 1, 1, "", "Genbank"], [0, 5, 1, "", "genbank"]], "pydna.genbank.Genbank": [[0, 2, 1, "", "nucleotide"]], "pydna.genbankfile": [[0, 1, 1, "", "GenbankFile"]], "pydna.genbankfile.GenbankFile": [[0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.genbankfixer": [[0, 5, 1, "", "concat_dict"], [0, 5, 1, "", "gbtext_clean"], [0, 5, 1, "", "locstr"], [0, 5, 1, "", "originstr"], [0, 5, 1, "", "parseGBLoc"], [0, 5, 1, "", "strip_indent"], [0, 5, 1, "", "strip_multiline"], [0, 5, 1, "", "toGB"], [0, 5, 1, "", "toInt"], [0, 5, 1, "", "toJSON"], [0, 5, 1, "", "wrapstring"]], "pydna.genbankrecord": [[0, 1, 1, "", "GenbankRecord"]], "pydna.genbankrecord.GenbankRecord": [[0, 2, 1, "", "biopython_code"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "pydna_code"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.myprimers": [[0, 1, 1, "", "PrimerList"], [0, 5, 1, "", "check_primer_numbers"], [0, 5, 1, "", "find_duplicate_primers"], [0, 5, 1, "", "undefined_sequence"]], "pydna.myprimers.PrimerList": [[0, 4, 1, "", "accessed"], [0, 2, 1, "", "assign_numbers"], [0, 2, 1, "", "code"], [0, 2, 1, "", "open_folder"], [0, 2, 1, "", "pydna_code_from_list"]], "pydna.parsers": [[0, 5, 1, "", "embl_gb_fasta"], [0, 5, 1, "", "extract_from_text"], [0, 5, 1, "", "parse"], [0, 5, 1, "", "parse_primers"]], "pydna.primer": [[0, 1, 1, "", "Primer"]], "pydna.primer.Primer": [[0, 4, 1, "", "footprint"], [0, 2, 1, "", "reverse_complement"], [0, 4, 1, "", "tail"]], "pydna.readers": [[0, 5, 1, "", "read"], [0, 5, 1, "", "read_primer"]], "pydna.seqrecord": [[0, 1, 1, "", "ProteinSeqRecord"], [0, 1, 1, "", "SeqRecord"]], "pydna.seqrecord.ProteinSeqRecord": [[0, 2, 1, "", "cai"], [0, 2, 1, "", "express"], [0, 2, 1, "", "gc"], [0, 2, 1, "", "isorf"], [0, 2, 1, "", "rarecodons"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "startcodon"], [0, 2, 1, "", "stopcodon"]], "pydna.seqrecord.SeqRecord": [[0, 4, 1, "", "accession"], [0, 2, 1, "", "add_colors_to_features_for_ape"], [0, 2, 1, "", "add_feature"], [0, 2, 1, "", "cai"], [0, 2, 1, "", "comment"], [0, 2, 1, "", "copy"], [0, 2, 1, "", "datefunction"], [0, 4, 1, "", "definition"], [0, 2, 1, "", "dump"], [0, 2, 1, "", "express"], [0, 2, 1, "", "extract_feature"], [0, 2, 1, "", "from_Bio_SeqRecord"], [0, 2, 1, "", "gc"], [0, 2, 1, "", "isorf"], [0, 2, 1, "", "lcs"], [0, 2, 1, "", "list_features"], [0, 4, 1, "", "locus"], [0, 2, 1, "", "rarecodons"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "sorted_features"], [0, 2, 1, "", "stamp"], [0, 2, 1, "", "startcodon"], [0, 2, 1, "", "stopcodon"], [0, 2, 1, "", "translate"]], "pydna.tm": [[0, 5, 1, "", "Q5"], [0, 5, 1, "", "dbd_program"], [0, 5, 1, "", "pfu_sso7d_program"], [0, 5, 1, "", "program"], [0, 5, 1, "", "ta_dbd"], [0, 5, 1, "", "ta_default"], [0, 5, 1, "", "taq_program"], [0, 5, 1, "", "tm_dbd"], [0, 5, 1, "", "tm_default"], [0, 5, 1, "", "tm_neb"], [0, 5, 1, "", "tm_product"], [0, 5, 1, "", "tmbresluc"]], "pydna.utils": [[0, 5, 1, "", "cai"], [0, 5, 1, "", "complement"], [0, 5, 1, "", "cuts_overlap"], [0, 5, 1, "", "eq"], [0, 5, 1, "", "express"], [0, 5, 1, "", "flatten"], [0, 5, 1, "", "identifier_from_string"], [0, 5, 1, "", "location_boundaries"], [0, 5, 1, "", "locations_overlap"], [0, 5, 1, "", "memorize"], [0, 5, 1, "", "open_folder"], [0, 5, 1, "", "randomDNA"], [0, 5, 1, "", "randomORF"], [0, 5, 1, "", "randomRNA"], [0, 