Skip to content

Commit

Permalink
Update tests
Browse files Browse the repository at this point in the history
  • Loading branch information
@leexgh
leexgh committed Sep 25, 2023
1 parent c7a188b commit e622c16
Show file tree
Hide file tree
Showing 28 changed files with 709 additions and 709 deletions.
10 changes: 5 additions & 5 deletions annotationPipeline/src/test/java/org/cbioportal/annotation/SpringBatchIntegrationTest.java
View file
Original file line number Diff line number Diff line change
Expand Up @@ -68,7 +68,7 @@ public void check_if_maf_file_still_the_same_when_annotating_with_uniprot_transc
JobParameters jobParameters = new JobParametersBuilder()
.addString("filename", inputFile)
.addString("outputFilename", actualFile)
.addString("replace", String.valueOf(false))
.addString("replace", String.valueOf(true))
.addString("isoformOverride", "uniprot")
.addString("errorReportLocation", null)
.toJobParameters();
Expand All @@ -85,7 +85,7 @@ public void check_if_maf_file_still_the_same_when_annotating_with_mskcc_transcri
JobParameters jobParameters = new JobParametersBuilder()
.addString("filename", inputFile)
.addString("outputFilename", actualFile)
.addString("replace", String.valueOf(false))
.addString("replace", String.valueOf(true))
.addString("isoformOverride", "mskcc")
.addString("errorReportLocation", null)
.toJobParameters();
Expand Down Expand Up @@ -192,7 +192,7 @@ public void run_vcf2maf_test_case_mskcc() throws Exception {
JobParameters jobParameters = new JobParametersBuilder()
.addString("filename", inputFile)
.addString("outputFilename", actualFile)
.addString("replace", String.valueOf(false))
.addString("replace", String.valueOf(true))
.addString("isoformOverride", "mskcc")
.addString("errorReportLocation", null)
.toJobParameters();
Expand All @@ -214,7 +214,7 @@ public void run_vcf2maf_test_case_uniprot() throws Exception {
JobParameters jobParameters = new JobParametersBuilder()
.addString("filename", inputFile)
.addString("outputFilename", actualFile)
.addString("replace", String.valueOf(false))
.addString("replace", String.valueOf(true))
.addString("isoformOverride", "uniprot")
.addString("errorReportLocation", null)
.toJobParameters();
Expand Down Expand Up @@ -248,7 +248,7 @@ public void check_if_nucleotide_context_provides_Ref_Tri_and_Var_Tri_columns() t
JobParameters jobParameters = new JobParametersBuilder()
.addString("filename", inputFile)
.addString("outputFilename", actualFile)
.addString("replace", String.valueOf(false))
.addString("replace", String.valueOf(true))
.addString("isoformOverride", "uniprot")
.addString("errorReportLocation", null)
.toJobParameters();
Expand Down
6 changes: 3 additions & 3 deletions annotationPipeline/src/test/resources/expected/corner_cases.mskcc.txt
View file
Original file line number Diff line number Diff line change
@@ -1,5 +1,5 @@
#genome_nexus_version: 1.0.2
#isoform: mskcc
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Annotation_Status
MET 4233 GRCh37 7 116411872 116411900 + splice_region_variant,intron_variant Splice_Region DEL TAACAAGCTCTTTCTTTCTCTCTGTTTTA - - ENST00000397752.3:c.2888-31_2888-3del p.X963_splice ENST00000397752 NM_000245.2 963 SUCCESS
PCM1 5108 GRCh37 8 17796382 17796383 + missense_variant Missense_Mutation DNP AC GT GT rs754721723 ENST00000325083.8:c.476_477inv p.Asn159Ser p.N159S ENST00000325083 NM_006197.3 159 aAC/aGT 5/39 SUCCESS
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number genomic_location_explanation Annotation_Status
MET 4233 GRCh37 7 116411872 116411900 + splice_region_variant,intron_variant Splice_Region DEL TAACAAGCTCTTTCTTTCTCTCTGTTTTA - - ENST00000397752.3:c.2888-31_2888-3del p.X963_splice ENST00000397752 NM_000245.2 963 SUCCESS
PCM1 5108 GRCh37 8 17796382 17796383 + missense_variant Missense_Mutation DNP AC GT GT rs754721723 ENST00000325083.8:c.476_477inv p.Asn159Ser p.N159S ENST00000325083 NM_006197.3 159 aAC/aGT 5/39 SUCCESS
8 changes: 4 additions & 4 deletions annotationPipeline/src/test/resources/expected/corner_cases.two_tumor_seq_allele.mskcc.txt
View file
Original file line number Diff line number Diff line change
@@ -1,6 +1,6 @@
#genome_nexus_version: 1.0.2
#isoform: mskcc
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Annotation_Status
PCM1 5108 GRCh37 8 17796382 17796383 + frameshift_variant Frame_Shift_Ins INS - AAC A ENST00000325083.8:c.476dup p.Asn159LysfsTer14 p.N159Kfs*14 ENST00000325083 NM_006197.3 159 aac/aaAc 5/39 SUCCESS
KMT2D 8085 GRCh37 12 49435045 49435045 + missense_variant Missense_Mutation SNP G C C rs758743247 ENST00000301067.7:c.6508C>G p.Gln2170Glu p.Q2170E ENST00000301067 NM_003482.3 2170 Caa/Gaa 31/54 SUCCESS
PCM1 5108 GRCh37 8 17796382 17796383 + missense_variant Missense_Mutation DNP AC AC GT rs754721723 ENST00000325083.8:c.476_477inv p.Asn159Ser p.N159S ENST00000325083 NM_006197.3 159 aAC/aGT 5/39 SUCCESS
