Add yellow fever virus dataset

Built from [nextclade workflow in yellow fever repo](nextstrain/yellow-fever#10)

data/nextstrain/yellow-fever/prM-E/CHANGELOG.md

@@ -0,0 +1,3 @@
+## Unreleased
+
+Initial release of yellow fever virus dataset.

data/nextstrain/yellow-fever/prM-E/README.md

@@ -0,0 +1,47 @@
+# Yellow fever virus dataset
+
+| Key               | Value                                                            |
+| ----------------- | -----------------------------------------------------------------|
+| name              | Yellow fever virus (YFV) prM-E region                            |
+| authors           | [Nextstrain](https://nextstrain.org)                             |
+| reference         | AY640589.1                                                       |
+| workflow          | <https://github.com/nextstrain/yellow-fever/tree/main/nextclade> |
+| path              | `nextstrain/yellow-fever/prM-E`                                  |
+
+## Scope of this dataset
+
+This dataset assigns genotypes to yellow fever virus samples based on
+strain and genotype information from [Mutebi et al.][] (J Virol. 2001
+Aug;75(15):6999-7008) and [Bryant et al.][] (PLoS Pathog. 2007 May 18;3(5):e75)
+
+These two papers, collectively, define 7 distinct yellow fever virus
+genotypes based on a 670 nucleotide region of the yellow fever virus
+genome, (bases 641-1310), called the prM-E region. This region
+comprises the 3' end of the pre-membrane protein (prM) gene, the
+entire membrane protein (M) gene, and the 5' end of the envelope
+protein (E) gene.
+
+(N.b., the reference sequence used in this data set is actually 672nt
+long, from bases 641-1312 of the genome reference. The 2 extra bases
+make the reference an complete open reading frame.)
+
+This dataset can be used to assign genotypes to any sequence that
+includes at least 500 bp of the prM-E region, including whole genome
+sequences. Sequence data beyond the prM-E region will be reported as an
+insertion in the Nextclade output.
+
+## Features
+
+This dataset supports:
+
+- Assignment of genotypes
+- Phylogenetic placement
+- Sequence quality control (QC)
+
+## What are Nextclade datasets
+
+Read more about Nextclade datasets in the Nextclade documentation:
+<https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html>
+
+[Mutebi et al.]: https://pubmed.ncbi.nlm.nih.gov/11435580/
+[Bryant et al.]: https://pubmed.ncbi.nlm.nih.gov/17511518/

data/nextstrain/yellow-fever/prM-E/genome_annotation.gff3

@@ -0,0 +1,5 @@
+##sequence-region prM-E 1 672
+NC_002031.1	feature	source	1	672	.	+	.	gene=nuc
+NC_002031.1	feature	gene	1	333	.	+	.	gene_name=prM
+NC_002031.1	feature	gene	109	333	.	+	.	gene_name=M
+NC_002031.1	feature	gene	334	672	.	+	.	gene_name=E

data/nextstrain/yellow-fever/prM-E/pathogen.json

@@ -0,0 +1,52 @@
+{
+  "files": {
+    "reference": "reference.fasta",
+    "pathogenJson": "pathogen.json",
+    "genomeAnnotation": "genome_annotation.gff3",
+    "treeJson": "tree.json",
+    "examples": "sequences.fasta",
+    "readme": "README.md",
+    "changelog": "CHANGELOG.md"
+  },
+  "attributes": {
+    "name": "Yellow fever virus (YFV) prM-E region",
+    "reference name": "Asibi",
+    "reference accession": "AY640589.1"
+  },
+  "schemaVersion": "3.0.0",
+  "alignmentParams": {
+      "minSeedCover": 0.01,
+      "minLength": 500
+  },
+  "qc": {
+    "missingData": {
+      "enabled": true,
+      "missingDataThreshold": 20,
+      "scoreBias": 4
+    },
+    "mixedSites": {
+      "enabled": true,
+      "mixedSitesThreshold": 4
+    },
+    "frameShifts": {
+      "enabled": true
+    },
+    "stopCodons": {
+      "enabled": true
+    },
+    "privateMutations": {
+      "enabled": true,
+      "cutoff": 8,
+      "typical": 2,
+      "weightLabeledSubstitutions": 1,
+      "weightReversionSubstitutions": 1,
+      "weightUnlabeledSubstitutions": 1
+    },
+    "snpClusters": {
+      "enabled": true,
+      "clusterCutOff": 3,
+      "scoreWeight": 50,
+      "windowSize": 50
+    }
+  }
+}

data/nextstrain/yellow-fever/prM-E/reference.fasta

@@ -0,0 +1,13 @@
+> prM-E region (genome 641-1312, 672 nt)
+CCAAGAGAGGAGCCAGATGACATTGATTGCTGGTGCTATGGGGTGGAAAACGTTAGAGTC
+GCATATGGTAAGTGTGACTCAGCAGGCAGGTCTAGGAGGTCAAGAAGGGCCATTGACTTG
+CCTACGCATGAAAACCATGGTTTGAAGACCCGGCAAGAAAAATGGATGACTGGAAGAATG
+GGTGAAAGGCAACTCCAAAAGATTGAGAGATGGCTCGTGAGGAACCCCTTTTTTGCAGTG
+ACAGCTCTGACCATTGCCTACCTTGTGGGAAGCAACATGACGCAACGAGTCGTGATTGCC
+CTACTGGTCTTGGCTGTTGGTCCGGCCTACTCAGCTCACTGCATTGGAATTACTGACAGG
+GATTTCATTGAGGGGGTGCATGGAGGAACTTGGGTTTCAGCTACCCTGGAGCAAGACAAG
+TGTGTCACTGTTATGGCCCCTGACAAGCCTTCATTGGACATCTCACTAGAGACAGTAGCC
+ATTGATGGACCTGCTGAGGCGAGGAAAGTGTGTTACAATGCAGTTCTCACTCATGTGAAG
+ATTAATGACAAGTGCCCCAGCACTGGAGAGGCCCACCTAGCTGAAGAGAACGAAGGGGAC
+AATGCGTGCAAGCGCACTTATTCTGATAGAGGCTGGGGCAATGGCTGTGGCCTATTTGGG
+AAAGGGAGCATT