Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Repeatexplorer #89

Merged
merged 25 commits into from
Nov 2, 2023
Merged
Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
25 commits
Select commit Hold shift + click to select a range
d418c0e
submodule added
kavonrtep Jul 27, 2023
ad7dac6
patch existing wrapper from kavonrtep/galaxy_packages
TomHarrop Nov 1, 2023
10a058a
add macros
TomHarrop Nov 1, 2023
cbdcda9
Update repex_full_clustering.xml
bgruening Nov 1, 2023
49c6641
Update tools/repeatexplorer2/repex_full_clustering.xml
TomHarrop Nov 2, 2023
88b806c
removing additional wrapper, it's at kavonrtep/galaxy_package if we w…
TomHarrop Nov 2, 2023
52a6ddc
shed.yml
TomHarrop Nov 2, 2023
6cd38bc
shed.yml
TomHarrop Nov 2, 2023
b86f302
remove nested conditionals, they are handled in command section
TomHarrop Nov 2, 2023
d172a83
inital basic test. no advanced params yet
TomHarrop Nov 2, 2023
f6d4dd2
pick up html source files
TomHarrop Nov 2, 2023
983e4b3
output directly to extra_files_path
TomHarrop Nov 2, 2023
1d73338
fix ram and quote
TomHarrop Nov 2, 2023
7e23a7c
start on advanced params
TomHarrop Nov 2, 2023
271a6b2
add a couple of advanced params
TomHarrop Nov 2, 2023
8d5a33b
quotes
TomHarrop Nov 2, 2023
21b8459
Update tools/repeatexplorer2/repex_full_clustering.xml
TomHarrop Nov 2, 2023
123bf41
Update tools/repeatexplorer2/repex_full_clustering.xml
TomHarrop Nov 2, 2023
4dc48f9
Update tools/repeatexplorer2/repex_full_clustering.xml
TomHarrop Nov 2, 2023
c5d1389
Update tools/repeatexplorer2/repex_full_clustering.xml
TomHarrop Nov 2, 2023
3299c98
Update tools/repeatexplorer2/repex_full_clustering.xml
TomHarrop Nov 2, 2023
65dcd49
changes from review
TomHarrop Nov 2, 2023
6b802ae
changes from review
TomHarrop Nov 2, 2023
4dbe5d1
add creators
TomHarrop Nov 2, 2023
662acf5
don't compare files
TomHarrop Nov 2, 2023
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
20 changes: 20 additions & 0 deletions tools/repeatexplorer2/.shed.yml
Original file line number Diff line number Diff line change
@@ -0,0 +1,20 @@
---
Copy link
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Can you convert that to a suite of tools?
In the original repo there have been two tools at least isn't it?

Copy link
Contributor Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I converted it to a suite.

BTW @bgruening it looked to me like the second wrapper runs the same command as the first with an additional option tarean_mode, so we can just include that function in this wrapper if we want it.

Copy link
Contributor Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

(probably)

Copy link
Contributor

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Yes, lets do that then. In general a suite can not hurt, so its fine to have it as suite in case we ever want to extend it. Thanks

auto_tool_repositories:
name_template: "{{ tool_id }}"
description_template: "{{ tool_name }} from the cactus suite"
categories:
- Genome annotation
description: Tool for annotation of repeats from unassembled shotgun reads.
homepage_url: https://github.com/repeatexplorer/repex_tarean
long_description: |
Tool for annotation of repeats from unassembled shotgun reads.
name: repeatexplorer2
owner: gga
remote_repository_url: https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/repeatexplorer2
suite:
name: suite_repeatexplorer2
description: >
Tool for annotation of repeats from unassembled shotgun reads.
long_description: >
Tool for annotation of repeats from unassembled shotgun reads.
type: unrestricted
29 changes: 29 additions & 0 deletions tools/repeatexplorer2/macros.xml
Original file line number Diff line number Diff line change
@@ -0,0 +1,29 @@
<macros>
<token name="@TOOL_VERSION@">2.3.8</token>
<token name="@VERSION_SUFFIX@">0</token>
<token name="@PROFILE@">23.0</token>
<xml name="requirements">
<requirements>
<container type="docker">kavonrtep/repeatexplorer:@TOOL_VERSION@</container>
</requirements>
</xml>
<xml name="citations">
<citations>
<citation type="bibtex">@software{repeatexplorer2,
author = {repeatexplorer},
year = {2023},
title = {repeatexplorer2},
publisher = {GitHub},
url = {https://github.com/repeatexplorer/repex_tarean}
}</citation>
</citations>
</xml>
<xml name="creator">
<creator>
<person name="Petr Novak" />
<organization name="Laboratory of Molecular Cytogenetics" url="http://w3lamc.umbr.cas.cz/lamc" address="Institute of Plant Molecular Biology, Biology Centre CAS, Branisovska 31, Ceske Budejoice, Czech Republic"/>
<person name="Tom Harrop"/>
<organization name="Galaxy Australia" url="https://site.usegalaxy.org.au"/>
</creator>
</xml>
</macros>
240 changes: 240 additions & 0 deletions tools/repeatexplorer2/repex_full_clustering.xml
Original file line number Diff line number Diff line change
@@ -0,0 +1,240 @@
<tool id="repeatexplorer_clusterin" name="RepeatExplorer (clustering)" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
<description>repeat discovery and characterization using graph-based sequence clustering</description>
<macros>
<import>macros.xml</import>
</macros>
<expand macro="creator"/>
<expand macro="requirements"/>
<command><![CDATA[