5, 1, "", "randomprot"], [0, 5, 1, "", "rarecodons"], [0, 5, 1, "", "rc"], [0, 5, 1, "", "seq31"], [0, 5, 1, "", "shift_feature"], [0, 5, 1, "", "shift_location"], [0, 5, 1, "", "smallest_rotation"], [0, 5, 1, "", "three_frame_orfs"]]}, "objnames": {"0": ["py", "module", "Python module"], "1": ["py", "class", "Python class"], "2": ["py", "method", "Python method"], "3": ["py", "attribute", "Python attribute"], "4": ["py", "property", "Python property"], "5": ["py", "function", "Python function"]}, "objtypes": {"0": "py:module", "1": "py:class", "2": "py:method", "3": "py:attribute", "4": "py:property", "5": "py:function"}, "terms": {"0": 0, "01": 0, "02": 0, "050": 0, "0_first_prim": 0, "0m": 0, "1": 0, "10": 0, "100": 0, "100bp": 0, "101": 0, "101bp": 0, "102": 0, "102bp": 0, "1051bp": 0, "11": 0, "11m": 0, "12": 0, "13": 0, "1388": 0, "14": 0, "14bp": 0, "15": 0, "15058bp": 0, "166": 0, "169": 0, "17": 0, "18": 0, "19": 0, "1950267": 0, "1983": 0, "1990": 0, "1_second_prim": 0, "1c": 0, "1st": 0, "2": 0, "2007": 0, "2007025016": 0, "2011": 0, "2013": 0, "2023": 0, "2243783": 0, "23": 0, "231": 0, "2389": 0, "24": 0, "25": 0, "250": 0, "2577": 0, "27": 0, "289": 0, "2_third_prim": 0, "3": 0, "30": 0, "300": 0, "304": 0, "308": 0, "313": 0, "32": 0, "32630": 0, "329": 0, "33bp": 0, "34bp": 0, "35": 0, "357": 0, "35bp": 0, "36": 0, "363": 0, "381": 0, "3atgtgagtggcagatagtaatag": 0, "3c": 0, "3gcaagctttgaatgctac5": 0, "3gcaagctttgaatgctaccctagg5": 0, "3gctgacatagtagactatcgtg5": 0, "3min": 0, "3tactgacgattgggaag": 0, "4": 0, "40": 0, "41": 0, "42": 0, "45": 0, "48": 0, "5": 0, "50": 0, "500": 0, "51": 0, "52": 0, "53": 0, "54": 0, "55": 0, "557": 0, "5681": 0, "57": 0, "59": 0, "5atgactgctaacccttc": 0, "5atgactgctaacccttc3": 0, "5e": 0, "5ggatccatgactgctaacccttc3": 0, "5min": 0, "5tacactcaccgtctatcattatc": 0, "5tacactcaccgtctatcattatc3": 0, "6": 0, "60": 0, "600": 0, "61": 0, "64": 0, "7": 0, "72": 0, "72c": 0, "75": 0, "79": 0, "8": 0, "82": 0, "84": 0, "85t6tfcvwav0wnxeib": 0, "9": 0, "95": 0, "98": 0, "A": 0, "AND": 0, "As": 0, "At": 0, "By": 0, "For": 0, "If": 0, "In": 0, "It": 0, "NOT": 0, "No": 0, "One": 0, "The": 0, "Then": 0, "There": 0, "These": 0, "To": 0, "_": 0, "____": 0, "_____": 0, "______": 0, "________": 0, "_________": 0, "__________": 0, "____________": 0, "___________________": 0, "______________________": 0, "__init__": 0, "_abstractcut": 0, "_klenow_frag": 0, "_mt": 0, "_mwstd": 0, "_new": 0, "_pretty_str": 0, "_restrictionbatch": 0, "_seqabstractbaseclass": 0, "_sy": 0, "_tm_default": 0, "_weight": 0, "a1": 0, "aa": 0, "aaa": 0, "aaaa": 0, "aaaaaa": 0, "aaac": 0, "aaacccc": 0, "aaagcccta": 0, "aaagcctag": 0, "aaagttct": 0, "aaat": 0, "aaatatagcgtactgagaagaaa": 0, "aaatg": 0, "aag": 0, "aagaattcaa": 0, "aagaattcaagaattc": 0, "aagaattcaagaattcaa": 0, "aat": 0, "aata": 0, "aattcaa": 0, "aattcaag": 0, "aattcc": 0, "about": 0, "abov": 0, "absolut": 0, "accept": 0, "access": 0, "accompani": 0, "accord": 0, "acg": 0, "acgatgctatactg": 0, "acgatgctatactgccccctgtgctgtgctcta": 0, "acgatgctatactgccccctgtgctgtgctctattttttattctggctgtatcgggggt": 0, "acid": 0, "acitivti": 0, "actgt": 0, "activ": 0, "actta": 0, "ad": 0, "adapt": 0, "add": 0, "add_colors_to_features_for_ap": 0, "add_featur": 0, "addition": 0, "address": 0, "adjac": 0, "advanc": 0, "after": 0, "agaaa": 0, "agaattcaa": 0, "agaros": 