Merge pull request #89 from TomHarrop/repeatexplorer

Repeatexplorer

tools/repeatexplorer2/.shed.yml

@@ -0,0 +1,20 @@
+---
+auto_tool_repositories:
+  name_template: "{{ tool_id }}"
+  description_template: "{{ tool_name }} from the cactus suite"
+categories:
+  - Genome annotation
+description: Tool for annotation of repeats from unassembled shotgun reads.
+homepage_url: https://github.com/repeatexplorer/repex_tarean
+long_description: |
+  Tool for annotation of repeats from unassembled shotgun reads.
+name: repeatexplorer2
+owner: gga
+remote_repository_url: https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/repeatexplorer2
+suite:
+  name: suite_repeatexplorer2
+  description: >
+    Tool for annotation of repeats from unassembled shotgun reads.
+  long_description: >
+    Tool for annotation of repeats from unassembled shotgun reads.
+type: unrestricted

tools/repeatexplorer2/macros.xml

@@ -0,0 +1,29 @@
+<macros>
+    <token name="@TOOL_VERSION@">2.3.8</token>
+    <token name="@VERSION_SUFFIX@">0</token>
+    <token name="@PROFILE@">23.0</token>
+    <xml name="requirements">
+        <requirements>
+            <container type="docker">kavonrtep/repeatexplorer:@TOOL_VERSION@</container>
+        </requirements>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="bibtex">@software{repeatexplorer2,
+                author = {repeatexplorer},
+                year = {2023},
+                title = {repeatexplorer2},
+                publisher = {GitHub},
+                url = {https://github.com/repeatexplorer/repex_tarean}
+                      }</citation>
+        </citations>
+    </xml>
+    <xml name="creator">
+        <creator>
+            <person name="Petr Novak" />
+            <organization name="Laboratory of Molecular Cytogenetics"  url="http://w3lamc.umbr.cas.cz/lamc" address="Institute of Plant Molecular Biology, Biology Centre CAS, Branisovska 31, Ceske Budejoice, Czech Republic"/>                
+            <person name="Tom Harrop"/>
+            <organization name="Galaxy Australia" url="https://site.usegalaxy.org.au"/>
+        </creator>
+    </xml>
+</macros>

