diff --git a/README.md b/README.md index f47b2eaf..e116f93e 100644 --- a/README.md +++ b/README.md @@ -21,7 +21,7 @@ Exercism Workspace | August | Apps | Dart (5/5), Java (0/5), Kotlin (0/5) | | September | Slimline | Awk (5/5), Bash\* (5/5), jq (0/5), Perl (0/5) | | October | Object-Oriented | Ruby (5/5), Java (0/5) | -| November | Nibbly | WebAssembly (2/5), x86-64 Assembly (0/5) | +| November | Nibbly | WebAssembly (3/5), x86-64 Assembly (0/5) | | December | Diversions | | \* not completed in 2023 diff --git a/wasm/README.md b/wasm/README.md index 2ce7ca19..5622b801 100644 --- a/wasm/README.md +++ b/wasm/README.md @@ -18,3 +18,4 @@ - [reverse-string](./reverse-string/README.md) - [grains](./grains/README.md) - [resistor-color](./resistor-color/README.md) +- [nucleotide-count](./nucleotide-count/README.md) diff --git a/wasm/nucleotide-count/.prettierignore b/wasm/nucleotide-count/.prettierignore new file mode 120000 index 00000000..d00c28f0 --- /dev/null +++ b/wasm/nucleotide-count/.prettierignore @@ -0,0 +1 @@ +../.prettierignore \ No newline at end of file diff --git a/wasm/nucleotide-count/README.md b/wasm/nucleotide-count/README.md index f9e0133c..11456421 100644 --- a/wasm/nucleotide-count/README.md +++ b/wasm/nucleotide-count/README.md @@ -41,4 +41,9 @@ The result should be returned as a 4-way tuple: `(i32 i32 i32 i32)`. Each number ### Based on -The Calculating DNA Nucleotides_problem at Rosalind - http://rosalind.info/problems/dna/ \ No newline at end of file +The Calculating DNA Nucleotides_problem at Rosalind - http://rosalind.info/problems/dna/ + +### My Solution + +- [my solution]() +- [run-tests](./run-tests-wasm.txt) diff --git a/wasm/nucleotide-count/babel.config.js b/wasm/nucleotide-count/babel.config.js index 9c17ba51..868a4948 100644 --- a/wasm/nucleotide-count/babel.config.js +++ b/wasm/nucleotide-count/babel.config.js @@ -1,4 +1,4 @@ export default { - presets: ["@exercism/babel-preset-javascript"], - plugins: [], -}; + presets: ["@exercism/babel-preset-javascript"], + plugins: [], +}; \ No newline at end of file diff --git a/wasm/nucleotide-count/coverage/clover.xml b/wasm/nucleotide-count/coverage/clover.xml new file mode 100644 index 00000000..bf151a9c --- /dev/null +++ b/wasm/nucleotide-count/coverage/clover.xml @@ -0,0 +1,6 @@ + + + + + + diff --git a/wasm/nucleotide-count/coverage/coverage-final.json b/wasm/nucleotide-count/coverage/coverage-final.json new file mode 100644 index 00000000..0967ef42 --- /dev/null +++ b/wasm/nucleotide-count/coverage/coverage-final.json @@ -0,0 +1 @@ +{} diff --git a/wasm/nucleotide-count/coverage/lcov-report/base.css b/wasm/nucleotide-count/coverage/lcov-report/base.css new file mode 100644 index 00000000..f418035b --- /dev/null +++ b/wasm/nucleotide-count/coverage/lcov-report/base.css @@ -0,0 +1,224 @@ +body, html { + margin:0; padding: 0; + height: 100%; +} +body { + font-family: Helvetica Neue, Helvetica, Arial; + font-size: 14px; + color:#333; +} +.small { font-size: 12px; } +*, *:after, *:before { + -webkit-box-sizing:border-box; + -moz-box-sizing:border-box; + box-sizing:border-box; + } +h1 { font-size: 20px; margin: 0;} +h2 { font-size: 14px; } +pre { + font: 12px/1.4 Consolas, "Liberation Mono", Menlo, Courier, monospace; + margin: 0; + padding: 0; + -moz-tab-size: 2; + -o-tab-size: 2; + tab-size: 2; +} +a { color:#0074D9; text-decoration:none; } +a:hover { text-decoration:underline; } +.strong { font-weight: bold; } +.space-top1 { padding: 10px 0 0 0; } +.pad2y { padding: 20px 0; } +.pad1y { padding: 10px 0; } +.pad2x { padding: 0 20px; } +.pad2 { padding: 20px; } +.pad1 { padding: 10px; } +.space-left2 { padding-left:55px; } +.space-right2 { padding-right:20px; } +.center { text-align:center; } +.clearfix { display:block; } +.clearfix:after { + content:''; + display:block; + height:0; + clear:both; + visibility:hidden; + } +.fl { float: left; } +@media only screen and (max-width:640px) { + .col3 { width:100%; max-width:100%; } + .hide-mobile { display:none!important; } +} + +.quiet { + color: #7f7f7f; + color: rgba(0,0,0,0.5); +} +.quiet a { opacity: 0.7; } + +.fraction { + font-family: Consolas, 'Liberation Mono', Menlo, Courier, monospace; + font-size: 10px; + color: #555; + background: #E8E8E8; + padding: 4px 5px; + border-radius: 3px; + vertical-align: middle; +} + +div.path a:link, div.path a:visited { color: #333; } +table.coverage { + border-collapse: collapse; + margin: 10px 0 0 0; + padding: 0; +} + +table.coverage td { + margin: 0; + padding: 0; + vertical-align: top; +} +table.coverage td.line-count { + text-align: right; + padding: 0 5px 0 20px; +} +table.coverage td.line-coverage { + text-align: right; + padding-right: 10px; + min-width:20px; +} + +table.coverage td span.cline-any { + display: inline-block; + padding: 0 5px; + width: 100%; +} +.missing-if-branch { + display: inline-block; + margin-right: 5px; + border-radius: 3px; + position: relative; + padding: 0 4px; + background: #333; + color: yellow; +} + +.skip-if-branch { + display: none; + margin-right: 10px; + position: relative; + padding: 0 4px; + background: #ccc; + color: white; +} +.missing-if-branch .typ, .skip-if-branch .typ { + color: inherit !important; +} +.coverage-summary { + border-collapse: collapse; + width: 100%; +} +.coverage-summary tr { border-bottom: 1px solid #bbb; } +.keyline-all { border: 1px solid #ddd; } +.coverage-summary td, .coverage-summary th { padding: 10px; } +.coverage-summary tbody { border: 1px solid #bbb; } +.coverage-summary td { border-right: 1px solid #bbb; } +.coverage-summary td:last-child { border-right: none; } +.coverage-summary th { + text-align: left; + font-weight: normal; + white-space: nowrap; +} +.coverage-summary th.file { border-right: none !important; } +.coverage-summary th.pct { } +.coverage-summary th.pic, +.coverage-summary th.abs, +.coverage-summary td.pct, +.coverage-summary td.abs { text-align: right; } +.coverage-summary td.file { white-space: nowrap; } +.coverage-summary td.pic { min-width: 120px !important; } +.coverage-summary tfoot td { } + +.coverage-summary .sorter { + height: 10px; + width: 7px; + display: inline-block; + margin-left: 0.5em; + background: url(sort-arrow-sprite.png) no-repeat scroll 0 0 transparent; +} +.coverage-summary .sorted .sorter { + background-position: 0 -20px; +} +.coverage-summary .sorted-desc .sorter { + background-position: 0 -10px; +} +.status-line { height: 10px; } +/* yellow */ +.cbranch-no { background: yellow !important; color: #111; } +/* dark red */ +.red.solid, .status-line.low, .low .cover-fill { background:#C21F39 } +.low .chart { border:1px solid #C21F39 } +.highlighted, +.highlighted .cstat-no, .highlighted .fstat-no, .highlighted .cbranch-no{ + background: #C21F39 !important; +} +/* medium red */ +.cstat-no, .fstat-no, .cbranch-no, .cbranch-no { background:#F6C6CE } +/* light red */ +.low, .cline-no { background:#FCE1E5 } +/* light green */ +.high, .cline-yes { background:rgb(230,245,208) } +/* medium green */ +.cstat-yes { background:rgb(161,215,106) } +/* dark green */ +.status-line.high, .high .cover-fill { background:rgb(77,146,33) } +.high .chart { border:1px solid rgb(77,146,33) } +/* dark yellow (gold) */ +.status-line.medium, .medium .cover-fill { background: #f9cd0b; } +.medium .chart { border:1px solid #f9cd0b; } +/* light yellow */ +.medium { background: #fff4c2; } + +.cstat-skip { background: #ddd; color: #111; } +.fstat-skip { background: #ddd; color: #111 !important; } +.cbranch-skip { background: #ddd !important; color: #111; } + +span.cline-neutral { background: #eaeaea; } + +.coverage-summary td.empty { + opacity: .5; + padding-top: 4px; + padding-bottom: 4px; + line-height: 1; + color: #888; +} + +.cover-fill, .cover-empty { + display:inline-block; + height: 12px; +} +.chart { + line-height: 0; +} +.cover-empty { + background: white; +} +.cover-full { + border-right: none !important; +} +pre.prettyprint { + border: none !important; + padding: 0 !important; + margin: 0 !important; +} +.com { color: #999 !important; } +.ignore-none { color: #999; font-weight: normal; } + +.wrapper { + min-height: 100%; + height: auto !important; + height: 100%; + margin: 0 auto -48px; +} +.footer, .push { + height: 48px; +} diff --git a/wasm/nucleotide-count/coverage/lcov-report/block-navigation.js b/wasm/nucleotide-count/coverage/lcov-report/block-navigation.js new file mode 100644 index 00000000..cc121302 --- /dev/null +++ b/wasm/nucleotide-count/coverage/lcov-report/block-navigation.js @@ -0,0 +1,87 @@ +/* eslint-disable */ +var jumpToCode = (function init() { + // Classes of code we would like to highlight in the file view + var missingCoverageClasses = ['.cbranch-no', '.cstat-no', '.fstat-no']; + + // Elements to highlight in the file listing view + var fileListingElements = ['td.pct.low']; + + // We don't want to select elements that are direct descendants of another match + var notSelector = ':not(' + missingCoverageClasses.join('):not(') + ') > '; // becomes `:not(a):not(b) > ` + + // Selecter that finds elements on the page to which we can jump + var selector = + fileListingElements.join(', ') + + ', ' + + notSelector + + missingCoverageClasses.join(', ' + notSelector); // becomes `:not(a):not(b) > a, :not(a):not(b) > b` + + // The NodeList of matching elements + var missingCoverageElements = document.querySelectorAll(selector); + + var currentIndex; + + function toggleClass(index) { + missingCoverageElements + .item(currentIndex) + .classList.remove('highlighted'); + missingCoverageElements.item(index).classList.add('highlighted'); + } + + function makeCurrent(index) { + toggleClass(index); + currentIndex = index; + missingCoverageElements.item(index).scrollIntoView({ + behavior: 'smooth', + block: 'center', + inline: 'center' + }); + } + + function goToPrevious() { + var nextIndex = 0; + if (typeof currentIndex !== 'number' || currentIndex === 0) { + nextIndex = missingCoverageElements.length - 1; + } else if (missingCoverageElements.length > 1) { + nextIndex = currentIndex - 1; + } + + makeCurrent(nextIndex); + } + + function goToNext() { + var nextIndex = 0; + + if ( + typeof currentIndex === 'number' && + currentIndex < missingCoverageElements.length - 1 + ) { + nextIndex = currentIndex + 1; + } + + makeCurrent(nextIndex); + } + + return function jump(event) { + if ( + document.getElementById('fileSearch') === document.activeElement && + document.activeElement != null + ) { + // if we're currently focused on the search input, we don't want to navigate + return; + } + + switch (event.which) { + case 78: // n + case 74: // j + goToNext(); + break; + case 66: // b + case 75: // k + case 80: // p + goToPrevious(); + break; + } + }; +})(); +window.addEventListener('keydown', jumpToCode); diff --git a/wasm/nucleotide-count/coverage/lcov-report/favicon.png b/wasm/nucleotide-count/coverage/lcov-report/favicon.png new file mode 100644 index 00000000..c1525b81 Binary files /dev/null and b/wasm/nucleotide-count/coverage/lcov-report/favicon.png differ diff --git a/wasm/nucleotide-count/coverage/lcov-report/index.html b/wasm/nucleotide-count/coverage/lcov-report/index.html new file mode 100644 index 00000000..b430d74a --- /dev/null +++ b/wasm/nucleotide-count/coverage/lcov-report/index.html @@ -0,0 +1,101 @@ + + + + + + Code coverage report for All files + + + + + + + + + +