0, "agcct": 0, "agcctatcatcttggtctctgca": 0, "agcctatcatcttggtctctgcatttatat": 0, "agcctatcatcttggtctctgcatttatatcgcatgactcttcttt": 0, "agctag": 0, "agctatgtatcttgcatcgta": 0, "aggcct": 0, "agt": 0, "ala": 0, "algorithm": 0, "alia": 0, "all": 0, "allow": 0, "almost": 0, "alon": 0, "alphabet": 0, "alreadi": 0, "also": 0, "altern": 0, "alwai": 0, "ambigu": 0, "amino": 0, "amount": 0, "ampl": 0, "amplicon1": 0, "amplicon1amplicon2amplicon3": 0, "amplicon1amplicon2amplicon3amplicon4": 0, "amplicon1dseqrecd1amplicon2dseqrecd2": 0, "amplicon2": 0, "amplicon3": 0, "amplicon4": 0, "amplif": 0, "amplify_ann": 0, "an": 0, "anaconda3": 0, "analysi": 0, "analyz": 0, "ani": 0, "anneal": 0, "annot": 0, "anoth": 0, "anselm": 0, "antisens": 0, "ap": 0, "apeextractor": 0, "apeinfo": 0, "api": 0, "app": 0, "appear": 0, "apply_cut": 0, "appmain": 0, "aptam": 0, "ar": 0, "arg": 0, "argument": 0, "around": 0, "art": 0, "artifici": 0, "ascii": 0, "assembl": 0, "assemble_circular": 0, "assemble_linear": 0, "assembly_assembli": 0, "assembly_frag": 0, "assemblyobj": 0, "assign": 0, "assign_numb": 0, "assign_numbers_to_new_prim": 0, "associ": 0, "assum": 0, "asterisk": 0, "asx": 0, "ataa": 0, "atc": 0, "atcg": 0, "atcgactgacgtgtt": 0, "atcgtgt": 0, "atcgtgtactgtcatattc": 0, "atg": 0, "atga": 0, "atgaaa": 0, "atgaccc": 0, "atgactgctaaccct": 0, "atgactgctaacccttc": 0, "atgactgctaacccttccttggtgttg": 0, "atgactgctaacccttccttggtgttgaacaagatcgacgacatttcgttcgaaacttacgatg": 0, "atggccattgtaatgggccgctgaaagggtgcccgatag": 0, "atgtaa": 0, "atgtacgatcgtatgctggttatattttag": 0, "atgttcctac": 0, "attca": 0, "attempt": 0, "attribut": 0, "atttaa": 0, "auggccauuguaaugggccgcugaaagggugcccgauag": 0, "author": 0, "automat": 0, "automaticli": 0, "avail": 0, "b": 0, "back": 0, "backward": 0, "bamhi": 0, "base": 0, "base64": 0, "basic": 0, "batch": 0, "bean": 0, "becaus": 0, "becom": 0, "been": 0, "befor": 0, "begin": 0, "behav": 0, "below": 0, "best": 0, "beta": 0, "between": 0, "bind": 0, "bio": 0, "biojson": 0, "biolog": 0, "biologi": 0, "biologylab": 0, "biopython": 0, "biopython_cod": 0, "biopythonparserwarn": 0, "bjorn": 0, "bjorn36": 0, "bjornjobb": 0, "bj\u00f6rn": 0, "bkgnebmkia5kng": 0, "blunt": 0, "bool": 0, "both": 0, "bp": 0, "bring": 0, "brixtel": 0, "broken": 0, "bug": 0, "built": 0, "byte": 0, "bytearrai": 0, "c": 0, "c_seq": 0, "ca": 0, "caaa": 0, "caaag": 0, "cach": 0, "cached_func": 0, "cai": 0, "calcul": 0, "call": 0, "callabl": 0, "can": 0, "cannot": 0, "capabl": 0, "capac": 0, "capit": 0, "care": 0, "carefulli": 0, "cas9": 0, "case": 0, "catattc": 0, "catattcaaagttct": 0, "catcga": 0, "catcgat": 0, "catcgatc": 0, "catcgtaagtttcga": 0, "catcgtaagtttcgaacg": 0, "catgatctacgt": 0, "catgatctacgtatcgtgt": 0, "cation": 0, "ccaaacccaccaggtaccttatgtaagtacttcaagtcgccagaagacttcttggtcaagttgcc": 0, "ccc": 0, "ccccaaa": 0, "ccccc": 0, "ccccttt": 0, "ccgga": 0, "cctag": 0, "cctagg": 0, "cctaggnnncttaag": 0, "ccttaa": 0, "cd": 0, "cdseguid": 0, "cgactgtatcatctgatagcac": 0, "cgactgtatcatctgatagcac3": 0, "cgi": 0, "cgtatgctg": 0, "cgttcgaaacttacgatg3": 0, "chang": 0, "charact": 0, "check": 0, "check_primer_numb": 0, "checksum": 0, "chew": 0, "christophchamp": 0, "circular": 0, "circular_assembly_frag": 0, "class": 0, "classmethod": 0, "clean": 0, "clone": 0, "closest": 0, "coding_dna": 0, "coerc": 0, "collect": 0, "color": 0, "com": 0, "combin": 