update: Added google badge to all notebooks issue #266 (#275)

* fourth trt

* final file added

* update: added installation of pydna

docs/notebooks/CRISPR.ipynb

@@ -13,6 +13,26 @@
     "The `pydna.crispr` module contains the `cas9` class to simulate the biological activites of the Cas9 protein and the guideRNA, which should be imported. In addtion, the `Dseqrecord` class has also been imported to generate an example target_sequence."
    ]
   },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "<a target=\"_blank\" href=\"https://colab.research.google.com/github/BjornFJohansson/pydna/blob/dev_bjorn/docs/notebooks/CRISPR.ipynb\">\n",
+    "  <img src=\"https://colab.research.google.com/assets/colab-badge.svg\" alt=\"Open In Colab\"/>\n",
+    "</a>"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# Install pydna \n",
+    "%%capture\n",
+    "!pip install pydna"
+   ]
+  },
   {
    "cell_type": "code",
    "execution_count": null,
@@ -34,15 +54,7 @@
    "cell_type": "code",
    "execution_count": null,
    "metadata": {},
-   "outputs": [
-    {
-     "name": "stdout",
-     "output_type": "stream",
-     "text": [
-      "[]\n"
-     ]
-    }
-   ],
+   "outputs": [],
    "source": [
     "# Defining the target sequence\n",
     "sequence = Dseqrecord(\"GTTACTTTACCCGACGTCCCCGG\")\n",
@@ -56,15 +68,7 @@
    "cell_type": "code",
    "execution_count": null,
    "metadata": {},
-   "outputs": [
-    {
-     "name": "stdout",
-     "output_type": "stream",
-     "text": [
-      "0\n"
-     ]
-    }
-   ],
+   "outputs": [],
    "source": [
     "# Initializing the Cas9 protein\n",
     "enzyme = cas9(protospacer=gRNA_sequence[0])\n",
@@ -95,7 +99,7 @@
    "name": "python",
    "nbconvert_exporter": "python",
    "pygments_lexer": "ipython3",
-   "version": "3.12.4"
+   "version": "3.11.9"
   }
  },
  "nbformat": 4,

docs/notebooks/Dseq.ipynb

@@ -8,6 +8,26 @@
     "> Visit the full library documentation [here](https://bjornfjohansson.github.io/pydna/)"
    ]
   },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "<a target=\"_blank\" href=\"https://colab.research.google.com/github/BjornFJohansson/pydna/blob/dev_bjorn/docs/notebooks/Dseq.ipynb\">\n",
+    "  <img src=\"https://colab.research.google.com/assets/colab-badge.svg\" alt=\"Open In Colab\"/>\n",
+    "</a>"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# Install pydna \n",
+    "%%capture\n",
+    "!pip install pydna"
+   ]
+  },
   {
    "cell_type": "markdown",
    "metadata": {},

docs/notebooks/Dseq_Features.ipynb

@@ -15,6 +15,26 @@
     "pydna offers many ways to easily view, add, extract, and write features into a Genbank file via the `Dseqrecord` class. After reading a file into a `Dseqrecord` object, we can check out the list of features in the record using the following code. This example uses the sample record [U49845](https://www.ncbi.nlm.nih.gov/genbank/samplerecord/)."
    ]
   },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "<a target=\"_blank\" href=\"https://colab.research.google.com/github/BjornFJohansson/pydna/blob/dev_bjorn/docs/notebooks/Dseq_Features.ipynb\">\n",
+    "  <img src=\"https://colab.research.google.com/assets/colab-badge.svg\" alt=\"Open In Colab\"/>\n",
+    "</a>"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# Install pydna \n",
+    "%%capture\n",
+    "!pip install pydna"
+   ]
+  },
   {
    "cell_type": "code",
    "execution_count": null,
@@ -788,7 +808,7 @@
    "name": "python",
    "nbconvert_exporter": "python",
    "pygments_lexer": "ipython3",
-   "version": "3.12.5"
+   "version": "3.11.9"
   }
  },
  "nbformat": 4,