+
+

All files

+
+ +
+ Unknown% + Statements + 0/0 +
+ + +
+ Unknown% + Branches + 0/0 +
+ + +
+ Unknown% + Functions + 0/0 +
+ + +
+ Unknown% + Lines + 0/0 +
+ + +
+

+ Press n or j to go to the next uncovered block, b, p or k for the previous block. +

+ +
+
+
+ + + + + + + + + + + + + + + + +
FileStatementsBranchesFunctionsLines
+
+
+
+
+ Code coverage generated by + istanbul + at 2023-11-11T23:16:29.277Z +
+ + + + + + + \ No newline at end of file diff --git a/wasm/nucleotide-count/coverage/lcov-report/prettify.css b/wasm/nucleotide-count/coverage/lcov-report/prettify.css new file mode 100644 index 00000000..b317a7cd --- /dev/null +++ b/wasm/nucleotide-count/coverage/lcov-report/prettify.css @@ -0,0 +1 @@ +.pln{color:#000}@media screen{.str{color:#080}.kwd{color:#008}.com{color:#800}.typ{color:#606}.lit{color:#066}.pun,.opn,.clo{color:#660}.tag{color:#008}.atn{color:#606}.atv{color:#080}.dec,.var{color:#606}.fun{color:red}}@media print,projection{.str{color:#060}.kwd{color:#006;font-weight:bold}.com{color:#600;font-style:italic}.typ{color:#404;font-weight:bold}.lit{color:#044}.pun,.opn,.clo{color:#440}.tag{color:#006;font-weight:bold}.atn{color:#404}.atv{color:#060}}pre.prettyprint{padding:2px;border:1px solid #888}ol.linenums{margin-top:0;margin-bottom:0}li.L0,li.L1,li.L2,li.L3,li.L5,li.L6,li.L7,li.L8{list-style-type:none}li.L1,li.L3,li.L5,li.L7,li.L9{background:#eee} diff --git a/wasm/nucleotide-count/coverage/lcov-report/prettify.js b/wasm/nucleotide-count/coverage/lcov-report/prettify.js new file mode 100644 index 00000000..b3225238 --- /dev/null +++ b/wasm/nucleotide-count/coverage/lcov-report/prettify.js @@ -0,0 +1,2 @@ +/* eslint-disable */ +window.PR_SHOULD_USE_CONTINUATION=true;(function(){var h=["break,continue,do,else,for,if,return,while"];var u=[h,"auto,case,char,const,default,double,enum,extern,float,goto,int,long,register,short,signed,sizeof,static,struct,switch,typedef,union,unsigned,void,volatile"];var p=[u,"catch,class,delete,false,import,new,operator,private,protected,public,this,throw,true,try,typeof"];var l=[p,"alignof,align_union,asm,axiom,bool,concept,concept_map,const_cast,constexpr,decltype,dynamic_cast,explicit,export,friend,inline,late_check,mutable,namespace,nullptr,reinterpret_cast,static_assert,static_cast,template,typeid,typename,using,virtual,where"];var x=[p,"abstract,boolean,byte,extends,final,finally,implements,import,instanceof,null,native,package,strictfp,super,synchronized,throws,transient"];var R=[x,"as,base,by,checked,decimal,delegate,descending,dynamic,event,fixed,foreach,from,group,implicit,in,interface,internal,into,is,lock,object,out,override,orderby,params,partial,readonly,ref,sbyte,sealed,stackalloc,string,select,uint,ulong,unchecked,unsafe,ushort,var"];var r="all,and,by,catch,class,else,extends,false,finally,for,if,in,is,isnt,loop,new,no,not,null,of,off,on,or,return,super,then,true,try,unless,until,when,while,yes";var w=[p,"debugger,eval,export,function,get,null,set,undefined,var,with,Infinity,NaN"];var s="caller,delete,die,do,dump,elsif,eval,exit,foreach,for,goto,if,import,last,local,my,next,no,our,print,package,redo,require,sub,undef,unless,until,use,wantarray,while,BEGIN,END";var I=[h,"and,as,assert,class,def,del,elif,except,exec,finally,from,global,import,in,is,lambda,nonlocal,not,or,pass,print,raise,try,with,yield,False,True,None"];var f=[h,"alias,and,begin,case,class,def,defined,elsif,end,ensure,false,in,module,next,nil,not,or,redo,rescue,retry,self,super,then,true,undef,unless,until,when,yield,BEGIN,END"];var H=[h,"case,done,elif,esac,eval,fi,function,in,local,set,then,until"];var A=[l,R,w,s+I,f,H];var e=/^(DIR|FILE|vector|(de|priority_)?queue|list|stack|(const_)?iterator|(multi)?(set|map)|bitset|u?(int|float)\d*)/;var C="str";var z="kwd";var j="com";var O="typ";var G="lit";var L="pun";var F="pln";var m="tag";var E="dec";var J="src";var P="atn";var n="atv";var N="nocode";var M="(?:^^\\.?|[+-]|\\!|\\!=|\\!==|\\#|\\%|\\%=|&|&&|&&=|&=|\\(|\\*|\\*=|\\+=|\\,|\\-=|\\->|\\/|\\/=|:|::|\\;|<|<<|<<=|<=|=|==|===|>|>=|>>|>>=|>>>|>>>=|\\?|\\@|\\[|\\^|\\^=|\\^\\^|\\^\\^=|\\{|\\||\\|=|\\|\\||\\|\\|=|\\~|break|case|continue|delete|do|else|finally|instanceof|return|throw|try|typeof)\\s*";function k(Z){var ad=0;var S=false;var ac=false;for(var V=0,U=Z.length;V122)){if(!(al<65||ag>90)){af.push([Math.max(65,ag)|32,Math.min(al,90)|32])}if(!(al<97||ag>122)){af.push([Math.max(97,ag)&~32,Math.min(al,122)&~32])}}}}af.sort(function(av,au){return(av[0]-au[0])||(au[1]-av[1])});var ai=[];var ap=[NaN,NaN];for(var ar=0;arat[0]){if(at[1]+1>at[0]){an.push("-")}an.push(T(at[1]))}}an.push("]");return an.join("")}function W(al){var aj=al.source.match(new RegExp("(?:\\[(?:[^\\x5C\\x5D]|\\\\[\\s\\S])*\\]|\\\\u[A-Fa-f0-9]{4}|\\\\x[A-Fa-f0-9]{2}|\\\\[0-9]+|\\\\[^ux0-9]|\\(\\?[:!=]|[\\(\\)\\^]|[^\\x5B\\x5C\\(\\)\\^]+)","g"));var ah=aj.length;var an=[];for(var ak=0,am=0;ak=2&&ai==="["){aj[ak]=X(ag)}else{if(ai!=="\\"){aj[ak]=ag.replace(/[a-zA-Z]/g,function(ao){var ap=ao.charCodeAt(0);return"["+String.fromCharCode(ap&~32,ap|32)+"]"})}}}}return aj.join("")}var aa=[];for(var V=0,U=Z.length;V=0;){S[ac.charAt(ae)]=Y}}var af=Y[1];var aa=""+af;if(!ag.hasOwnProperty(aa)){ah.push(af);ag[aa]=null}}ah.push(/[\0-\uffff]/);V=k(ah)})();var X=T.length;var W=function(ah){var Z=ah.sourceCode,Y=ah.basePos;var ad=[Y,F];var af=0;var an=Z.match(V)||[];var aj={};for(var ae=0,aq=an.length;ae=5&&"lang-"===ap.substring(0,5);if(am&&!