0, "combo": 0, "comma": 0, "command": 0, "comment": 0, "common": 0, "compact": 0, "compar": 0, "comparison": 0, "compat": 0, "complement": 0, "complet": 0, "compoundloc": 0, "comput": 0, "conc": 0, "concat_dict": 0, "concaten": 0, "concentr": 0, "concept": 0, "configpars": 0, "configur": 0, "connect": 0, "consid": 0, "considi": 0, "construct": 0, "contact": 0, "contain": 0, "control": 0, "conveni": 0, "convens": 0, "convent": 0, "copi": 0, "copy_fasta_to_clipboard": 0, "copy_gb_to_clipboard": 0, "copyright": 0, "correct": 0, "correctli": 0, "cottenoir": 0, "could": 0, "cover": 0, "creat": 0, "creation": 0, "crick": 0, "crick_ovhg": 0, "cs570233": 0, "cseguid": 0, "cta": 0, "ctag": 0, "ctagctac": 0, "ctagctag": 0, "ctagg": 0, "ctaggatcgtagatctagctg": 0, "ctaggg": 0, "ctctgcatttatat": 0, "ctctgcatttatatcgcatgactcttcttt": 0, "ctg": 0, "ctgggta": 0, "ctrl": 0, "ctta": 0, "cttt": 0, "cttta": 0, "current": 0, "cursor": 0, "custom": 0, "cut": 0, "cut_crick": 0, "cut_watson": 0, "cuts_overlap": 0, "cutsit": 0, "cutsite_is_valid": 0, "cutter": 0, "d": 0, "data": 0, "data_dir": 0, "date": 0, "datefunct": 0, "david": 0, "db_xref": 0, "dbd_program": 0, "dbxref": 0, "de_tabl": 0, "deal": 0, "debug": 0, "decemb": 0, "deduc": 0, "default": 0, "defin": 0, "definit": 0, "depict": 0, "deprec": 0, "describ": 0, "descript": 0, "detail": 0, "detailed_figur": 0, "detect": 0, "determin": 0, "develop": 0, "dict": 0, "differ": 0, "difficult": 0, "digest": 0, "dir": 0, "direct": 0, "directli": 0, "directori": 0, "dist": 0, "dlist": 0, "dna": 0, "dna_nn3": 0, "dna_nn4": 0, "dnac1": 0, "dnac2": 0, "dntp": 0, "do": 0, "doc": 0, "docstr": 0, "doctr": 0, "doe": 0, "domain": 0, "done": 0, "doubl": 0, "down": 0, "download_text": 0, "dropbox": 0, "dsdna": 0, "dseqr": 0, "dseqrecd1": 0, "dseqrecd1amplicon1amplicon2": 0, "dseqrecd1amplicon1dseqrecd2amplicon2": 0, "dseqrecd2": 0, "dseqrecord_frag": 0, "dseqrecord_sync": 0, "dseqtyp": 0, "dump": 0, "duplic": 0, "dure": 0, "duval": 0, "dvberkel": 0, "e": 0, "each": 0, "earlier": 0, "easier": 0, "easiest": 0, "ecori": 0, "edg": 0, "edit": 0, "edu": 0, "effect": 0, "either": 0, "element": 0, "els": 0, "email": 0, "embl": 0, "embl_gb_fasta": 0, "empti": 0, "en": 0, "encod": 0, "end": 0, "engin": 0, "enough": 0, "ensur": 0, "enter": 0, "entir": 0, "entri": 0, "env": 0, "environ": 0, "environment": 0, "enz": 0, "enzym": 0, "enzymestyp": 0, "eppstein": 0, "eq": 0, "equal": 0, "equival": 0, "especi": 0, "estim": 0, "estimate_funct": 0, "even": 0, "everi": 0, "exactposit": 0, "excactli": 0, "excel": 0, "except": 0, "exist": 0, "exo": 0, "exo1_end": 0, "exo1_front": 0, "exonucleas": 0, "expect": 0, "explan": 0, "explicitli": 0, "explor": 0, "express": 0, "extern": 0, "extra": 0, "extract": 0, "extract_featur": 0, "extract_from_text": 0, "f": 0, "f64": 0, "fa": 0, "fa1": 0, "fa2": 0, "facilit": 0, "factor": 0, "fall": 0, "fals": 0, "fasta": 0, "faster": 0, "fb": 0, "fc": 0, "featur": 0, "feb": 0, "field": 0, "figur": 0, "file": 0, "filenam": 0, "fill": 0, "fill_in": 0, "final": 0, "find": 0, "find_aa": 0, "find_aminoacid": 0, "find_duplicate_prim": 0, "first": 0, "fit": 0, "five": 0, "five_prime_end": 0, "fix": 0, "flank": 0, "flatten": 0, "flexibl": 0, "float": 0, "folder": 0, "follow": 0, "footprint": 0, "fore": 0, "form": 0, "format": 0, "formula": 0, "forward": 0, "forward_prim": 0, "found": 