Input files - Positions issues

[cdiaz45]

Hello,
Thanks for making such a great documentation. I have a question regarding some strange results I have been getting depending on the input files. I have changed my original error message and put real guides and examples to make it easier to replicate.

Say you have a guide for Myod: “TTTGTGGTTAAGGAAAGCGG”. If I run it on the terminal with one mismatch, one dna bulge and one rna bulge, I get the following wrong position (off by one 0-based) for no mismatches: X TTTGTGGTTAAGGAAAGCGGNRG TTTGTGGTTAAGGAAAGCGGCGG chr11 17719597 - 0 0

If I run the same guide in the cas-offinder website with the same parameters (1 mismatch, one bulge in dna and rna), I get the correct position: X TTTGTGGTTAAGGAAAGCGGNRG TTTGTGGTTAAGGAAAGCGGCGG chr11 17719596 - 0 0

Now, if you run the guide in the terminal with just one mismatch (no bulges), you get the correct position again as in the website, so it seems that adding bulges to the parameters triggers something that makes the position to be off. I tried to replicate, and strangely it does not happen with all guides. So I tested a few and from those, the one I mention in this example gave those weird results.
The guides I tested are:
TCCTTAACCACAAATCAGGC
TTTGTGGTTAAGGAAAGCGG (only one where I detected this problem)
CAAATCAGGCCGGACAGGAG
AACCACAAATCAGGCCGGAC
GCTTTCCTTAACCACAAATC

Thank you so much, Carmen

[pjb7687]

@cdiaz45 Hi, yes we know that issue and that's why we are pending the official release of Cas-OFFiner 3.0. At the moment we do not have enough capacity to fix the issue yet, so I cannot guarantee when we can finally release 3.0 though.