(ai&&typeof ai[1]==="string")){am=false;ap=J}if(!am){aj[ag]=ap}}var ab=af;af+=ag.length;if(!am){ad.push(Y+ab,ap)}else{var al=ai[1];var ak=ag.indexOf(al);var ac=ak+al.length;if(ai[2]){ac=ag.length-ai[2].length;ak=ac-al.length}var ar=ap.substring(5);B(Y+ab,ag.substring(0,ak),W,ad);B(Y+ab+ak,al,q(ar,al),ad);B(Y+ab+ac,ag.substring(ac),W,ad)}}ah.decorations=ad};return W}function i(T){var W=[],S=[];if(T.tripleQuotedStrings){W.push([C,/^(?:\'\'\'(?:[^\'\\]|\\[\s\S]|\'{1,2}(?=[^\']))*(?:\'\'\'|$)|\"\"\"(?:[^\"\\]|\\[\s\S]|\"{1,2}(?=[^\"]))*(?:\"\"\"|$)|\'(?:[^\\\']|\\[\s\S])*(?:\'|$)|\"(?:[^\\\"]|\\[\s\S])*(?:\"|$))/,null,"'\""])}else{if(T.multiLineStrings){W.push([C,/^(?:\'(?:[^\\\']|\\[\s\S])*(?:\'|$)|\"(?:[^\\\"]|\\[\s\S])*(?:\"|$)|\`(?:[^\\\`]|\\[\s\S])*(?:\`|$))/,null,"'\"`"])}else{W.push([C,/^(?:\'(?:[^\\\'\r\n]|\\.)*(?:\'|$)|\"(?:[^\\\"\r\n]|\\.)*(?:\"|$))/,null,"\"'"])}}if(T.verbatimStrings){S.push([C,/^@\"(?:[^\"]|\"\")*(?:\"|$)/,null])}var Y=T.hashComments;if(Y){if(T.cStyleComments){if(Y>1){W.push([j,/^#(?:##(?:[^#]|#(?!##))*(?:###|$)|.*)/,null,"#"])}else{W.push([j,/^#(?:(?:define|elif|else|endif|error|ifdef|include|ifndef|line|pragma|undef|warning)\b|[^\r\n]*)/,null,"#"])}S.push([C,/^<(?:(?:(?:\.\.\/)*|\/?)(?:[\w-]+(?:\/[\w-]+)+)?[\w-]+\.h|[a-z]\w*)>/,null])}else{W.push([j,/^#[^\r\n]*/,null,"#"])}}if(T.cStyleComments){S.push([j,/^\/\/[^\r\n]*/,null]);S.push([j,/^\/\*[\s\S]*?(?:\*\/|$)/,null])}if(T.regexLiterals){var X=("/(?=[^/*])(?:[^/\\x5B\\x5C]|\\x5C[\\s\\S]|\\x5B(?:[^\\x5C\\x5D]|\\x5C[\\s\\S])*(?:\\x5D|$))+/");S.push(["lang-regex",new RegExp("^"+M+"("+X+")")])}var V=T.types;if(V){S.push([O,V])}var U=(""+T.keywords).replace(/^ | $/g,"");if(U.length){S.push([z,new RegExp("^(?:"+U.replace(/[\s,]+/g,"|")+")\\b"),null])}W.push([F,/^\s+/,null," \r\n\t\xA0"]);S.push([G,/^@[a-z_$][a-z_$@0-9]*/i,null],[O,/^(?:[@_]?[A-Z]+[a-z][A-Za-z_$@0-9]*|\w+_t\b)/,null],[F,/^[a-z_$][a-z_$@0-9]*/i,null],[G,new RegExp("^(?:0x[a-f0-9]+|(?:\\d(?:_\\d+)*\\d*(?:\\.\\d*)?|\\.\\d\\+)(?:e[+\\-]?\\d+)?)[a-z]*","i"),null,"0123456789"],[F,/^\\[\s\S]?/,null],[L,/^.[^\s\w\.$@\'\"\`\/\#\\]*/,null]);return g(W,S)}var K=i({keywords:A,hashComments:true,cStyleComments:true,multiLineStrings:true,regexLiterals:true});function Q(V,ag){var U=/(?:^|\s)nocode(?:\s|$)/;var ab=/\r\n?|\n/;var ac=V.ownerDocument;var S;if(V.currentStyle){S=V.currentStyle.whiteSpace}else{if(window.getComputedStyle){S=ac.defaultView.getComputedStyle(V,null).getPropertyValue("white-space")}}var Z=S&&"pre"===S.substring(0,3);var af=ac.createElement("LI");while(V.firstChild){af.appendChild(V.firstChild)}var W=[af];function ae(al){switch(al.nodeType){case 1:if(U.test(al.className)){break}if("BR"===al.nodeName){ad(al);if(al.parentNode){al.parentNode.removeChild(al)}}else{for(var an=al.firstChild;an;an=an.nextSibling){ae(an)}}break;case 3:case 4:if(Z){var am=al.nodeValue;var aj=am.match(ab);if(aj){var ai=am.substring(0,aj.index);al.nodeValue=ai;var ah=am.substring(aj.index+aj[0].length);if(ah){var ak=al.parentNode;ak.insertBefore(ac.createTextNode(ah),al.nextSibling)}ad(al);if(!ai){al.parentNode.removeChild(al)}}}break}}function ad(ak){while(!ak.nextSibling){ak=ak.parentNode;if(!ak){return}}function ai(al,ar){var aq=ar?al.cloneNode(false):al;var ao=al.parentNode;if(ao){var ap=ai(ao,1);var an=al.nextSibling;ap.appendChild(aq);for(var am=an;am;am=an){an=am.nextSibling;ap.appendChild(am)}}return aq}var ah=ai(ak.nextSibling,0);for(var aj;(aj=ah.parentNode)&&aj.nodeType===1;){ah=aj}W.push(ah)}for(var Y=0;Y=S){ah+=2}if(V>=ap){Z+=2}}}var t={};function c(U,V){for(var S=V.length;--S>=0;){var T=V[S];if(!t.hasOwnProperty(T)){t[T]=U}else{if(window.console){console.warn("cannot override language handler %s",T)}}}}function q(T,S){if(!(T&&t.hasOwnProperty(T))){T=/^\s*]*(?:>|$)/],[j,/^<\!--[\s\S]*?(?:-\->|$)/],["lang-",/^<\?([\s\S]+?)(?:\?>|$)/],["lang-",/^<%([\s\S]+?)(?:%>|$)/],[L,/^(?:<[%?]|[%?]>)/],["lang-",/^]*>([\s\S]+?)<\/xmp\b[^>]*>/i],["lang-js",/^]*>([\s\S]*?)(<\/script\b[^>]*>)/i],["lang-css",/^]*>([\s\S]*?)(<\/style\b[^>]*>)/i],["lang-in.tag",/^(<\/?[a-z][^<>]*>)/i]]),["default-markup","htm","html","mxml","xhtml","xml","xsl"]);c(g([[F,/^[\s]+/,null," \t\r\n"],[n,/^(?:\"[^\"]*\"?|\'[^\']*\'?)/,null,"\"'"]],[[m,/^^<\/?[a-z](?:[\w.:-]*\w)?|\/?>$/i],[P,/^(?!style[\s=]|on)[a-z](?:[\w:-]*\w)?/i],["lang-uq.val",/^=\s*([^>\'\"\s]*(?:[^>\'\"\s\/]|\/(?=\s)))/],[L,/^[=<>\/]+/],["lang-js",/^on\w+\s*=\s*\"([^\"]+)\"/i],["lang-js",/^on\w+\s*=\s*\'([^\']+)\'/i],["lang-js",/^on\w+\s*=\s*([^\"\'>\s]+)/i],["lang-css",/^style\s*=\s*\"([^\"]+)\"/i],["lang-css",/^style\s*=\s*\'([^\']+)\'/i],["lang-css",/^style\s*=\s*([^\"\'>\s]+)/i]]),["in.tag"]);c(g([],[[n,/^[\s\S]+/]]),["uq.val"]);c(i({keywords:l,hashComments:true,cStyleComments:true,types:e}),["c","cc","cpp","cxx","cyc","m"]);c(i({keywords:"null,true,false"}),["json"]);c(i({keywords:R,hashComments:true,cStyleComments:true,verbatimStrings:true,types:e}),["cs"]);c(i({keywords:x,cStyleComments:true}),["java"]);c(i({keywords:H,hashComments:true,multiLineStrings:true}),["bsh","csh","sh"]);c(i({keywords:I,hashComments:true,multiLineStrings:true,tripleQuotedStrings:true}),["cv","py"]);c(i({keywords:s,hashComments:true,multiLineStrings:true,regexLiterals:true}),["perl","pl","pm"]);c(i({keywords:f,hashComments:true,multiLineStrings:true,regexLiterals:true}),["rb"]);c(i({keywords:w,cStyleComments:true,regexLiterals:true}),["js"]);c(i({keywords:r,hashComments:3,cStyleComments:true,multilineStrings:true,tripleQuotedStrings:true,regexLiterals:true}),["coffee"]);c(g([],[[C,/^[\s\S]+/]]),["regex"]);function d(V){var U=V.langExtension;try{var S=a(V.sourceNode);var T=S.sourceCode;V.sourceCode=T;V.spans=S.spans;V.basePos=0;q(U,T)(V);D(V)}catch(W){if("console" in window){console.log(W&&W.stack?W.stack:W)}}}function y(W,V,U){var S=document.createElement("PRE");S.innerHTML=W;if(U){Q(S,U)}var T={langExtension:V,numberLines:U,sourceNode:S};d(T);return S.innerHTML}function b(ad){function Y(af){return document.getElementsByTagName(af)}var ac=[Y("pre"),Y("code"),Y("xmp")];var T=[];for(var aa=0;aa=0){var ah=ai.match(ab);var am;if(!ah&&(am=o(aj))&&"CODE"===am.tagName){ah=am.className.match(ab)}if(ah){ah=ah[1]}var al=false;for(var ak=aj.parentNode;ak;ak=ak.parentNode){if((ak.tagName==="pre"||ak.tagName==="code"||ak.tagName==="xmp")&&ak.className&&ak.className.indexOf("prettyprint")>=0){al=true;break}}if(!al){var af=aj.className.match(/\blinenums\b(?::(\d+))?