0, "four": 0, "fp": 0, "fr": 0, "frag": 0, "frag1": 0, "frag14": 0, "frag2": 0, "frag20": 0, "frag23": 0, "fragment": 0, "frame": 0, "fring": 0, "from": 0, "from_bio_seqrecord": 0, "from_full_sequence_and_overhang": 0, "from_represent": 0, "from_seqrecord": 0, "from_str": 0, "ft": 0, "ft2": 0, "full": 0, "full_sequ": 0, "func": 0, "function": 0, "funtion": 0, "further": 0, "fuse": 0, "fusion": 0, "fwd": 0, "g": 0, "gaaat": 0, "gaat": 0, "gaattc": 0, "gac": 0, "gacccat": 0, "gacgt": 0, "gagacgtaaatata": 0, "gagacgtaaatatagcgtactgagaagaaa": 0, "gap": 0, "gat": 0, "gatc": 0, "gatcc": 0, "gatccnnngaattc": 0, "gatccttt": 0, "gatcg": 0, "gatcga": 0, "gatcgat": 0, "gatcgatc": 0, "gatcgatg": 0, "gattaca": 0, "gb": 0, "gbkstring": 0, "gbtext": 0, "gbtext_clean": 0, "gbw0jp907tg_yx3jngs4qqwttj": 0, "gbw0jp907tg_yx3jngs4qqwttju": 0, "gc": 0, "gcaagctttgaatgctac5": 0, "gcatacgac": 0, "gcatcgtagtctatttgcttac": 0, "gcta": 0, "gctag": 0, "gctgacatagtagactatcgtg5": 0, "gel_length": 0, "genbank_nucleotid": 0, "gener": 0, "get_cut_paramet": 0, "get_cutsit": 0, "get_cutsite_pair": 0, "get_env": 0, "getcwd": 0, "gf7iorxmniu": 0, "ggaatt": 0, "ggatc": 0, "ggatcc": 0, "ggatcca": 0, "ggatccatgactgct": 0, "ggatccatgactgctaacccttccttggtgttgaacaagatcgacgacatttcgttcgaaacttacgatgggatcc": 0, "ggatcccatcgtaag": 0, "ggatccnnngaattc": 0, "ggcct": 0, "gggaaat": 0, "ggggtttcccc": 0, "gibson": 0, "gip0": 0, "gist": 0, "github": 0, "given": 0, "gmail": 0, "gnnncttaag": 0, "googl": 0, "gov": 0, "govern": 0, "gram": 0, "graph": 0, "greater": 0, "greedi": 0, "greedili": 0, "greyc": 0, "group": 0, "gt": 0, "gtagcta": 0, "gtagctag": 0, "gtt": 0, "gttcttaa": 0, "gttt": 0, "gtttc": 0, "guess": 0, "ha": 0, "half": 0, "handl": 0, "happen": 0, "have": 0, "helix": 0, "high": 0, "highlight": 0, "hold": 0, "home": 0, "homolog": 0, "homologi": 0, "http": 0, "i": 0, "id": 0, "ident": 0, "identifi": 0, "identifier_from_str": 0, "ignor": 0, "imm_tabl": 0, "immedi": 0, "immut": 0, "implement": 0, "import": 0, "includ": 0, "incorpor": 0, "index": 0, "indexerror": 0, "inform": 0, "ing": 0, "inhibit": 0, "inhibitor": 0, "ini": 0, "initi": 0, "initlist": 0, "inplac": 0, "input": 0, "insensit": 0, "insert": 0, "inspect": 0, "instanc": 0, "instanti": 0, "instead": 0, "instread": 0, "int": 0, "integ": 0, "intermedi": 0, "interpol": 0, "interpret": 0, "introspect": 0, "invers": 0, "involv": 0, "ipython": 0, "is_left": 0, "isblunt": 0, "isorf": 0, "issu": 0, "item": 0, "iter": 0, "its": 0, "itself": 0, "iupac": 0, "j": 0, "j2": 0, "jean": 0, "johansson": 0, "join": 0, "jorgensen": 0, "journal": 0, "jseq": 0, "json": 0, "jun": 0, "junction": 0, "just": 0, "k": 0, "kb": 0, "keep": 0, "kei": 0, "kept": 0, "keyword": 0, "klenow": 0, "klenow_frag": 0, "kwarg": 0, "l": 0, "l_": 0, "label": 0, "lactamas": 0, "larger": 0, "last": 0, "lc": 0, "ldseguid": 0, "least": 0, "left": 0, "left_cut": 0, "left_end_posit": 0, "len": 0, "lenght": 0, "length": 0, "length1": 0, "length2": 0, "less": 0, "letter": 0, "levskaya": 0, "lib": 0, "licenc": 0, "licens": 0, "lift": 0, "like": 0, "lim": 0, "limit": 0, "line": 0, "linear": 0, "link": 0, "linux": 0, "list": 0, "list_featur": 0, "lkutrl4": 0, "lkynqhtivh": 0, "loc": 0, "loc1": 0, "loc2": 0, "local": 0, "locat": 0, "location_boundari": 0, "locations_overlap": 0, "locstr": 0, "locu": 0, "log": 0, "log_dir": 0, "loglevel": 0, "logo": 