docs/notebooks/Example_Restriction.ipynb

@@ -16,6 +16,26 @@
     "Source files can be found alongside this notebook, if you would like to follow along. Annotations are made alongside the code to describe key steps."
    ]
   },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "<a target=\"_blank\" href=\"https://colab.research.google.com/github/BjornFJohansson/pydna/blob/dev_bjorn/docs/notebooks/Example_Restriction.ipynb\">\n",
+    "  <img src=\"https://colab.research.google.com/assets/colab-badge.svg\" alt=\"Open In Colab\"/>\n",
+    "</a>"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# Install pydna \n",
+    "%%capture\n",
+    "!pip install pydna"
+   ]
+  },
   {
    "cell_type": "code",
    "execution_count": null,

docs/notebooks/Gibson.ipynb

@@ -17,6 +17,26 @@
     "  * `algorithm`: the function used to find homology regions between DNA fragments. For Gibson Assembly, we use the `terminal_overlap` function, which finds homology regions only at the terminal regions. By default, the `Assembly` class uses the `common_sub_strings` function to find homology regions, which finds homology anywhere, as it could happen in a homologous recombination event.\n"
    ]
   },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "<a target=\"_blank\" href=\"https://colab.research.google.com/github/BjornFJohansson/pydna/blob/dev_bjorn/docs/notebooks/Gibson.ipynb\">\n",
+    "  <img src=\"https://colab.research.google.com/assets/colab-badge.svg\" alt=\"Open In Colab\"/>\n",
+    "</a>"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# Install pydna \n",
+    "%%capture\n",
+    "!pip install pydna"
+   ]
+  },
   {
    "cell_type": "code",
    "execution_count": null,

docs/notebooks/Importing_Seqs.ipynb

@@ -19,6 +19,26 @@
     "The following code shows an example of how to use the `parse` function to import a FASTA file."
    ]
   },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "<a target=\"_blank\" href=\"https://colab.research.google.com/github/BjornFJohansson/pydna/blob/dev_bjorn/docs/notebooks/Importing_Seqs.ipynb\">\n",
+    "  <img src=\"https://colab.research.google.com/assets/colab-badge.svg\" alt=\"Open In Colab\"/>\n",
+    "</a>"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# Install pydna \n",
+    "%%capture\n",
+    "!pip install pydna"
+   ]
+  },
   {
    "cell_type": "code",
    "execution_count": null,

docs/notebooks/PCR.ipynb

@@ -17,6 +17,26 @@
     "The following example uses a 300+ bp custom sample circular DNA, containing an example gene that we would like to clone. 18 bp forward and reverse primers have been provided. "
    ]
   },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "<a target=\"_blank\" href=\"https://colab.research.google.com/github/BjornFJohansson/pydna/blob/dev_bjorn/docs/notebooks/PCR.ipynb\">\n",
+    "  <img src=\"https://colab.research.google.com/assets/colab-badge.svg\" alt=\"Open In Colab\"/>\n",
+    "</a>"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# Install pydna \n",
+    "%%capture\n",
+    "!pip install pydna"
+   ]
+  },
   {
    "cell_type": "code",
    "execution_count": null,

docs/notebooks/Restrict_Ligate_Cloning.ipynb

@@ -14,6 +14,26 @@
     "Restriction enzymes recognise specific DNA sequences and cut them, leaving sticky ends or blunt ends. To cut a sequence using `pydna`, we can use the `cut` method on a `Dseqrecord` object. Here is an example showing how to use the `cut` method to genenrate EcoRI restriction digests. The record includes a 338bp circular sequence, with an example gene feature."
    ]
   },
+  {
+   "cell_type": "markdown",
+   "metadata": {},
+   "source": [
+    "<a target=\"_blank\" href=\"https://colab.research.google.com/github/BjornFJohansson/pydna/blob/dev_bjorn/docs/notebooks/Restrict_Ligate_Cloning.ipynb\">\n",
+    "  <img src=\"https://colab.research.google.com/assets/colab-badge.svg\" alt=\"Open In Colab\"/>\n",
+    "</a>"
+   ]
+  },
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "# Install pydna \n",
+    "%%capture\n",
+    "!pip install pydna"
+   ]
+  },
   {
    "cell_type": "code",
    "execution_count": null,