tools/repeatexplorer2/repex_full_clustering.xml

@@ -0,0 +1,240 @@
+<tool id="repeatexplorer_clusterin" name="RepeatExplorer (clustering)" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
+  <description>repeat discovery and characterization using graph-based sequence clustering</description>
+  <macros>
+    <import>macros.xml</import>
+  </macros>
+  <expand macro="creator"/>
+  <expand macro="requirements"/>
+  <command><![CDATA[
+      
+      export GALAXY_MEMORY_KB=\$((\${GALAXY_MEMORY_MB:-8192}*1024))
+      &&
+
+      export PYTHONHASHSEED=0
+      &&
+
+      ## output will go here
+      mkdir -p '${reportfile.extra_files_path}'
+      &&
+
+      /repex_tarean/seqclust
+      --cpu \${GALAXY_SLOTS:-1}
+      --max_memory \${GALAXY_MEMORY_KB}
+      '${paired}'
+      #if $sample:
+        --sample '${sample}'
+      #end if
+      --taxon '${taxon}'
+      --output_dir='${reportfile.extra_files_path}'
+      #if $advanced.mincl:
+        --mincl '${advanced.mincl}'
+      #end if
+      --assembly_min '${advanced.assembly_min}'
+      #if $advanced.keep_names:
+        --keep_names
+      #end if
+      '${fastafile}'
+      &&
+
+      ## pick up the html index
+      cp '${reportfile.extra_files_path}/index.html' ./index.html
+
+      ]]></command>
+  <inputs>
+    <param name="fastafile" label="NGS reads" type="data" format="fasta" help="Input file must contain FASTA-formatted NGS reads. Illumina paired-end reads are recommended."/>
+    <param argument="--paired" type="boolean" truevalue="--paired" falsevalue="" checked="True" label="Paired-end reads" help="If paired-end reads are used, they must be interleaved and all pairs must be complete. Example of the correct format is provided in the help below."/>
+    <param argument="--sample" type="integer" min="2" optional="true" label="Subsample reads (number)" help="Use an integer &gt; 1 to select a specific number of reads to use. Leave this field blank to use the entire dataset."/>
+    <param argument="--taxon" label="Select taxon and protein domain database version (REXdb)" type="select" help="Reference database of transposable element protein domains - REXdb - is used for annotation of repeats">
+      <option value="VIRIDIPLANTAE3.0" selected="true">Viridiplantae version 3.0</option>
+      <option value="VIRIDIPLANTAE2.2" selected="true">Viridiplantae version 2.2</option>
+      <option value="METAZOA3.0">Metazoa version 3.0</option>
+      <option value="METAZOA2.0">Metazoa version 2.0</option>
+    </param>
+    <section name="advanced" title="Advanced options" expanded="false">
+      <param argument="--mincl" label="Cluster size threshold  for detailed analysis" type="float" value="" min="0.0001" max="100" optional="true" help="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; clusters with less than 20 reads are not considered."/>
+      <param argument="--assembly_min" type="integer" label="Minimal cluster size for assembly" value="5" min="2" max="100"/>
+      <param argument="--keep_names" label="Keep original read names" type="boolean" checked="false" help="By default, reads are renamed using integers. Use this option to keep original names."/>
+    </section>
+  </inputs>
+  <outputs>
+    <data name="reportfile" format="html" from_work_dir="index.html" label="RepeatExplorer - HTML report on ${on_string}"/>
+  </outputs>
+  <tests>
+    <!-- test1: basic function -->
+    <test expect_num_outputs="1">
+      <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/>
+      <param name="paired" value="True"/>
+      <param name="taxon" value="VIRIDIPLANTAE3.0"/>
+      <output name="reportfile">
+      <assert_contents>
+        <has_text text="Clustering summary"/>
+      </assert_contents>
+    </output>
+    </test>
+    <!-- test2: read subsample -->
+    <test expect_num_outputs="1">
+      <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/>
+      <param name="paired" value="True"/>
+      <param name="sample" value="5000"/>
+      <param name="taxon" value="VIRIDIPLANTAE3.0"/>
+      <output name="reportfile">
+        <assert_contents>
+          <has_text text="Clustering summary"/>
+        </assert_contents>
+      </output>
+    </test>
+    <!-- test3: advanced params -->
+    <test expect_num_outputs="1">
+      <param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/>
+      <param name="paired" value="True"/>
+      <param name="taxon" value="VIRIDIPLANTAE3.0"/>
+      <param name="mincl" value="0.01"/>
+      <param name="keep_names" value="True"/>
+      <output name="reportfile">
+        <assert_contents>
+          <has_text text="Clustering summary"/>
+        </assert_contents>
+      </output>
+    </test>
+  </tests>
+  <help><![CDATA[
+      **HELP**
+      
+      RepeatExplorer2 clustering is a computational pipeline for unsupervised
+      identification of repeats from unassembled sequence reads. The
+      pipeline uses low-pass whole genome sequence reads and performs graph-based
+      clustering. Resulting clusters, representing all types of repeats, are then
+      examined to identify and classify into repeats groups. 
+
+      **Input data**
+      
+      The analysis requires either **single** or **paired-end reads** generated
+      by whole genome shotgun sequencing provided as a single fasta-formatted file.
+      Generally, paired-end reads provide significantly better results than single
+      reads. Reads should be of uniform length (optimal size range is 100-200 nt) and
+      the number of analyzed reads should represent less than 1x genome equivalent
+      (genome coverage of 0.01 - 0.50 x is recommended). Reads should be
+      quality-filtered (recommended filtering : quality score >=10 over 95% of bases