/);af=af?af[1]&&af[1].length?+af[1]:true:false;if(af){Q(aj,af)}S={langExtension:ah,sourceNode:aj,numberLines:af};d(S)}}}if(X]*(?:>|$)/],[PR.PR_COMMENT,/^<\!--[\s\S]*?(?:-\->|$)/],[PR.PR_PUNCTUATION,/^(?:<[%?]|[%?]>)/],["lang-",/^<\?([\s\S]+?)(?:\?>|$)/],["lang-",/^<%([\s\S]+?)(?:%>|$)/],["lang-",/^]*>([\s\S]+?)<\/xmp\b[^>]*>/i],["lang-handlebars",/^]*type\s*=\s*['"]?text\/x-handlebars-template['"]?\b[^>]*>([\s\S]*?)(<\/script\b[^>]*>)/i],["lang-js",/^]*>([\s\S]*?)(<\/script\b[^>]*>)/i],["lang-css",/^]*>([\s\S]*?)(<\/style\b[^>]*>)/i],["lang-in.tag",/^(<\/?[a-z][^<>]*>)/i],[PR.PR_DECLARATION,/^{{[#^>/]?\s*[\w.][^}]*}}/],[PR.PR_DECLARATION,/^{{&?\s*[\w.][^}]*}}/],[PR.PR_DECLARATION,/^{{{>?\s*[\w.][^}]*}}}/],[PR.PR_COMMENT,/^{{![^}]*}}/]]),["handlebars","hbs"]);PR.registerLangHandler(PR.createSimpleLexer([[PR.PR_PLAIN,/^[ \t\r\n\f]+/,null," \t\r\n\f"]],[[PR.PR_STRING,/^\"(?:[^\n\r\f\\\"]|\\(?:\r\n?|\n|\f)|\\[\s\S])*\"/,null],[PR.PR_STRING,/^\'(?:[^\n\r\f\\\']|\\(?:\r\n?|\n|\f)|\\[\s\S])*\'/,null],["lang-css-str",/^url\(([^\)\"\']*)\)/i],[PR.PR_KEYWORD,/^(?:url|rgb|\!important|@import|@page|@media|@charset|inherit)(?=[^\-\w]|$)/i,null],["lang-css-kw",/^(-?(?:[_a-z]|(?:\\[0-9a-f]+ ?))(?:[_a-z0-9\-]|\\(?:\\[0-9a-f]+ ?))*)\s*:/i],[PR.PR_COMMENT,/^\/\*[^*]*\*+(?:[^\/*][^*]*\*+)*\//],[PR.PR_COMMENT,/^(?:)/],[PR.PR_LITERAL,/^(?:\d+|\d*\.\d+)(?:%|[a-z]+)?/i],[PR.PR_LITERAL,/^#(?:[0-9a-f]{3}){1,2}/i],[PR.PR_PLAIN,/^-?(?:[_a-z]|(?:\\[\da-f]+ ?))(?:[_a-z\d\-]|\\(?:\\[\da-f]+ ?))*/i],[PR.PR_PUNCTUATION,/^[^\s\w\'\"]+/]]),["css"]);PR.registerLangHandler(PR.createSimpleLexer([],[[PR.PR_KEYWORD,/^-?(?:[_a-z]|(?:\\[\da-f]+ ?))(?:[_a-z\d\-]|\\(?:\\[\da-f]+ ?))*/i]]),["css-kw"]);PR.registerLangHandler(PR.createSimpleLexer([],[[PR.PR_STRING,/^[^\)\"\']+/]]),["css-str"]); diff --git a/wasm/nucleotide-count/coverage/lcov-report/sort-arrow-sprite.png b/wasm/nucleotide-count/coverage/lcov-report/sort-arrow-sprite.png new file mode 100644 index 00000000..6ed68316 Binary files /dev/null and b/wasm/nucleotide-count/coverage/lcov-report/sort-arrow-sprite.png differ diff --git a/wasm/nucleotide-count/coverage/lcov-report/sorter.js b/wasm/nucleotide-count/coverage/lcov-report/sorter.js new file mode 100644 index 00000000..2bb296a8 --- /dev/null +++ b/wasm/nucleotide-count/coverage/lcov-report/sorter.js @@ -0,0 +1,196 @@ +/* eslint-disable */ +var addSorting = (function() { + 'use strict'; + var cols, + currentSort = { + index: 0, + desc: false + }; + + // returns the summary table element + function getTable() { + return document.querySelector('.coverage-summary'); + } + // returns the thead element of the summary table + function getTableHeader() { + return getTable().querySelector('thead tr'); + } + // returns the tbody element of the summary table + function getTableBody() { + return getTable().querySelector('tbody'); + } + // returns the th element for nth column + function getNthColumn(n) { + return getTableHeader().querySelectorAll('th')[n]; + } + + function onFilterInput() { + const searchValue = document.getElementById('fileSearch').value; + const rows = document.getElementsByTagName('tbody')[0].children; + for (let i = 0; i < rows.length; i++) { + const row = rows[i]; + if ( + row.textContent + .toLowerCase() + .includes(searchValue.toLowerCase()) + ) { + row.style.display = ''; + } else { + row.style.display = 'none'; + } + } + } + + // loads the search box + function addSearchBox() { + var template = document.getElementById('filterTemplate'); + var templateClone = template.content.cloneNode(true); + templateClone.getElementById('fileSearch').oninput = onFilterInput; + template.parentElement.appendChild(templateClone); + } + + // loads all columns + function loadColumns() { + var colNodes = getTableHeader().querySelectorAll('th'), + colNode, + cols = [], + col, + i; + + for (i = 0; i < colNodes.length; i += 1) { + colNode = colNodes[i]; + col = { + key: colNode.getAttribute('data-col'), + sortable: !colNode.getAttribute('data-nosort'), + type: colNode.getAttribute('data-type') || 'string' + }; + cols.push(col); + if (col.sortable) { + col.defaultDescSort = col.type === 'number'; + colNode.innerHTML = + colNode.innerHTML + ''; + } + } + return cols; + } + // attaches a data attribute to every tr element with an object + // of data values keyed by column name + function loadRowData(tableRow) { + var tableCols = tableRow.querySelectorAll('td'), + colNode, + col, + data = {}, + i, + val; + for (i = 0; i < tableCols.length; i += 1) { + colNode = tableCols[i]; + col = cols[i]; + val = colNode.getAttribute('data-value'); + if (col.type === 'number') { + val = Number(val); + } + data[col.key] = val; + } + return data; + } + // loads all row data + function loadData() { + var rows = getTableBody().querySelectorAll('tr'), + i; + + for (i = 0; i < rows.length; i += 1) { + rows[i].data = loadRowData(rows[i]); + } + } + // sorts the table using the data for the ith column + function sortByIndex(index, desc) { + var key = cols[index].key, + sorter = function(a, b) { + a = a.data[key]; + b = b.data[key]; + return a < b ? -1 : a > b ? 