Merge pull request #4 from Zymo-Research/dev

hide some parameters and change path to indices

conf/igenome.config

@@ -1,13 +1,13 @@
 params {
     genomes {
         hg38 {
-            index = 's3://pacinfo-fs/tmp/qong/BSBolt/hg38_indexFull_rrbs/'
+            index = 's3://zymo-filesystem/srv/pacinfo/BSBolt/hg38_indexFull_rrbs/'
         }
         mm10 {
-            index = 's3://pacinfo-fs/tmp/qong/BSBolt/mm10_indexFull_rrbs/'
+            index = 's3://zymo-filesystem/srv/pacinfo/BSBolt/mm10_indexFull_rrbs/'
         }
         hg38_testdata {
-            index = 's3://pacinfo-fs/tmp/qong/BSBolt/DB_index_test/'
+            index = 's3://zymo-filesystem/srv/pacinfo/BSBolt/DB_index_test/'
         }
     }
 }

nextflow_schema.json

@@ -20,6 +20,7 @@
                 "outdir": {
                     "type": "string",
                     "description": "The output directory where the results will be saved",
+                    "default": "./results",
                     "hidden": true
                 },
                 "project": {
@@ -43,7 +44,9 @@
                     "description": "Reference genome used to align reads.",
                     "hidden": false,
                     "advanced": false,
-                    "enum": ["hg38", "mm10", "hg38_testdata"]
+                    "enum": ["hg38",
+                             "mm10",
+                             "hg38_testdata"]
                 }
             },
             "required": [
@@ -58,22 +61,26 @@
                 "adapter_first_read": {
                     "type": "string",
                     "description": "Sequence of an adapter ligated to the 3' end (paired data: of the first read). The adapter and subsequent bases are trimmed.",
+                    "hidden": true,
                     "default": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"
                 },
                 "adapter_second_read": {
                     "type": "string",
                     "description": "3' adapter to be removed from second read in a pair",
+                    "hidden": true,
                     "default": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"
                 },
                 "minimum_length": {
                     "type": "integer",
                     "description": "Discard reads shorter than LEN. Default: 1",
+                    "hidden": true,
                     "minimum": 1,
                     "default": 1
                 },
                 "cores": {
                     "type": "integer",
                     "description": "Number of CPU cores to use. Use 0 to auto-detect. Default: 7",
+                    "hidden": true,
                     "minimum": 1,
                     "maximum": 8,
                     "default": 7
@@ -93,23 +100,27 @@
                 "base_quality": {
                     "type": "integer",
                     "description": "minimum base quality",
+                    "hidden": true,
                     "default": 10
                 },
                 "alignment_quality": {
                     "type": "integer",
                     "description": "minimum alignment quality",
+                    "hidden": true,
                     "minimum": 10,
                     "default": 20
                 },
                 "max_read_depth": {
                     "type": "integer",
                     "description": "max read depth to call methylation [8000]",
+                    "hidden": true,
                     "minimum": 100,
                     "default": 8000
                 },
                 "minimum_read_depth": {
                     "type": "integer",
                     "description": "minimum read depth required to report methylation site [10]",
+                    "hidden": true,
                     "minimum": 10,
                     "default": 10
                 }