+      and no Ns allowed) and only **complete read pairs** should be submitted for
+      analysis. When paired reads are used, input data must be **interlaced** format
+      as fasta file:
+
+      example of interlaced input format::
+      
+        >0001_f
+        CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
+        >0001_r
+        GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
+        >0002_f
+        ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
+        >0002_r
+        TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
+        >0003_f
+        TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
+        >0003_r
+        TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
+        ...
+
+
+      **Comparative analysis**
+
+      For comparative analysis sequence names must contain code (prefix) for each group.
+      Prefix in sequences names  must be of fixed length.
+
+      Example of labeling two groups with where **group code length** is 2 and is used to distinguish groups - AA and BB ::
+
+        >AA0001_f
+        CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
+        >AA0001_r
+        GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
+        >AA0002_f
+        ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
+        >AA0002_r
+        TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
+        >BB0001_f
+        TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
+        >BB0001_r
+        TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
+        >BB0002_f
+        TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
+        >BB0002_r
+        TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
+        
+
+      To prepare quality filtered and interlaced input fasta file from fastq
+      files, use `Preprocessing of paired-reads`__  tool.
+
+      .. __: tool_runner?tool_id=paired_fastq_filtering
+
+
+      **Additional parameters**
+
+      **Sample size** defines how many reads should be used in calculation.
+      Default setting with 500,000 reads will enable detection of high copy
+      repeats within several hours of computation time. For higher
+      sensitivity the sample size can be set higher. Since sample size affects
+      the memory usage, this parameter may be automatically adjusted to lower
+      value during the run. Maximum sample size which can be processed depends on
+      the repetitiveness of analyzed genome.
+
+      
+      **Select taxon and protein domain database version (REXdb)**. Classification
+      of transposable elements is based on the similarity to our reference database
+      of transposable element protein domains (**REXdb**). Standalone database for Viridiplantae species
+      can be obtained on `repeatexplorer.org`__. Classification
+      system used in REXdb is described in article `Systematic survey of plant
+      LTR-retrotransposons elucidates phylogenetic relationships of their
+      polyprotein domains and provides a reference for element classification`__
+      Database for Metazoa species is still under development so use it with caution.
+
+      .. __: http://repeatexplorer.org
+      .. __: https://doi.org/10.1186/s13100-018-0144-1
+
+      **Select parameters for protein domain search** REXdb is compared with s
+      equence clusters either using blastx or diamond aligner. Diamond program
+      is about three time faster than blastx with word size 3.
+
+      **Similarity search options** By default sequence reads are compared using
+      mgblast program. Default threshold is explicitly set to 90% sequence
+      similarity spanning at least 55% of the read length (in the case of reads
+      differing in length it applies to the longer one). Additionally, sequence
+      overlap must be at least 55 nt. If you select option for shorter reads
+      than 100 nt,  minimum overlap 55 nt is not required.
+
+      By default,
+      mgblast search use DUST program to filter out
+      low-complexity sequences. If you want
+      to increase sensitivity of detection of satellites with shorter monomer
+      use option with '*no masking of low complexity repeats*'. Note that omitting
+      DUST filtering will significantly increase running times
+     
+
+      **Automatic filtering of abundant satellite repeats** perform clustering on
+      smaller dataset of sequence reads to detect abundant high confidence
+      satellite repeats. If such satellites are detected, sequence reads derived
+      from these satellites are depleted from input dataset. This step enable more
+      sensitive detection of less abundant repeats as more reads can be used
+      in clustering step.
+
+      **Use custom repeat database**. This option allows users to perform similarity
+      comparison of identified repeats to their custom databases. The repeat class must
+      be encoded in FASTA headers of database entries in order to allow correct 
+      parsing of similarity hits. Required format for custom database sequence name is: ::
+
+        >reapeatname#class/subclass
+
+
+      **Output**
+
+      List of clusters identified as putative satellite repeats, their genomic
+      abundance and various cluster characteristics. 
+
+      Output includes a **HTML summary** with table listing of all analyzed
+      clusters. More detailed information about clusters is provided in
+      additional files and directories. All results are also provided as
+      downloadable **zip archive**. Additionally a **log file** reporting
+      the progress of the computational pipeline is provided.
+      
+      ]]></help>
+  <expand macro="citations"/>
+</tool>