variant_catalog.json

[LJ-jiao]

I want to create a variant_catalog.json file to identify VNTR in FcRn gene using WGS sequencing data.
The FcRn gene contains a VNTR sequence consisting of three repeats of 37 nucleotides each, with one nucleotide difference in the third repeat compared to the first two repeats. How should I write this JSON file?

The sequence of this region is as follows.

>hg38_dna range=chr19:49512986-49513096 5'pad=0 3'pad=0 strand=+ repeatMasking=lower
cggactcctgggtccgagggtagagcggttgggggcc
cggactcctgggtccgagggtagagcggttgggggcc
cggactcctgggtccgagggaagagcggttgggggcc

[andreasssh]

If you want to get the genotype involving both motifs, you can define the first motif as the repeated unit and the length of all 3 repeats as the region. Both motifs (3 repeats) will be counted despite the 1-nucleotide difference.

[
    {
        "LocusId": "FCGRT",
        "LocusStructure": "(CGGACTCCTGGGTCCGAGGGTAGAGCGGTTGGGGGCC)*",
        "ReferenceRegion": "chr19:49512985-49513096",
        "VariantId": "FCGRT",
        "VariantType": "Repeat"
    }
]