0, "logotyp": 0, "long": 0, "longer": 0, "longest": 0, "look": 0, "loop": 0, "lost": 0, "lower": 0, "lowercas": 0, "lp002422": 0, "lseguid": 0, "lsseguid": 0, "lst": 0, "lyndon": 0, "m": 0, "made": 0, "mai": 0, "main": 0, "maivmgrt": 0, "maivmgru": 0, "maivmgrwkgar": 0, "make": 0, "malform": 0, "manag": 0, "mani": 0, "manual": 0, "map": 0, "map_trace_fil": 0, "mar": 0, "margin": 0, "mass": 0, "match": 0, "max": 0, "max_nod": 0, "maximum": 0, "maxlength": 0, "maxlink": 0, "maxsiz": 0, "mean": 0, "meant": 0, "melt": 0, "memor": 0, "mention": 0, "mer": 0, "merg": 0, "meta": 0, "metalailevalmetglyargtrplysglyalaargt": 0, "metallo": 0, "method": 0, "methyl": 0, "mg": 0, "might": 0, "minimum": 0, "minsiz": 0, "misc": 0, "miscellan": 0, "mit": 0, "mix": 0, "mixtur": 0, "mm": 0, "mmm": 0, "mode": 0, "modif": 0, "modifi": 0, "mol": 0, "mol_typ": 0, "molecul": 0, "molecular": 0, "molecule_typ": 0, "monoval": 0, "most": 0, "mostli": 0, "move": 0, "mung": 0, "mung_bean_nucleas": 0, "must": 0, "mutableseq": 0, "mw": 0, "mwstd": 0, "my_protein": 0, "my_seq": 0, "mydrmlvif": 0, "myemail": 0, "n": 0, "n_cutter": 0, "na": 0, "name": 0, "ncbi": 0, "neb": 0, "nebswebsit": 0, "necessari": 0, "need": 0, "neg": 0, "networkx": 0, "new": 0, "new_dna": 0, "newcom": 0, "next": 0, "nicer": 0, "nih": 0, "nlm": 0, "nm": 0, "nn_tabl": 0, "nnn": 0, "nnnn": 0, "nnnnn": 0, "no_cutt": 0, "node": 0, "nodemap": 0, "non": 0, "none": 0, "normal": 0, "note": 0, "noth": 0, "notion": 0, "now": 0, "nucleas": 0, "nucleotid": 0, "nuclotid": 0, "number": 0, "number_of_cut": 0, "numer": 0, "o": 0, "o3": 0, "o4": 0, "o59": 0, "o6": 0, "o7": 0, "o8": 0, "obj": 0, "object": 0, "obtain": 0, "occur": 0, "occurr": 0, "off": 0, "old": 0, "oligonuceotid": 0, "onc": 0, "once_cutt": 0, "one": 0, "onli": 0, "onlin": 0, "open": 0, "open_cache_fold": 0, "open_config_fold": 0, "open_current_fold": 0, "open_fold": 0, "open_log_fold": 0, "optim": 0, "option": 0, "order": 0, "orf": 0, "orfs_to_featur": 0, "org": 0, "organ": 0, "orient": 0, "origin": 0, "original_loc": 0, "originstr": 0, "other": 0, "otherwis": 0, "out": 0, "output": 0, "outsid": 0, "over": 0, "overhang": 0, "overlap": 0, "ovhg": 0, "own": 0, "p": 0, "p1": 0, "p2": 0, "p3": 0, "pad": 0, "padfirst": 0, "page": 0, "pair": 0, "param": 0, "parament": 0, "paramet": 0, "pars": 0, "parse_prim": 0, "parsegbloc": 0, "part": 0, "part_nam": 0, "pass": 0, "past": 0, "pat": 0, "patent": 0, "path": 0, "pathlib": 0, "pcr": 0, "pcr_prod": 0, "perform": 0, "permanantli": 0, "permut": 0, "pf": 0, "pfu": 0, "pfu_sso7d_program": 0, "php": 0, "phusion": 0, "pierr": 0, "pl": 0, "place": 0, "plain": 0, "plasmid": 0, "plausibl": 0, "pleas": 0, "plu": 0, "po": 0, "point": 0, "polymeras": 0, "pop": 0, "posit": 0, "possibl": 0, "power": 0, "pr": 0, "practic": 0, "preceed": 0, "prefer": 0, "presenc": 0, "present": 0, "press": 0, "pretty_str": 0, "previou": 0, "prime": 0, "primer1": 0, "primer_design": 0, "primerc": 0, "primerdict": 0, "primerlist": 0, "prinmer": 0, "print": 0, "probabl": 0, "process": 0, "prodcod": 0, "produc": 0, "product": 0, "productcod": 0, "program": 0, "properti": 0, "protein": 0, "proteinseqrecord": 0, "protocol": 0, "protrud": 0, "provid": 0, "pth": 0, "pubm": 0, "purpos": 0, "put": 0, "py": 0, "pydna_": 0, "pydna_cached_func": 0, "pydna_cod": 0, "pydna_code_from_list": 0, "pydna_config_dir": 0, "pydna_data_dir": 