1 : 0; + }, + finalSorter = sorter, + tableBody = document.querySelector('.coverage-summary tbody'), + rowNodes = tableBody.querySelectorAll('tr'), + rows = [], + i; + + if (desc) { + finalSorter = function(a, b) { + return -1 * sorter(a, b); + }; + } + + for (i = 0; i < rowNodes.length; i += 1) { + rows.push(rowNodes[i]); + tableBody.removeChild(rowNodes[i]); + } + + rows.sort(finalSorter); + + for (i = 0; i < rows.length; i += 1) { + tableBody.appendChild(rows[i]); + } + } + // removes sort indicators for current column being sorted + function removeSortIndicators() { + var col = getNthColumn(currentSort.index), + cls = col.className; + + cls = cls.replace(/ sorted$/, '').replace(/ sorted-desc$/, ''); + col.className = cls; + } + // adds sort indicators for current column being sorted + function addSortIndicators() { + getNthColumn(currentSort.index).className += currentSort.desc + ? ' sorted-desc' + : ' sorted'; + } + // adds event listeners for all sorter widgets + function enableUI() { + var i, + el, + ithSorter = function ithSorter(i) { + var col = cols[i]; + + return function() { + var desc = col.defaultDescSort; + + if (currentSort.index === i) { + desc = !currentSort.desc; + } + sortByIndex(i, desc); + removeSortIndicators(); + currentSort.index = i; + currentSort.desc = desc; + addSortIndicators(); + }; + }; + for (i = 0; i < cols.length; i += 1) { + if (cols[i].sortable) { + // add the click event handler on the th so users + // dont have to click on those tiny arrows + el = getNthColumn(i).querySelector('.sorter').parentElement; + if (el.addEventListener) { + el.addEventListener('click', ithSorter(i)); + } else { + el.attachEvent('onclick', ithSorter(i)); + } + } + } + } + // adds sorting functionality to the UI + return function() { + if (!getTable()) { + return; + } + cols = loadColumns(); + loadData(); + addSearchBox(); + addSortIndicators(); + enableUI(); + }; +})(); + +window.addEventListener('load', addSorting); diff --git a/wasm/nucleotide-count/coverage/lcov.info b/wasm/nucleotide-count/coverage/lcov.info new file mode 100644 index 00000000..e69de29b diff --git a/wasm/nucleotide-count/nucleotide-count.spec.js b/wasm/nucleotide-count/nucleotide-count.spec.js index 4ed81b66..29ac30f8 100644 --- a/wasm/nucleotide-count/nucleotide-count.spec.js +++ b/wasm/nucleotide-count/nucleotide-count.spec.js @@ -1,75 +1,80 @@ -import { compileWat, WasmRunner } from "@exercism/wasm-lib"; +import { + compileWat, + WasmRunner +} from "@exercism/wasm-lib"; let wasmModule; let currentInstance; beforeAll(async () => { - try { - const watPath = new URL("./nucleotide-count.wat", import.meta.url); - const { buffer } = await compileWat(watPath); - wasmModule = await WebAssembly.compile(buffer); - } catch (err) { - console.log(`Error compiling *.wat: ${err}`); - process.exit(1); - } + try { + const watPath = new URL("./nucleotide-count.wat", import.meta.url); + const { + buffer + } = await compileWat(watPath); + wasmModule = await WebAssembly.compile(buffer); + } catch (err) { + console.log(`Error compiling *.wat: ${err}`); + process.exit(1); + } }); function countNucleotides(input) { - const inputBufferOffset = 64; - const inputBufferCapacity = 256; + const inputBufferOffset = 64; + const inputBufferCapacity = 256; - const inputLengthEncoded = new TextEncoder().encode(input).length; - if (inputLengthEncoded > inputBufferCapacity) { - throw new Error( - `String is too large for buffer of size ${inputBufferCapacity} bytes` - ); - } + const inputLengthEncoded = new TextEncoder().encode(input).length; + if (inputLengthEncoded > inputBufferCapacity) { + throw new Error( + `String is too large for buffer of size ${inputBufferCapacity} bytes` + ); + } - currentInstance.set_mem_as_utf8(inputBufferOffset, inputLengthEncoded, input); + currentInstance.set_mem_as_utf8(inputBufferOffset, inputLengthEncoded, input); - // Pass offset and length to WebAssembly function - return currentInstance.exports.countNucleotides( - inputBufferOffset, - input.length - ); + // Pass offset and length to WebAssembly function + return currentInstance.exports.countNucleotides( + inputBufferOffset, + input.length + ); } describe("count all nucleotides in a strand", () => { - beforeEach(async () => { - currentInstance = null; - if (!wasmModule) { - return Promise.reject(); - } - try { - currentInstance = await new WasmRunner(wasmModule); - return Promise.resolve(); - } catch (err) { - console.log(`Error instantiating WebAssembly module: ${err}`); - return Promise.reject(); - } - }); + beforeEach(async () => { + currentInstance = null; + if (!wasmModule) { + return Promise.reject(); + } + try { + currentInstance = await new WasmRunner(wasmModule); + return Promise.resolve(); + } catch (err) { + console.log(`Error instantiating WebAssembly module: ${err}`); + return Promise.reject(); + } + }); - test("empty strand", () => { - expect(countNucleotides("")).toEqual([0, 0, 0, 0]); - }); + test("empty strand", () => { + expect(countNucleotides("")).toEqual([0, 0, 0, 0]); + }); - test("can count one nucleotide in single-character input", () => { - expect(countNucleotides("G")).toEqual([0, 0, 1, 0]); - }); + test("can count one nucleotide in single-character input", () => { + expect(countNucleotides("G")).toEqual([0, 0, 1, 0]); + }); - test("strand