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number genomic_location_explanation Annotation_Status
PCM1 5108 GRCh37 8 17796382 17796383 + frameshift_variant Frame_Shift_Ins INS - AAC A ENST00000325083.8:c.476dup p.Asn159LysfsTer14 p.N159Kfs*14 ENST00000325083 NM_006197.3 159 aac/aaAc 5/39 Start position changes from 17796382 to 17796383 is attributed to the presence of common bases A. Reference allele changes from AC to C is attributed to the presence of common bases A. Variant allele changes from AAC to AC is attributed to the presence of common bases A. SUCCESS
KMT2D 8085 GRCh37 12 49435045 49435045 + missense_variant Missense_Mutation SNP G C C rs758743247 ENST00000301067.7:c.6508C>G p.Gln2170Glu p.Q2170E ENST00000301067 NM_003482.3 2170 Caa/Gaa 31/54 SUCCESS
PCM1 5108 GRCh37 8 17796382 17796383 + missense_variant Missense_Mutation DNP AC AC GT rs754721723 ENST00000325083.8:c.476_477inv p.Asn159Ser p.N159S ENST00000325083 NM_006197.3 159 aAC/aGT 5/39 Start position changes from 17796381 to 17796382 is attributed to the presence of common bases A. Reference allele changes from AAC to AC is attributed to the presence of common bases A. Variant allele changes from AGT to GT is attributed to the presence of common bases A. SUCCESS
8 changes: 4 additions & 4 deletions annotationPipeline/src/test/resources/expected/corner_cases.two_tumor_seq_allele.uniprot.txt
View file
Original file line number Diff line number Diff line change
@@ -1,6 +1,6 @@
#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Annotation_Status
PCM1 5108 GRCh37 8 17796382 17796383 + frameshift_variant Frame_Shift_Ins INS - AAC A ENST00000325083.8:c.476dup p.Asn159LysfsTer14 p.N159Kfs*14 ENST00000325083 NM_006197.3 159 aac/aaAc 5/39 SUCCESS
KMT2D 8085 GRCh37 12 49435045 49435045 + missense_variant Missense_Mutation SNP G C C rs758743247 ENST00000301067.7:c.6508C>G p.Gln2170Glu p.Q2170E ENST00000301067 NM_003482.3 2170 Caa/Gaa 31/54 SUCCESS
PCM1 5108 GRCh37 8 17796382 17796383 + missense_variant Missense_Mutation DNP AC AC GT rs754721723 ENST00000325083.8:c.476_477inv p.Asn159Ser p.N159S ENST00000325083 NM_006197.3 159 aAC/aGT 5/39 SUCCESS
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number genomic_location_explanation Annotation_Status
PCM1 5108 GRCh37 8 17796382 17796383 + frameshift_variant Frame_Shift_Ins INS - AAC A ENST00000325083.8:c.476dup p.Asn159LysfsTer14 p.N159Kfs*14 ENST00000325083 NM_006197.3 159 aac/aaAc 5/39 Start position changes from 17796382 to 17796383 is attributed to the presence of common bases A. Reference allele changes from AC to C is attributed to the presence of common bases A. Variant allele changes from AAC to AC is attributed to the presence of common bases A. SUCCESS
KMT2D 8085 GRCh37 12 49435045 49435045 + missense_variant Missense_Mutation SNP G C C rs758743247 ENST00000301067.7:c.6508C>G p.Gln2170Glu p.Q2170E ENST00000301067 NM_003482.3 2170 Caa/Gaa 31/54 SUCCESS
PCM1 5108 GRCh37 8 17796382 17796383 + missense_variant Missense_Mutation DNP AC AC GT rs754721723 ENST00000325083.8:c.476_477inv p.Asn159Ser p.N159S ENST00000325083 NM_006197.3 159 aAC/aGT 5/39 Start position changes from 17796381 to 17796382 is attributed to the presence of common bases A. Reference allele changes from AAC to AC is attributed to the presence of common bases A. Variant allele changes from AGT to GT is attributed to the presence of common bases A. SUCCESS
6 changes: 3 additions & 3 deletions annotationPipeline/src/test/resources/expected/corner_cases.uniprot.txt
View file
Original file line number Diff line number Diff line change
@@ -1,5 +1,5 @@
#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Annotation_Status
MET 4233 GRCh37 7 116411872 116411900 + splice_region_variant,intron_variant Splice_Region DEL TAACAAGCTCTTTCTTTCTCTCTGTTTTA - - ENST00000397752.3:c.2888-31_2888-3del p.X963_splice ENST00000397752 NM_000245.2 963 SUCCESS
PCM1 5108 GRCh37 8 17796382 17796383 + missense_variant Missense_Mutation DNP AC GT GT rs754721723 ENST00000325083.8:c.476_477inv p.Asn159Ser p.N159S ENST00000325083 NM_006197.3 159 aAC/aGT 5/39 SUCCESS
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number genomic_location_explanation Annotation_Status
MET 4233 GRCh37 7 116411872 116411900 + splice_region_variant,intron_variant Splice_Region DEL TAACAAGCTCTTTCTTTCTCTCTGTTTTA - - ENST00000397752.3:c.2888-31_2888-3del p.X963_splice ENST00000397752 NM_000245.2 963 SUCCESS
PCM1 5108 GRCh37 8 17796382 17796383 + missense_variant Missense_Mutation DNP AC GT GT rs754721723 ENST00000325083.8:c.476_477inv p.Asn159Ser p.N159S ENST00000325083 NM_006197.3 159 aAC/aGT 5/39 SUCCESS
Loading

0 comments on commit e622c16

Please sign in to comment.