export GALAXY_MEMORY_KB=\$((\${GALAXY_MEMORY_MB:-8192}*1024))
&&

export PYTHONHASHSEED=0
&&

## output will go here
mkdir -p '${reportfile.extra_files_path}'
&&

/repex_tarean/seqclust
--cpu \${GALAXY_SLOTS:-1}
--max_memory \${GALAXY_MEMORY_KB}
'${paired}'
#if $sample:
--sample '${sample}'
#end if
--taxon '${taxon}'
--output_dir='${reportfile.extra_files_path}'
#if $advanced.mincl:
--mincl '${advanced.mincl}'
#end if
--assembly_min '${advanced.assembly_min}'
#if $advanced.keep_names:
--keep_names
#end if
'${fastafile}'
&&

## pick up the html index
cp '${reportfile.extra_files_path}/index.html' ./index.html

]]></command>
<inputs>
<param name="fastafile" label="NGS reads" type="data" format="fasta" help="Input file must contain FASTA-formatted NGS reads. Illumina paired-end reads are recommended."/>
<param argument="--paired" type="boolean" truevalue="--paired" falsevalue="" checked="True" label="Paired-end reads" help="If paired-end reads are used, they must be interleaved and all pairs must be complete. Example of the correct format is provided in the help below."/>
<param argument="--sample" type="integer" min="2" optional="true" label="Subsample reads (number)" help="Use an integer &gt; 1 to select a specific number of reads to use. Leave this field blank to use the entire dataset."/>
<param argument="--taxon" label="Select taxon and protein domain database version (REXdb)" type="select" help="Reference database of transposable element protein domains - REXdb - is used for annotation of repeats">
<option value="VIRIDIPLANTAE3.0" selected="true">Viridiplantae version 3.0</option>
<option value="VIRIDIPLANTAE2.2" selected="true">Viridiplantae version 2.2</option>
<option value="METAZOA3.0">Metazoa version 3.0</option>
<option value="METAZOA2.0">Metazoa version 2.0</option>
</param>
<section name="advanced" title="Advanced options" expanded="false">
<param argument="--mincl" label="Cluster size threshold for detailed analysis" type="float" value="" min="0.0001" max="100" optional="true" help="Minimal size (as percentage of input reads) of the smallest cluster which is analyzed; clusters with less than 20 reads are not considered."/>
<param argument="--assembly_min" type="integer" label="Minimal cluster size for assembly" value="5" min="2" max="100"/>
<param argument="--keep_names" label="Keep original read names" type="boolean" checked="false" help="By default, reads are renamed using integers. Use this option to keep original names."/>
</section>
</inputs>
<outputs>
<data name="reportfile" format="html" from_work_dir="index.html" label="RepeatExplorer - HTML report on ${on_string}"/>
</outputs>
<tests>
<!-- test1: basic function -->
<test expect_num_outputs="1">
<param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/>
<param name="paired" value="True"/>
<param name="taxon" value="VIRIDIPLANTAE3.0"/>
<output name="reportfile">
<assert_contents>
<has_text text="Clustering summary"/>
</assert_contents>
</output>
</test>
<!-- test2: read subsample -->
<test expect_num_outputs="1">
<param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/>
<param name="paired" value="True"/>
<param name="sample" value="5000"/>
<param name="taxon" value="VIRIDIPLANTAE3.0"/>
<output name="reportfile">
<assert_contents>
<has_text text="Clustering summary"/>
</assert_contents>
</output>
</test>
<!-- test3: advanced params -->
<test expect_num_outputs="1">
<param name="fastafile" value="LAS_paired_10k.fa.gz" ftype="fasta.gz"/>
<param name="paired" value="True"/>
<param name="taxon" value="VIRIDIPLANTAE3.0"/>
<param name="mincl" value="0.01"/>
<param name="keep_names" value="True"/>
<output name="reportfile">
<assert_contents>
<has_text text="Clustering summary"/>
</assert_contents>
</output>
</test>
</tests>
<help><![CDATA[
**HELP**

RepeatExplorer2 clustering is a computational pipeline for unsupervised
identification of repeats from unassembled sequence reads. The
pipeline uses low-pass whole genome sequence reads and performs graph-based
clustering. Resulting clusters, representing all types of repeats, are then
examined to identify and classify into repeats groups.