0, "pydna_email": 0, "pydna_prim": 0, "pydnaseqrecord": 0, "pyl": 0, "pypars": 0, "python": 0, "python2": 0, "python3": 0, "python_packag": 0, "q5": 0, "qht": 0, "qualifi": 0, "quick": 0, "quicker": 0, "quit": 0, "r": 0, "r64": 0, "rais": 0, "randomdna": 0, "randomorf": 0, "randomprot": 0, "randomrna": 0, "rarecodon": 0, "ration": 0, "rbrixtel_at_gmail_dot_com": 0, "rc": 0, "reaction": 0, "read": 0, "read_prim": 0, "readabl": 0, "reason": 0, "rec": 0, "recent": 0, "recognit": 0, "recombin": 0, "record": 0, "ref": 0, "refer": 0, "reflect": 0, "region": 0, "relat": 0, "reli": 0, "rememb": 0, "remov": 0, "render": 0, "repeat": 0, "replac": 0, "report": 0, "repositori": 0, "repr": 0, "repres": 0, "represent": 0, "requir": 0, "resect": 0, "reserv": 0, "respect": 0, "restrict": 0, "restrictionbatch": 0, "restrictionenzym": 0, "result": 0, "return": 0, "retwingl": 0, "rev": 0, "revers": 0, "reverse_compl": 0, "reverse_prim": 0, "rhoad": 0, "right": 0, "right_cut": 0, "right_end_posit": 0, "rml": 0, "rna": 0, "romain": 0, "rotat": 0, "roundtrip": 0, "rowend": 0, "rowstart": 0, "rp": 0, "rstr": 0, "rule": 0, "rychlik": 0, "s2": 0, "s3": 0, "safe": 0, "salt": 0, "saltc": 0, "saltcorr": 0, "same": 0, "sampl": 0, "scanner": 0, "sce": 0, "search": 0, "second": 0, "section": 0, "see": 0, "seguid": 0, "sel": 0, "selenocystein": 0, "self": 0, "selfcomp": 0, "sens": 0, "sensit": 0, "separ": 0, "seq": 0, "seq3": 0, "seq31": 0, "seq_len": 0, "seq_to_open": 0, "seqenc": 0, "seqfeatur": 0, "seqio": 0, "sequec": 0, "sequenc": 0, "sequtil": 0, "set": 0, "set_forward_primer_footprint": 0, "set_reverse_primer_footprint": 0, "sever": 0, "shape": 0, "share": 0, "shaw": 0, "shell": 0, "shell_command_for_editor": 0, "shift": 0, "shift_featur": 0, "shift_loc": 0, "short": 0, "shortest": 0, "should": 0, "show": 0, "side": 0, "sign": 0, "similar": 0, "simpl": 0, "simpleloc": 0, "simpler": 0, "simplifi": 0, "simul": 0, "sinc": 0, "singl": 0, "site": 0, "size": 0, "slc": 0, "slice": 0, "slightli": 0, "slow": 0, "smallest": 0, "smallest_rot": 0, "snippet": 0, "so": 0, "softwar": 0, "some": 0, "someon": 0, "sort": 0, "sorted_featur": 0, "spacer": 0, "specif": 0, "specifi": 0, "spencer": 0, "split": 0, "spyder": 0, "sr": 0, "sso7d": 0, "sta": 0, "stagger": 0, "stamp": 0, "standard": 0, "start": 0, "startcodon": 0, "startposit": 0, "startx1": 0, "startx2": 0, "starty1": 0, "starty2": 0, "stdin": 0, "stdout": 0, "sticki": 0, "sticky3": 0, "sticky5": 0, "stop": 0, "stop_symbol": 0, "stopcodon": 0, "store": 0, "str": 0, "str_": 0, "strand": 0, "stretch": 0, "strict": 0, "string": 0, "stringi": 0, "stringx": 0, "strip_ind": 0, "strip_multilin": 0, "strorbyt": 0, "structur": 0, "stuff": 0, "sub": 0, "subclass": 0, "subfrag": 0, "sublcass": 0, "subsequ": 0, "substitut": 0, "substr": 0, "suggest": 0, "suppli": 0, "support": 0, "surviv": 0, "switch": 0, "symbol": 0, "syn": 0, "sync": 0, "synhtes": 0, "synthet": 0, "system": 0, "t": 0, "t4": 0, "ta": 0, "ta_dbd": 0, "ta_default": 0, "taa": 0, "taaa": 0, "tab": 0, "tac": 0, "tacactcaccgtctatcattatc": 0, "tacactcaccgtctatcattatctactatcgactgtatcatctgatagcac": 0, "tact": 0, "tactggg": 0, "tag": 0, "tagctag": 0, "tagctgactgcacaa": 0, "tail": 0, "take": 0, "taq": 0, "taq_program": 0, "target": 0, "target_tm": 0, "tattctggctgtatc": 0, "tattctggctgtatcgggggtacgatgctatactg": 0, "taxon": 0, "taxonomi": 