with repeated nucleotide", () => { - expect(countNucleotides("GGGGGGG")).toEqual([0, 0, 7, 0]); - }); + test("strand with repeated nucleotide", () => { + expect(countNucleotides("GGGGGGG")).toEqual([0, 0, 7, 0]); + }); - test("strand with multiple nucleotides", () => { - expect( - countNucleotides( - "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" - ) - ).toEqual([20, 12, 17, 21]); - }); + test("strand with multiple nucleotides", () => { + expect( + countNucleotides( + "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" + ) + ).toEqual([20, 12, 17, 21]); + }); - test("strand with invalid nucleotides", () => { - expect(countNucleotides("AGXXACT")).toEqual([-1, -1, -1, -1]); - }); -}); + test("strand with invalid nucleotides", () => { + expect(countNucleotides("AGXXACT")).toEqual([-1, -1, -1, -1]); + }); +}); \ No newline at end of file diff --git a/wasm/nucleotide-count/nucleotide-count.wat b/wasm/nucleotide-count/nucleotide-count.wat index 48e0fdcb..cdd43e1c 100644 --- a/wasm/nucleotide-count/nucleotide-count.wat +++ b/wasm/nucleotide-count/nucleotide-count.wat @@ -1,12 +1,226 @@ +;; https://exercism.org/tracks/wasm/exercises/nucleotide-count + (module + (import "console" "log_mem_as_utf8" (func $log_mem_as_utf8 (param $byteOffset i32) (param $length i32))) + (import "console" "log_i32_u" (func $log_i32_u (param i32))) + ;; (import "console" "log_i64_u" (func $log_i64_u (param i64))) + ;; string log example + ;; (call $log_mem_as_utf8 (local.get $offset) (local.get $length)) + ;; i32 log example + ;; (call $log_i32_u (local.get $number)) + (memory (export "mem") 1) - (func (export "countNucleotides") (param $offset i32) (param $length i32) (result i32 i32 i32 i32) - (return - (i32.const -1) - (i32.const -1) - (i32.const -1) - (i32.const -1) + (global $a_offset i32 (i32.const 1000)) + (global $c_offset i32 (i32.const 1001)) + (global $g_offset i32 (i32.const 1002)) + (global $t_offset i32 (i32.const 1003)) + + (global $false i32 (i32.const 0)) + (global $true i32 (i32.const 1)) + + ;; 0=>false/disable, 1=>true/enable + (global $debug i32 (i32.const 0)) + + (data (i32.const 1000) "ACGT") + (global $data_length i32 (i32.const 4)) + + (data (i32.const 2000) "ERROR") + (global $error_offset i32 (i32.const 2000)) + (global $error_length i32 (i32.const 5)) + + (data (i32.const 2005) "NOT_A_MATCH") + (global $not_a_match_offset i32 (i32.const 2005)) + (global $not_a_match_length i32 (i32.const 11)) + (global $match_offset i32 (i32.const 2011)) + (global $match_length i32 (i32.const 5)) + + (data (i32.const 2016) "SEQUENCE") + (global $title_offset i32 (i32.const 2016)) + (global $title_length i32 (i32.const 8)) + + (data (i32.const 2024) "CHECKING") + (global $checking_offset i32 (i32.const 2024)) + (global $checking_length i32 (i32.const 8)) + + (func (export "countNucleotides") (param $sequence_offset i32) (param $sequence_length i32) (result i32 i32 i32 i32) + (local $sequence_ptr i32) + (local $found i32) + + (local $a_count i32) + (local $c_count i32) + (local $g_count i32) + (local $t_count i32) + + (local $error i32) + + (local.set $sequence_ptr (local.get $sequence_offset)) + + (local.set $a_count (i32.const 0)) + (local.set $c_count (i32.const 0)) + (local.set $g_count (i32.const 0)) + (local.set $t_count (i32.const 0)) + + (local.set $error (i32.const -1)) + + (if + (i32.eq + (local.get $sequence_length) + (i32.const 0) + ) ;; eq + (then + (return + (local.get $a_count) + (local.get $c_count) + (local.get $g_count) + (local.get $t_count) + ) ;; return + ) ;; then + ) ;; if other + + (call $debug_print_str (global.get $title_offset) (global.get $title_length)) + (call $debug_print_str (local.get $sequence_offset) (local.get $sequence_length)) + + (loop $my_loop + (local.set $found (global.get $false)) + + (call $debug_print_str (global.get $checking_offset) (global.get $checking_length)) + (call $debug_print_str (local.get $sequence_ptr) (i32.const 1)) + + (call $debug_print_str (global.get $a_offset) (i32.const 1)) + (if + (i32.eq + (i32.load8_u (global.get $a_offset)) + (i32.load8_u (local.get $sequence_ptr)) + ) ;; eq + (then + (local.set $a_count (i32.add (local.get $a_count) (i32.const 1))) + (local.set $found (global.get $true)) + + (call $debug_print_str (global.get $match_offset) (global.get $match_length)) + (call $debug_print_i32u (local.get $a_count)) + ) ;; then + (else + (call $debug_print_str (global.get $not_a_match_offset) (global.get $not_a_match_length)) + ) ;; + ) ;; if a + + (call $debug_print_str (global.get $c_offset) (i32.const 1)) + (if + (i32.eq + (i32.load8_u (global.get $c_offset)) + (i32.load8_u (local.get $sequence_ptr)) + ) ;; eq + (then + (local.set $c_count (i32.add (local.get $c_count) (i32.const 1))) + (local.set $found (global.get $true)) + + (call $debug_print_str (global.get $match_offset) (global.get $match_length)) + (call $debug_print_i32u (local.get $c_count)) + ) ;; then + (else + (call $debug_print_str (global.get $not_a_match_offset) (global.get $not_a_match_length)) + ) ;; + ) ;; if c + + (call $debug_print_str (global.get $g_offset) (i32.const 1)) + (if + (i32.eq + (i32.load8_u (global.get $g_offset)) + (i32.load8_u (local.get $sequence_ptr)) + ) ;; eq + (then + (local.set $g_count (i32.add (local.get $g_count) (i32.const 1))) + (local.set $found (global.get $true)) + + (call $debug_print_str (global.get $match_offset) (global.get $match_length)) + (call $debug_print_i32u (local.get $g_count)) + ) ;; then + (else + (call $debug_print_str (global.get $not_a_match_offset) (global.get $not_a_match_length)) + ) ;; + ) ;; if g + + (call $debug_print_str (global.get $t_offset) (i32.const 1)) + (if + (i32.eq + (i32.load8_u (global.get $t_offset)) + (i32.load8_u (local.get $sequence_ptr)) + ) ;; eq + (then + (local.set $t_count (i32.add (local.get $t_count) (i32.const 1))) + (local.set $found (global.get $true)) + + (call $debug_print_str (global.get $match_offset) (global.get $match_length)) + (call $debug_print_i32u (local.get $t_count)) + ) ;; then + (else + (call $debug_print_str (global.get $not_a_match_offset) (global.get $not_a_match_length)) + ) ;; + ) ;; if t + + (if + (i32.eq + (local.get $found) + (global.get $false) + ) ;; eq + (then + (call $debug_print_str (global.get $error_offset) (global.get $error_length)) + (call $debug_print_str (local.get $sequence_ptr) (i32.const 1)) + (call $debug_print_i32u (local.get $sequence_ptr)) + (call $debug_print_i32u (local.get $sequence_length)) + + (return + (local.get $error) + (local.get $error) + (local.get $error) + (local.get $error) + ) ;; return + ) ;; then + ) ;; if other + + (local.set $sequence_ptr (i32.add (local.get $sequence_ptr) (i32.const 1))) + + (call $debug_print_i32u (local.get $sequence_ptr)) + + ;; break if false + (br_if $my_loop + (i32.lt_u + (local.get $sequence_ptr) + (i32.add (local.get $sequence_offset) (local.get $sequence_length)) + ) ;; ge + ) ;; br_if + ) ;; loop + + (return + (local.get $a_count) + (local.get $c_count) + (local.get $g_count) + (local.get $t_count) ) ) -) + + (func $debug_print_i32u (export "debug_print_i32u") (param $value i32) + (if + (i32.eq + (global.get $debug) + (global.get $true) + ) ;; eq + (then + (call $log_i32_u (local.get $value)) + ) ;; then + ) ;; if debugging + ) ;; debug_print_i32u() + + (func $debug_print_str (export "debug_print_str") (param $offset i32) (param $length i32) + (if + (i32.eq + (global.get $debug) + (global.get $true) + ) ;; eq + (then + (call $log_mem_as_utf8 (local.get $offset) (local.get $length)) + ) ;; then + ) ;; if debugging + ) ;; debug_print_str() +) ;; module diff --git a/wasm/nucleotide-count/run-tests-wasm.txt b/wasm/nucleotide-count/run-tests-wasm.txt new file mode 100644 index 00000000..1fca51ff --- /dev/null +++ b/wasm/nucleotide-count/run-tests-wasm.txt @@ -0,0 +1,136 @@ +Running automated test file(s): + + +=============================================================================== + +Running: ../../.github/citools/wasm/wasm-lint-formatter + +Running WebAssembly Formatter + +Node versions: + + nodejs: v12.22.12 + npm: 9.8.1 + yarn: 1.22.19 + + + ============================================================================== + +Running: js-beautify ./babel.config.js ./nucleotide-count.spec.js + +beautified babel.config.js - unchanged +beautified nucleotide-count.spec.js - unchanged + +real 0m0.091s +user 0m0.089s +sys 0m0.015s + + + ============================================================================== + +Exit code: 0 + +real 0m0.403s +user 0m0.386s +sys 0m0.079s + +real 0m0.406s +user 0m0.388s +sys 0m0.081s + +=============================================================================== + +Running: npm install + +up to date in 493ms + +107 packages are looking for funding + run `npm fund` for details + +real 0m0.681s +user 0m0.939s +sys 0m0.085s + +=============================================================================== + +Running: ../../.github/citools/wasm/wasm-test-with-coverage + +Running WebAssembly Tests With Coverage + +Node versions: + + nodejs: v12.22.12 + npm: 9.8.1 + yarn: 1.22.19 + + + ============================================================================== + +Running: rm -rf ./coverage + + +real 0m0.001s +user 0m0.000s +sys 0m0.001s + + + ============================================================================== + +Running: npm run test -- --coverage + + +> test +> node --experimental-vm-modules node_modules/jest/bin/jest.js ./* --coverage + +(node:19987) ExperimentalWarning: VM Modules is an experimental feature. This feature could change at any time +(Use `node --trace-warnings ...` to show where the warning was created) +PASS ./nucleotide-count.spec.js + count all nucleotides in a strand + ✓ empty strand (3 ms) + ✓ can count one nucleotide in single-character input + ✓ strand with repeated nucleotide (1 ms) + ✓ strand with multiple nucleotides + ✓ strand with invalid nucleotides (1 ms) + +----------|---------|----------|---------|---------|------------------- +File | % Stmts | % Branch | % Funcs | % Lines | Uncovered Line #s +----------|---------|----------|---------|---------|------------------- +All files | 0 | 0 | 0 | 0 | +----------|---------|----------|---------|---------|------------------- +Test Suites: 1 passed, 1 total +Tests: 5 passed, 5 total +Snapshots: 0 total +Time: 0.33 s, estimated 2 s +Ran all test suites matching /.\/HELP.md|.\/LICENSE|.\/README.md|.\/babel.config.js|.\/node_modules|.\/nucleotide-count.spec.js|.\/nucleotide-count.wat|.\/package-lock.json|.\/package.json|.\/run-tests-wasm.txt/i. + +real 0m0.937s +user 0m0.909s +sys 0m0.147s + + + ============================================================================== + +Exit code: 0 + +real 0m1.247s +user 0m1.201s +sys 0m0.217s + +real 0m1.250s +user 0m1.203s +sys 0m0.217s + +=============================================================================== + +Running: misspell ./nucleotide-count.wat + +real 0m0.039s +user 0m0.036s +sys 0m0.017s + +=============================================================================== + +/home/vpayno/git_vpayno/exercism-workspace/wasm + +=============================================================================== +