**Input data**

The analysis requires either **single** or **paired-end reads** generated
by whole genome shotgun sequencing provided as a single fasta-formatted file.
Generally, paired-end reads provide significantly better results than single
reads. Reads should be of uniform length (optimal size range is 100-200 nt) and
the number of analyzed reads should represent less than 1x genome equivalent
(genome coverage of 0.01 - 0.50 x is recommended). Reads should be
quality-filtered (recommended filtering : quality score >=10 over 95% of bases
and no Ns allowed) and only **complete read pairs** should be submitted for
analysis. When paired reads are used, input data must be **interlaced** format
as fasta file:

example of interlaced input format::

>0001_f
CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
>0001_r
GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
>0002_f
ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
>0002_r
TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
>0003_f
TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
>0003_r
TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
...


**Comparative analysis**

For comparative analysis sequence names must contain code (prefix) for each group.
Prefix in sequences names must be of fixed length.

Example of labeling two groups with where **group code length** is 2 and is used to distinguish groups - AA and BB ::

>AA0001_f
CGTAATATACATACTTGCTAGCTAGTTGGATGCATCCAACTTGCAAGCTAGTTTGATG
>AA0001_r
GATTTGACGGACACACTAACTAGCTAGTTGCATCTAAGCGGGCACACTAACTAACTAT
>AA0002_f
ACTCATTTGGACTTAACTTTGATAATAAAAACTTAAAAAGGTTTCTGCACATGAATCG
>AA0002_r
TATGTTGAAAAATTGAATTTCGGGACGAAACAGCGTCTATCGTCACGACATAGTGCTC
>BB0001_f
TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
>BB0001_r
TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT
>BB0002_f
TGACATTTGTGAACGTTAATGTTCAACAAATCTTTCCAATGTCTTTTTATCTTATCAT
>BB0002_r
TATTGAAATACTGGACACAAATTGGAAATGAAACCTTGTGAGTTATTCAATTTATGTT


To prepare quality filtered and interlaced input fasta file from fastq
files, use `Preprocessing of paired-reads`__ tool.

.. __: tool_runner?tool_id=paired_fastq_filtering


**Additional parameters**

**Sample size** defines how many reads should be used in calculation.
Default setting with 500,000 reads will enable detection of high copy
repeats within several hours of computation time. For higher
sensitivity the sample size can be set higher. Since sample size affects
the memory usage, this parameter may be automatically adjusted to lower
value during the run. Maximum sample size which can be processed depends on
the repetitiveness of analyzed genome.


**Select taxon and protein domain database version (REXdb)**. Classification
of transposable elements is based on the similarity to our reference database
of transposable element protein domains (**REXdb**). Standalone database for Viridiplantae species
can be obtained on `repeatexplorer.org`__. Classification
system used in REXdb is described in article `Systematic survey of plant
LTR-retrotransposons elucidates phylogenetic relationships of their
polyprotein domains and provides a reference for element classification`__
Database for Metazoa species is still under development so use it with caution.

.. __: http://repeatexplorer.org
.. __: https://doi.org/10.1186/s13100-018-0144-1

**Select parameters for protein domain search** REXdb is compared with s
equence clusters either using blastx or diamond aligner. Diamond program
is about three time faster than blastx with word size 3.

**Similarity search options** By default sequence reads are compared using
mgblast program. Default threshold is explicitly set to 90% sequence
similarity spanning at least 55% of the read length (in the case of reads
differing in length it applies to the longer one). Additionally, sequence
overlap must be at least 55 nt. If you select option for shorter reads
than 100 nt, minimum overlap 55 nt is not required.

By default,
mgblast search use DUST program to filter out
low-complexity sequences. If you want
to increase sensitivity of detection of satellites with shorter monomer
use option with '*no masking of low complexity repeats*'. Note that omitting
DUST filtering will significantly increase running times


**Automatic filtering of abundant satellite repeats** perform clustering on
smaller dataset of sequence reads to detect abundant high confidence
satellite repeats. If such satellites are detected, sequence reads derived
from these satellites are depleted from input dataset. This step enable more
sensitive detection of less abundant repeats as more reads can be used
in clustering step.

**Use custom repeat database**. This option allows users to perform similarity
comparison of identified repeats to their custom databases. The repeat class must
be encoded in FASTA headers of database entries in order to allow correct
parsing of similarity hits. Required format for custom database sequence name is: ::

>reapeatname#class/subclass


**Output**

List of clusters identified as putative satellite repeats, their genomic
abundance and various cluster characteristics.

Output includes a **HTML summary** with table listing of all analyzed
clusters. More detailed information about clusters is provided in
additional files and directories. All results are also provided as
downloadable **zip archive**. Additionally a **log file** reporting
the progress of the computational pipeline is provided.

]]></help>
<expand macro="citations"/>
</tool>
Binary file not shown.