0, "tccgga": 0, "tcctag": 0, "tcgcatgactcttcttt": 0, "tcggatagtagaacca": 0, "tcggatagtagaaccagagacgt": 0, "tcggatagtagaaccagagacgtaaatata": 0, "tcggatagtagaaccagagacgtaaatatagcgtactgagaagaaa": 0, "tcl": 0, "tclsh": 0, "tclsh8": 0, "tcttggtctctgcatttatat": 0, "tech": 0, "techniqu": 0, "technologi": 0, "tell": 0, "temp": 0, "temperatur": 0, "templat": 0, "temprari": 0, "ter": 0, "term": 0, "termin": 0, "terminal_overlap": 0, "terminal_transferas": 0, "test": 0, "tewydy0ugvgxh3vjnvwgtxoydqa": 0, "texa": 0, "text": 0, "tga": 0, "tgagtagtcgtagtcgtcgtat": 0, "tgatcgtcatgctgactatactat": 0, "tggatcc": 0, "tgtactggtgctgaaccttgtatcaagttgggtgttgacgccattgccccaggtggtcgtttcgtt": 0, "tgtgctgtgctcta": 0, "tgtgctgtgctctattttttattctggctgtatc": 0, "than": 0, "the_exo": 0, "thei": 0, "them": 0, "thermodynam": 0, "thi": 0, "thing": 0, "those": 0, "three": 0, "three_frame_orf": 0, "three_prime_end": 0, "threonin": 0, "through": 0, "throw": 0, "thrown": 0, "time": 0, "titl": 0, "tm_dbd": 0, "tm_default": 0, "tm_func": 0, "tm_neb": 0, "tm_nn": 0, "tm_product": 0, "tmapi": 0, "tmbresluc": 0, "tmf": 0, "tmm_tabl": 0, "tmpdir": 0, "tmr": 0, "to_stop": 0, "togb": 0, "togeth": 0, "toint": 0, "tojson": 0, "tolinear": 0, "tool": 0, "top": 0, "topologi": 0, "tp2jzecm2e3w4yxtrrx09cmka_8": 0, "trace": 0, "traceback": 0, "track": 0, "transcrib": 0, "translat": 0, "treatment": 0, "tri": 0, "trick": 0, "true": 0, "trunc": 0, "try": 0, "tt": 0, "ttaagg": 0, "ttat": 0, "ttc": 0, "ttcaagaa": 0, "ttcttaa": 0, "ttcttaagtt": 0, "ttg": 0, "ttt": 0, "ttta": 0, "tttac": 0, "tttat": 0, "tttatatcgcatgactcttcttt": 0, "tttc": 0, "tttcccc": 0, "tttg": 0, "tttt": 0, "tttttt": 0, "tupl": 0, "turn": 0, "tweak": 0, "twice": 0, "twice_cutt": 0, "two": 0, "txt": 0, "type": 0, "type3": 0, "type5": 0, "type_": 0, "typeerror": 0, "typic": 0, "u": 0, "unassign": 0, "undefined_sequ": 0, "underli": 0, "union": 0, "unique_cutt": 0, "univers": 0, "unk": 0, "unknown": 0, "up": 0, "upper": 0, "uppercas": 0, "url": 0, "urlsaf": 0, "usag": 0, "user": 0, "userlist": 0, "users_email": 0, "usr": 0, "usual": 0, "utah": 0, "v": 0, "val": 0, "valid": 0, "valu": 0, "valueerror": 0, "variabl": 0, "variou": 0, "vector": 0, "veri": 0, "version": 0, "vf": 0, "view": 0, "visual": 0, "vitro": 0, "vivo": 0, "w": 0, "wa": 0, "wai": 0, "watson": 0, "watson_ovhg": 0, "wayn": 0, "we": 0, "weight": 0, "well": 0, "when": 0, "where": 0, "which": 0, "while": 0, "who": 0, "whole": 0, "whose": 0, "wiki": 0, "wikidata": 0, "wikipedia": 0, "window": 0, "without": 0, "wo": 0, "wo2007025016": 0, "word": 0, "work": 0, "would": 0, "wprintgc": 0, "wrap": 0, "wrapstr": 0, "write": 0, "written": 0, "www": 0, "x": 0, "x1b": 0, "xaa": 0, "xle": 0, "xxx": 0, "y": 0, "yet": 0, "you": 0, "z": 0}, "titles": ["Welcome to pydna\u2019s documentation!"], "titleterms": {"": 0, "amplicon": 0, "amplifi": 0, "assembli": 0, "code": 0, "common_sub_str": 0, "content": 0, "contig": 0, "design": 0, "document": 0, "download": 0, "dseq": 0, "dseqrecord": 0, "editor": 0, "exampl": 0, "gel": 0, "genbank": 0, "genbankfil": 0, "genbankfix": 0, "genbankrecord": 0, "get": 0, "help": 0, "how": 0, "indic": 0, "layout": 0, "modul": 0, "more": 0, "myprim": 0, "packag": 0, "parser": 0, "primer": 0, "pydna": 0, "reader": 0, "seqrecord": 0, "sourc": 0, "tabl": 0, "tm": 0, "us": 0, "util": 0, "welcom": 0}})
\ No newline at end of file